%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf SKUMMET_JULETREKK_GAMMEL NISSE_2 2017-11-10T16:35:23+01:00 2017-11-10T16:35:23+01:00 2017-11-10T16:35:23+01:00 Adobe Illustrator CC 22.0 (Macintosh) 228 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAADkAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYq4kAVJoPHFVvqx/zj7ximi71Y/5x94xWi71Y/wCcfeMVou9WP+cfeMVou9WP+cfeMVou 9WP+cfeMVou9WP8AnH3jFaK1ri3UqGlRSxooLAVPtikRPctF7ZmlJ4zyNFo67nwG/vivBLucL2zN KTxnkaL8a7keG+K8Eu5ZLqNskYaN0mYmiojoCflyYDG2Qxm99kKnmGxLBXV4idgWClSemzKWBwWz OnkotLNqVxW2LLAq8eZkMZV67uEUksadmpizoQG/NOcLiuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ku xV2KqVyAYwDuOaf8TGLKPNf6Uf8AIPuGKLLvSj/kH3DFbLvSj/kH3DFbLvSj/kH3DFbLvSj/AJB9 wxWy70o/5B9wxWy70o/5B9wxWy70o/5B9wxWy70o/wCQfcMVsu9KP+QfcMVsu9KP+QfcMVsqUsML TRVjU0LEVA60xZCRooa+0oTzLNH6aOqstWSpBNPiBUqeQpgpnjy0KKPQFVAJLEAAsep98LSW8Vdi rsVdirsVdirsVdirsVdirsVdirsVdiqncf3Y/wBdP+JjFlHmqYsXYq7FXVGKuxV2KuxV2KuJAFSa DxOKqS3dq0hjWZDItaqGFRTr92LIwNXSqCD0PXcYsVN/76L/AGX6sWQ5FUxYuxV2KuxV2KuxV2Ku xV2KuxV2KuxV2KuxV2KuxVTuP7sf66f8TGLKPNZfpG9nMkhRVZSvKQgKCdlrX3xTjJEhSAl4LJMY L2GFf91IHAVfhCHkvTrgbhyFglZDFOVVf0grTqNlExYVPICu1T8ZX9WKSR/N29y021yzMDexmXmw jJfkQWdaACm32OnjivEO40mVvLYxR0SSJeVXajggk1LGp69DhaZCRPVUW8tGrxnjNByNGXoO/Xpi x4JdzYurYsVEyFhsQGFRSpP6sV4D3L0dHXkjBl33BqNtjigikm1W6mnhNuIFpK7RxSF2qHjJBqoQ /wAp79MBcnFAA3f4+aTkRMh4xWqMoV9mm5U4GQEAgj7IwOTv3y+z3J9ptwrm3YW8aq6NHFKj824p ua/Au1ffrhDiZY1e6YP/AH0X+y/VhaRyKpixdirsVdirsVdirsVdirsVdirsVdirsVdirsVdiqnc f3Y/10/4mMWUebc0Mc0fpyCqkgkf6pDD8RiiMiNwopp9uooK0qx69OTKx/FRiyOQtDTLQSLIFIZA AN/5W5j8caT4sqpaNJtAxccw/wDMGO3xc9vD4t8FJ8YrTomm0I9Lrv1770P0V2xpPjy71VNOtlha GhMbLwIJ/ZrWmGmJyG7U00i0Svp8kUty4g7dCv6mwUk5pHmioIEghWKOvBNlBNaDwwtcpWbKHl08 PKXEpUFvUCgKaNx4kgkHqMFMxkoclD9A2+1ZXIAIAKw9CvCn93/KKY0z/MHu+/8AWiLSwFu/L1C/ FSqAgCgJBbp40GFhPJas/wDfRf7L9WLEciqYsXYq7FXYq7FVCI3LxI/NByUNTge4r/NizNAr+Nz/ AL8T/gD/AM1Yo2dxuf8Afif8Af8AmrFdncbn/fif8Af+asV2dxuf9+J/wB/5qxXZ3G5/34n/AAB/ 5qxXZ3G5/wB+J/wB/wCasV2dxuf9+J/wB/5qxXZ3G5/34n/AH/mrFdncbn/fif8AAH/mrFdncbn/ AH4n/AH/AJqxXZSufXVFLOhHqRggKQd5FHXkcWUa+9E4tbsVdirsVdirsVdirsVdirsVdiqm/wDf Rf7L9WLIciqYsXYq7FXYq7FVO1/3mi/1F/ViylzKpixdirsVdirsVdirsVdirsVdiqhef3K/8ZYv +Tq4s4c/gfuV8WDsVdirsVdirsVdirsVdirsVdiqm/8AfRf7L9WLIciqYsXYq7FXYq7FVO1/3mi/ 1F/ViylzKpixdirsVQmp6xpGlW/1jVL63sLf/f11KkKbCv2nKjFUDp3nXybqc3oabr2nX03++ra7 glb/AIFHY4qj7fVdMuTILa8gmMIrL6ciPwH+VQmn04qiUdHUOjBlO4YGoP0jFW8VdirsVULz+5X/ AIyxf8nVxZw5/A/cr4sHYq7FXYq7FWMar+ZvkLS2kW61q3Z4tpY7ctdOh8GS3ErKfYjIymBzLZDF OZqIJPkkx/PX8uiwCXc7xkV9X6tMoH+xdUff/VyHjw7w5H8naj/U5/6Uqy/nb+WzRc01OQmtOBtb pDUdd3iVfx+WJzw7wgaDOTXBK/6pZT5f8w6R5g0xNS0qf17R2ZA5VkIZDxZSrhTsf7NssBBFhxpR MSQdiExwsXYqpv8A30X+y/ViyHIqmLF2KuxV2KuxVTtf95ov9Rf1YspcyqYsXYqwX81fzHHlHTY4 LJFm1u+VvqqvvHEi0DTSDatCaKv7R9gxFWbKIRsuXotHPUZBCP8AYHzbqOp6jqV699qN1LeXsgo9 zM3KQgmvGuwVa9FUBR2AzT5c8p8y99o+y8OAChcu88/2fBBzPGlvK0u8KoWlWhaoHbiOuDECTsaK dflxwheSHHH3A1+P7V80DlmjuIHWSEcXinjZHj5APQpIqstRQ9N9sskMkTVmz5uLiyaLNAz4Y8Mb /hHQWaHOt3rX5Z2/mDyJp1x5k1CwuP0FqCQpBZwNCGked/UW5dGdUj4oCByYM7Oq0rTNlhhKA9Rt 47tDUYs0wccODZ6jon5p+QtbuUtrDV42nkjWVFmSWAMHHIBHmVEZqdVUkjuMvEgTThGEgASNiyoG u46YWLsVULz+5X/jLF/ydXFnDn8D9yviwdiqA1fX9D0aAz6tqFvYRBS3O4lSOoUVNORFfoxV5F5o /wCchXJeDy1ZAKDRb69BqR3KwAqVqPsl2qP2k7Zh5dbGOw3d7ouwM2UCUvRHz5/L9bzDW/OvmzXV ePVdUuLuB6h7csEhZT2aGMJEaf6mYM9XOXWnosHYWmx8xxHz/V/akrfAtXIRFH2mPFQAPE7dMpEZ SO25dhPPgwQ3MYx/HIJt5W0H9Oa/+iTcC1aKNbi5do5ZSsTHbgkSsZHIPJVBFVqagDMnHpes/SHS 672ghEcOH1S7+g/X+ObKtb/L3y3buZNK1i5uEVQWtLixkikUuQqeqzvDInJjx5egRXrTL/y2I7i3 UDt/VCNHhvvrf9X2Ml8qR6zo9hJpOiz3FuDIbmaHgHnZ3VQVlgVZZ4eKqKNGpU9StScuhOhQ5eX6 3U5ZGcjKXMnf+x6Rp1/5zuJrRVtY47KqC5muo2EhjX7ZDc4X9Ru1bdVrlsZSJ3FBpIHeyjLWKm/9 9F/sv1YshyKpixdirsVdirsVQunXtncafHcQTxzQBKGWN1ZAVFG+IGm1N8WUuZQ2neZ/Lep3LWun arZ3tygLNBbzxSuFGxbijE0rtXFimeKvnT/nIBbj/HcTOG9M6dB6Tb8OAlm28OQYtX2IzXa8HZ6v 2YnEGYP1Gv08nmbvGjIrsEaQ0QMQOR9q5gRxyPIF6bJrMMDUpxB94b5Bbgwc19dRyMYYcgK0qQDt vhOOQ5gtcNdgybCUZeXX5cy9u/L78vPKXmnyfo/mTzBETd26zRz8JniieC1eS3t/XWoKNHbKimhU 0ADbbZuoRsAnnT53nnwzlGNiPEa+3n50s/NLznr+p6Tfab5UtUn8nQ2yxatrEMZdOJqXiicskfoi NVWRlRxxc7rQtjmMhH0hlpMeM5I+KajY6cx8/wBbxCZHmuIreoQt+/ZmLKSIHVyF2oxP7XxDioLG ozW4IEgyHPf4vU9p6uMckcMuHwyYnl9FV8Dt9h7n0f8A84//AKWPkZ2vGZrI3bjSA9aC1WONSEr0 T1lk4j7tqZscHFwDi5vMdoeH48vD+i9vx3Xy8npeXOEoXn9yv/GWL/k6uLOHP4H7lfFggtb1P9Ga Vc3wiNw8CExW6kKZZD8McYY7Dm5C1PTFXz15x8o6hc+bdRur7Vree4vYo72O4tknkiKSPLEYKxJO 1LdoOHI9RTYGoGFqcZJBs/Z+x22h7QGGPDwQl5kbsd8veRda1zX10TTxFKYgv1u8i5G2toxtV+Yh k+yBwTipf9n4astMdGZGydvtdr/ohjDEY44cMunWP6PlT13S/wAh/JekaZfTeY7qTUoopzeC5mYw rb20D+qq/AR2WsjCncKFXbM+OKMeQeby6nJkNykTvfxSHWrDSba3u7Pyb5b/AEbZsrXerajIsEdy YZXV44LVZ35W6OXrwPBlA+BAx5C0RbMOnMjEyB4T3Vf482OjTLMRix+rXFmsrG8MQE9sJGFOU7OC iyLU0aQsV7E4y4BuXZS/K1RFHu3tObfW9bstJlslv/rNoiM9pZKkAMc4QiI/WolRBGp+L4DIa03U Ag0yBmKA28/1OH+V4jxQB4fOvx9717QfMPlZPKWn6vBPDpujXMaPDJc8LRayb/Fz4ryJr8+oJG+W uuUNQ/M7yDYbS61bzMCQUtOV44INCCtsJWFD1qMVQNv+cn5d3Gq2mlpqbLd30q29qsttcxK8j/ZX lJGgHI7CvfFWYSEevEO55H7hikclXFDsVdirsVdir57/ADr8padoJ03UdGgksYNYWdNZ9KeVYJ5O MbRRyRcvTYFTK3Hp8NadcxtSZCHp5u17Lx4Zaj96Rwi+fK/N5jBczwTiaIyRTxEvDOjmNklR1Wtf hdfhMhDJXcDoGquviPD61J6PNOWroRhGWAmr/iFdfLy7+vN7R+XP5iedv0WhvLZdbgnu2ghkluTB eKVjV3CK8JjljHNTyeZaVI6DbZ6aUpwsvN6/QiGWcce8YUkcOgap578x6hr+tR3QgikP+4aPa5Wx HNYWidCyFUYbiJyXfmVPJSrQy4pSJPdyHRgM5wR4BcZH6j18gPLqe/4J9+V66d/psVhpVrZwaczW YvonR7i4XlzjacoN2aPi78mqHYrxBBzX6uxVk79GvD7kwOmap5k1TUdPfSrKTTAGtb28lDcWuU9N 7eVJPhZvSjkcFV+JZNgw+1l+DTkgEEhhPJRIY1pfkebSLq70b63NqIW59axhlUR2txPanixltz8D ycVFC23wrxFCCdljxiI25ObhEco8XIb6H5bH8e9lEK+aPMaand+ThFZ2Gp27R3MuoqTbNcGiOtsq c+YI5VlK8VrTi5qqmR6OLqMw4Rj58P8AF5Jh5T/JbyzpuktHrVtFqOrXKMlzdAycIwW5L9XDH926 UX96oDkiu3QVQxiPJpzaieSuIkgcvJR8qX+qeSdYTyhr03raPOQNA1QrwX4m4i3YD4VpUDiKBSQF +BlVJjZpel4UKF5/cr/xli/5Orizhz+B+5XxYPG9RuaaMX1N9Vm8zSiOL6sxvTEmoyyBIljialoi fWWVUenAinxEZg3nOT+jf2N/7vh81OGx84L5tn0CyfTVvHW3TUJNGi4R6fZAmQKwmZlglY3EsyAp IXLdAvxDIyYBMgy6NcchiNnrOiaHpui2C2OnxmOEEu7uzSSSSN9qSWRyXd27sxrloFMCXiP5s/m8 2rR3/lfQwF0qT1bPUtQYMJZeLBHjtweIVeSurOQaj7P8wxs+pENuruOzeyJ6n1coD7fd+v70H5d8 weYr7RYptTtBL9Yu5biS5D1S69FF+JkorURy4boDvSmZeKfFEFyMPGJmBA9HosHl3/FnOradr+q+ Vmv9T1CxvNFaEz3Ec4WNYFRSxdZFVWjeGmzIwZSNskacbKdNGRiYyiR1fNnkzW/Mes+c9Nht7k6z ezTEWulXkYe0k48qevAWhiICDnUMKdeoyFusnmnP6iS9E138vvzn8+QXdjrkMyy28qNDNeyrbWET xjiwhhiLKwpyCusZ2O7eK1PR/Lf5GaDpemWq+YdUm1RoIliMMDG1t2KqBt6Z9dm2/wB+UP8ALkhE nZBkBuyvSfKXlrQZDcaPpFno80oKC69ENdOO/KQ1enjyb55bGA97VKcv6qZ/pyFHhmuC6xBSrPxq pf2oK5HLARbtNxZLAVf8T6P/AL9P/AN/TKbcn8rPud/ifR/9+n/gG/pja/lZ9yrD5g0eVgq3AUn+ cMv4kAY2xOnmOiYAggEGoO4IwtLsVQ6QQT2cKTxrKnFG4uoYcloVND3BFRiykdyxvzR+V3kzzHMb q8sVg1BmDPqFqFiuH2AIkfiRICAPtg9B4DIygJCiyxZp45cUSQWNaz5AvfK+mS3Hl+drnSreCVZ7 K4o1xbwMTJM9pJ+7Ds3xc1l+Jqmjj7JnHbZvwaswPq9Qu/j71/lLzD+XXmbWdQ8t6NfG5I0e12jW SKRUV5HeVZaALLG92h7Mj171oCWjLkM5GR5lMbfQfM9jFFY3+lWnmVLSP04dZe4+q3MsXIkRTQmN 1PEOf92cT1oDgMQebAFNfLvlnVEhsZdfktDJY/FZ6XpsHoWNvIeVHAYu8jqr8Q3wr3CA74UPB9f/ ADw0TWPPen6JcQBvLKaxcLrFxIFH1qFyIIGLL8SxIB8aftoo5VqwxtkJEAgHm+no0jjjVI1CRoAq KoAUKBQAAdsWK7FUr8y+XNN8xaTLpt+v7t/iilUAvFJQgOnIMK0YggihBKkEEjEhWL+TfMup6dqh 8neaH5anF/xzL41C3MNCVWrEksFU0Ykk0IY81JYApZpdyIU4BgXSWHkoO4rItKjCyhz+B+5EYsEu 8waNHrOlS2DzNblnilinQBiktvKs0TcWqrASRqSp2I2OKpBo2iedNEsZNOsV0No2kLx3cVtJYheV Oby2cPNJZGPxMVljBPYYq8u/Oj8yb7yhqaaRrD3euzXkS3QskEenaQE5FFWkYlvJvijq6NccTXfb 4cVeEQ+d7Z45XubQRXDcikduoWEEkkUUsCgHSm+YWTScU+K+bvtL25LDgGMDePI/bRH6imWm/nH5 l0Y2yWNrB9Xgk+sQwXgeUcnoHpxMPwOEFV+Z7nMrDEwjV24OXtCUpTkABx8/f3j70XJqn5vfmJC2 l6Vpk/6Iu5RJJZ2EUsdkXr8JkllZhxXb7clO+TJtxc2eeSuLo92/Jr8krPyAj65rM8V35okiKRxq wENsjjdEJALO3Rn8Nh3JlCBJcacwA9K+vHUWWBAeci/Grf3a0NeVBux275k+HwbuP4nHsqNdWVnG II/9LuA1VUAUDe1BQfRkeGUjZ2DIzjEUNymNuJnt1Nyq+qQeSgbAHtv7dcolQOzfGyN0k83qqWVs qgKocgAbAfDkJFztENyxXIuxdirsVTbQdaksp1ilato5owP7Ff2h/HCC42owCQsc2a1FK9sk6tTt f95ov9Rf1YspcyqYsXz7/wA5Mfm+lhZS+SNDuAb+6WmtTxmvpQMP956jo8g+14Lt+1sqwX/nHvRG sWuPOEk7WkyubHSZnSRrYyLwe5+sCMqxUxsFWld6tT4RhAtyMGmllB4ej6q0LXrLWLX1YCEmUAz2 xeN3jqSF5emzrRuJ4mv41GBqnjlE1IUUH501n9GaJL6UnC7uiILYAcmJc0cqP5lSpWu1aVwgWzwY Dklwh8Ueb/J9/N+ZGq6F5f0yWWYzmSDTbZWlaJZQJTHsPsxc+NT4YCwyRAkQDYfYX5RQ+d7byPZW XnK2FvqtkPQRvVSV5IEA9JpDGWUOB8J3NaVPXFgzPFXYqwH807PSr6bQrK+f6mXuJJRqYkMDxxwo GeGOUFaPK3A+wUutHRWFOeZjGwLLPGATukXkHR5bvVrbWYtPtLGzsR6bX9mhC3slw8NQkhJaaNGR 2MhPxEr+0GAhghIWSTu2cQuvI/c9bzJaHYq7FWK/mN+XOg+fNAbStUX05UPOyvkAMsEtKcl6VB6M p2PzoQq+Xdd/LLyRo+qSWr60TfaPLDa61oqlJprhXUepcWMtAg+DkzpKoMTChb7JKr0RvOV55Kg0 Ty95GuNN1jytc+tfWs0/Oe5iiZyTFcIJIzHxlqqtxBPSlUbkqvm/NHzf5gkj/Q97eDWSgMllYRwQ 2NkWND60t1FP6pFPflQ8QvTNTn1mTHMmfBDGPjKXuA/A9zlQxRkKFmX2BTj836/bLFBca+2r6s7M nC0tovRd15c15iJ3mdSCH9Fajug3y7D2lqckvTDhj5/V8unxLRPR4Yjc2fs+b0bylbeam0hm1sj6 0zEkRosbmE0K8oVeSh/2Xvt0G9xzNDj+p104C/TyZvp1slvEixxUDKGeViORJ7bZj5JWdy5OKHCN gjMqbWP+cf8AeS3/AOMh/VgLmaL6ixTIuxdirsVdirKf0m/+FPUr+9p6Ffp4/wDEMN7Ov8L99XTm 8/8AzD8zapFrmnXNvPLHpXli+sTf20DENM0saSylwu7gRToiJ4sxIO1MPJrIxzxxHmY3+Pt+TUcJ MTLzewRSxTRJLE4eKRQ8bqaqysKggjsRmc47x780/JH5Lay+oR3oisfMr8ma90+KZ5UuGXmDcJbp IhLVBbmvIg1rvXGmcMcpcgSwn8srq40Dy5Z2NxM8CtHzX1reSSAmQmSS3uoeDupDsxSQpxI68KAt MbO0wg44DiiTHvG0ollsnm/QrMkwT6XpmqOo9G7stUtI5AD4QTvOnxdCrJ9AYAhNHquXwsgF5Dt3 jdAav531DUnujaxtPLcuRI9JI4kAUKAJJthGVH/Hsrcz9rxxAZafEIC4Azl3naP7UD5J8x3XlXUN Vu/qts+q628MS3FzLxcx20Z4hYUB5Vq3wiQURVrU1wcLRLRynPcgE953+Q+56t+XnnLVvME2pW2p xQLLZCCSOa2V0Vln9QcSjvKaqYa15b1wEU4up0/hS4btkHmPzLovlzS5NT1e5W2tU+Fa7vI5BIjj QfE7mmyjA47yTyfrGrax+YVr5qblZHXLk28Olo4kP6OitJSpuaGgq0Kyr/I2w+2wOvhqzLUHGB6R E2fPbYfj7m84qx8R529qnt7e4T054klQEMEdQwqpqDQ9xmwaFl4KQqB09WL/AJOrizhz+B+5XxYO xV2KvCL/APM/zX5P8zeb1ugNagiuJGgtp53iFsoUzw+mAkg4+hNGGQBa8eVak4aRbAdUt4dQvfUe UWH6aeSTV7yaFDb2l1PIXrDwkd2tmlfcyCqbsQRsFVKe7SwnlsY7PhqUbyJc2a+mhjkjZkk9Qkgb MjVIrsC32anIzyCI3URJZT5V8q69quj2lizR2ukxRKssiR8YZ5NhJJ6fwtctIeTF3pFvssvXMLT9 l+JkOSVi+p+qu4fzR7vV5jk2ZtaIR4Rv93x73q/lzyHp2jsP0bEslzIii61CYiSUkbhC3gtdkACj sozcQEMYoCnBkJzLLrTS7e3jYMPVkcESSN1IPUd8qnlJLdDEIhFRiNV4JQKnw8R226fdlZNtgFLs CWP+cf8AeS3/AOMh/VgLmaL6ixTIuxdirsVdiqb/APTLf9HP/GuHo43+W+DFvO9rBpWsXMl/A7aN 5it42adFZv8AS44Vt3gIXfk8McZjpuxDAbgZou2NHOUo5sf1R/t/t9/c16fLEcUJcil35dfmPL5c MWia+xfRJGAsNUJB9DnybjNxJURkDkGX4RuV+CqxbTT6gS2PP8fjvHXoTiZIVupee9KmTzldiBpY 9LvrrTrm4vYACIoLyRIXMbMrJ+8aGU1PQmuZoOzfi1coYzAd7KdZ/KOVEEugX5aUAhrTUGrG57FZ o0Lx+9UceAHdEizwdo5IHf1DzSOT8uPO6yeklpauabTfWaQ19yY/Up/zzw8bm/ywP5v2/sTjRfya aWZbjzPqBuEWjJpdg0kEAP8AxbOCs01Pb018VORMrdfqNdkyczQ7gmPmT8tPKC6ba2mlaVZaZcTX kI+uQ28YnoSfU/efDIWaPkKlvvwOIDTH9L1zQfy4sdXQzfpDUri4MdjpsQWIrBagwRmQ1cRx+okh 5ntWgPE5GUwObOUjM79w+zZgdyvmHzZ5lhu9VEmpa3KzDT9MjBWG1jGx4Rt8KAE/vGkO2wdiaRNg Tyyy7Q+nv/H4PT+cLBER3PP8fj8Uz7y0tn5Q1xtNe2bUfNFzG4ur8gpa25eNXht4SwDSepI0SM2x JK/ZVVRczFhEBs1SkS9Us7yK7h9aEN6RoUdhQOrKHVlPdSG/hlrB15/cr/xli/5Orizhz+B+5XxY PJdP/NqXyzfaro/nVp7jUYruRrOSCJN7cU6gFFRFWkiu37Lhal1bKxPcgsqRmufmPq0hWOOa38uw SGiNcNFcXz1GwSOrQI3/ACNrmny9sGW2CEp+dVH8fJy46SvrIj97BNS8uprlxLdQRXXq3K0vdW1K WVRKKEVNuxWVuPQD90ONKGgAzAj2vlxk+JISJ/hjvX+dy/3RbjpIy+kEeZ/V/Yxa90LUCV0bRbpN XidChnWJnk9L7NAAyxyH9nnyCA/bK999o9Vkyx3gYy7vxy+Iv3uDmxxgfq2egeUvyytbRhea0Td3 kjCRo5pDPVxSj3EjAes4IqFoI0/ZUsOZ2mHSV6p+qX2D3Ovy6m9o7Bmmt6tqPluKz1NbG21DS7mT 0LmaSc27QOxpG3Jo2SjsPTHIr8ZXcA1B1GYjv2ZafCOaF1H86/IOj6Mlxas0t04DnTDSOaMMqsHn LkhUIdeLjkGBqnIb5i5M3U7ubg03EeGND3mh8y8h81/mx5o8zyyEXBsdN5MiWFrITHxqRSVwEMjF ftBtgegGa3UamfS4h63svsfBRMzHJL+jKwPx5sRjd4yDGStKUpt0NR+OYniz7y706DTkV4cP9KGT +WPzK82+XrxJre9kuLao9WxuHZ4HWu4Cmvpk/wAyUPStRscjFq5RO+4dXrewMWSN4xwT+w/jye9X uv2PmDyxpesWR/cXfxlKgtG4BWSJqbco3BVvcZtSbDyekiRIg80nwOe7FXYq7FU3/wCmW/6Of+Nc PRxv8t8GTXWmafqmjnT9QgW5s7mJUmgcVVhQH6CDuCOhyTrZcy8L89eStQ8tXKCYteaLcSFLW/4l 3VpGDCKcKVJdiB0I9QgMvGenPV5tNwbx5fd+PsGxuG0b4ZL2P4/H435gvLnmQeWtK16yvppbrRrn TVXTJa+v9TMInlgi+FeUkMskp9N+m1Ph+IJkabVcW0tpfj8EdPMUTDJjrccn0bHIksaSRnkjgMjD uCKg5mNK7FXYq8q/MD817aDULTT/AC1xv9Qs5nknuettH+5liKhujsvMkmvFeJqdmAqyZREbsoxJ YJ5Z8q615l1O5lsaPdzymbUNWkVkiiklId3+Hi3M7EBSHpTiUWkjYXDLKTf0/j8Vy773jG6xH3/j 8fiz1Y+VdL8o6BFBYENJ6ttPe3DCt5dGznjuHCBRQhYIpSsKL/q03zYQgIimgm2GW2jztLqjwMWm RriX6wpBf6w4RuaDsXe2guYmNeQY5NyIRuLMLn83tFtVt55YWk02ZCRqKEBJGjA9X0U3JVCf2ita HjXaoaOE1aeXvmVX1qLS7WEXEIkRbm7VnKxyrJX0qrG0XMcfiVpFYV2BxTDn8D9zIcWDH/N/kbQf NVoItQR4rmMUt7+3IS4ioyuOLEMCvNFbiwK1ANKjIyiDzCQSGCwfkvrekK0Pl/WYbe3clmH1aKJq t1J+CdSSd/gVF8FzB1HZuPL9fqrvJ/QR9u7dj1Eo8tkUPyhvb1yNa1NruMEVjQtHG4G+6FpQGB3D RhDl+m7PwYtwN/cPv5n4ktOXPlnsyXTPJFtp0UsVnGkCE1qKl5XoBzkc8mY7dWJObOGWEQBEU4cs MpEklN7bQLWMq0pMrAbr0UmuRlqCeTOOnA5ovUbHTrzTriyv4Y5tPmjaO5glAMbRkUYMDtSmY7kP A7jQPTk+qTyGCwaBW8sazHCIb5reNjGLmOROEvOFJayhiTIrBwFBYZi5AYGw2xNiijJ4ZLryA2mx eU7nzRqek3kel2t7JL6V/wDV5kM4nll4yPEUqoaJtqFS4G6C2NTjuonLHK4kghi35ifllqfk+eOU ObzSLluFveUo6uFLenOqjiG4gkMPhbfZdhmv1Ol4RxR5PXdkdtnLIY8v1Hke/wB7C/8APfbMIC3p JzEQZHkHrH5TXzt5d1DTzyIhu47kFjUVnjaOgHYUtx/nXNtpJXj9zxvaMBHVyI6gFmeZLjuxV2Ku xVN/+mW/6Of+NcPRxv8ALfBNvLHmqw1Yz2BBtNV09vTutPmZPWCAApMoUnlFIrAq3zB+IEZIinWE 2Sm9/YWWoWU1jfQpc2dyhjngkAZHRhQgg4oeD+fvI175WlMsJa40Gd2FvdOvrNC0pHKC5Df3iSHu xpJ0YrMFd9dn0u9x/H46Hp/VsN8MvQ/j8fjdV/Lf8wJvLd5b6NeStcaLfTw29nacmlms5bhxHGIW ajS2zsfh2+HdTxcFWs02eR9Mhv3/AI5Hy6842EZIAbj8fj+171ma0vNPzhtfzKv4odP8t2pk0OaP /cnNbSxpdVLEMnGRl5R8KbJUk9QQOLRldbJDDfI/5V6zq/AX1tc6Ho8Lgy+uvpXlwRQ0VCWKAUAq 32afDzYLIuJHTmRufP8AH4vr5C4thmBsPx+Px3vc9L0vTtKsYrHTrdLa0hFI4kFBuaknuSTuSdye uZgFNSE8xa7oWi20N3rDhIvV427GNpaS8GIpxVuJ4hviNB74Veb3/nzT9X1i11nT9Ple1ERgleAC W7eORgYZJooi1IV4yGKpNatTifhdb8OxtD6pF5Yke79GadJLdhcP6L1hLSTfvQvrcrcj1EHrKfgB Px0JrhbZiJtM/Lyzy+YoTGbia6ikin1GS5ggDRxXLuE5TurSMGkjIVYZKCm/w4C18IHvo/c9C8x6 nLpXl7VNUhj9aWwtJ7mOHc82hiZwu2+5Wm2LjvMvOP52N5DvEh1u3fVEurqe2D2/GAQi0s7aSoQq xkM0lzy+1RVO3TdV543/ADl/rIWWmhWxY28Yh+OQAXXIeoX33j414gb1777KvcPy0/MzQvPWji6s JB9dt1jTUIOLIFmMas/p86M0YZqBsVZhirsVYr51m+uXmjeWRJ6S6xcNJekH7dnZ8ZZ4So3KzkpE 3QcWO/RWVQepnQLbzJeabr9mh0m+js7ixnmSWS2S4SQWiR8mX0YZCzx+msZqfiJpiqv5e1K21uCw HlWJrLyiiLc2+q2ojhWaSG4aOWz+qzxeoEbiS0gAr+ye+KpJ+eeq6QvlObS7iRDeTPDLBAWAdxHc Rcii7sePNSaDauHJH91InqGelkfzGOuYkHzi0czJyZJEt7iMGCYqVV1JZTJCxqrivw8gKVU7mlM0 3B4cQTze2Oo/N5smPGfSYiJPlvdDzuu7r3PW/wAqrnR18u3FrHcepq73Jkng4SAx28a+nEDIw4PV ubAqx2YV3zO05HDzs8y6XPjkMxPDKMBtGwRy9/fzZll7F2KuxV2Kpv8A9Mt/0c/8a4ejjf5b4Jxq egC/itL21lNpqlqqGC8jVS/AFXaE16xyGMB17juDQi2JFUXVZInisIfSfNbrdwaR5hRLDWJiVtmA Zba6Iqf3DP8AZcqpYxFiw3oWA5YJRpEZWh7vVtV1OzvHgis20pri4sDDcwvcGQW8rW83qKHROLSR uvE9sMIcWyJzERaT6LHZ+XJHRPKts+pBmVNU0+O1t4pIusYb1biW6QgbMCD8VSOuGOGXQIOaI6q1 zrvnmRFnhks4GW4DmxCNJytvVFYzMxX4zDWhCAc+9N8t/LGvNq/Mi/JV1bzZ5tudPmg0rTYrG8lB SG8nuFcRV29T01jcOR1Ck098iNPJkdRFBy6v5m02406aXWpbxJr60tJreeK1SNkurhYW+KKGNwwE lVo32hTvksmERjbHFnMpU9FzGclTurW3u7aa1uY1mtp0aKeFwGV0ccWVgeoINDirANN/Kaxs/Odx qckVtc6RODOts6KOE/J1CeiF9Nl9NkPMnkWUE774ptOJ/Jl3ezcNQvFks0ZjbiJDFNEeJVJImU8E JQ8JYyrRvQNRalcVBpMNJ8taP5e0iGw0yBIo0eFXkCIrycZRQuY1QGldtqDtiyhz+B+5NryW0htJ pbx0jtI0Zrh5SBGIwKsXLbcada4sHy7+f/nH8rvMvlS3g8r6hHcarpl+jSr6c6NJC1uLd2WSZV9W nowrUMTRa9N8VeAYFe2/kZoPmHy59b8zvKunTajZSW2kRTrHyZJCvK+mMqsYrS3oHLbeoaKvKtCV fWOnXJurC3uSksfqor8J09OWhH7afsk9eJ3HfFURirA5/rMn5t3L8HkWy0e1FqWVTGj3NzMJQjD4 gW9JGbbfiOlBW3EBvbVlJ2pnbcafFSg339t8qbWM+avO+l6LaxxRhrq9vJPq1jZ268pZpmGyRLtU +9eI6sQMuGPh3k0nJxbReP8Anb9L6HZW2oa3d2Vz5yunEEWlrBbXaadYyqZmLLIjhpHkhSMu3w02 Tu2Y2p1FCy5/Z2h8XIIDbvPds1pX6f8APHkS+XVlhuLrRJPQ0u9iCxyuVj9QwSQjiFJXj8QHA8lo PgyeOIzYiCGByy0eojOJvhPwKWflA3q3+oyRqWjjiVHlG6BjIwUcgSPjEZZfEbjMDTYDA2XpNZ2l DUmoj6b38r+zkD8fJ6hmY4Sulsgp9ZcwBgCh4lqg/LFgZd26NXTrKoiWf1JZF5oDG6EApyDA1408 cNNXiS51sleByE3/AOmW/wCjn/jXD0cb/LfBNI9T8w2ViJLnS4pLaGPkZYbwO3BRXkwmitwDTr8R +eSdbLmUmvPM3lDzRozpqFhc3GnOvP1oFS9CcaOJFk02S64lTQhgdjQ4RKmBjap5D8z+XIPK+lW9 zqcFvezRCaSG6dYJmkuCZmPCQRMSS5P2cCWTvp1gVNxDAkrFaxqD8DeHtvloyy5W1HFHnSQ3mn3c I9aWMIrtsqmoBO9Nq5mQyA7Bwp45DcoZo3UAspUHoSKVp/t5Owwosf8AOFzbpp0Uck6wsLuwmLPS npx38BcktsPCvbrlWc+khtwD1AvTb7UbGwsZb+8nSGzhT1JZ2PwhfH3r2p1zAdgtttV0+50yPVIp 1FhJEJ1uHrGojI5cm58StB15Up3xVil7+cv5c2spi/SwuH48la2imljYHpwmVPSavs+VyyxHMhyM WjzZBcYSI8gUx8p/mH5X80ySwaXcn63CvOS0mXhJwrTmvVXUVFeJNKitKjDDJGQsFjn0+TEamDE+ aayajp9y0tvbXUM1xazQrcwxyK7xMZFoJFBJUmnfJsIc/gfuYn+dHlLXPM/ki407QppU1J3jWO3W RUgmR5UEi3Af4SiqOfjtt1IKwfFHmHy15i0C9Nrrumz6dcsW4pPEY1bidzGaBWXfqu2BUNpOp3Ol ana6laiNri0kWaITRpLHyQ1HJHDK30jFX2b+WHm3yD5+gttYjitofMyKJdR0pW4stwnwfWDF8Ilo AOEpDFQaVBrhV6dirsVeZ/mZd3vlnXovNNrp0t/HcWEtnJ6CszLc23K4tFfgrMEmLPGXoeJ412yz HPhtqywMqrveXaf/AM5XT32kzwa5psUF+LmBoXtA/ovbGZROjK7krIsRYoeXEnqB3jCfCbZThxCn pkR8q/l/pY816q0t75i1hC6I03rsTLxd47ap9OOFF4KzL2VftHiDDLlAFyLfptNLJIQgLLwXU9Su dR1O51G4JNzdytPKSS3xuamhIXYdF2G1O2aTPMmdvoXZemjDTiBHeJe+yD+O577+WutWeqflzbRj 0/0hp7mC7RF4so5n0nYn7RkiVeT1PJq13BA32hycVF877V03hTlCuR293RE20gj0i400igsb0mDx 9C4QzL9Cu8iL7LhzxqTb2bK/ko5S7ZO7QpNaR/WoIXpusrShGovw8nQEEgUoab08cLiz2lsT8kJe ahdLyhiuvUgddgq8QFP7ArUqKdq4GyGMcyN0vxbk3/6Zb/o5/wCNcPRxv8t8GSWN3NHBDFNFISEB aai8APHlUdBlxiKsF1BkeKiCwjzWND83XDaZb6YJrSf17a48yLZiZ1miU1htGeGUMSInVpiVRSAF YuQMrZphpX5fRrptubfzBqgrFGjH1YzG3GQs3K1dJLVWK/uyFjoKbb74qlVx5f03SdUXTrfWrK21 B6SJDMjaVc3BckgifT3s4ZTt8X7h/cYqqWR/MDytZpbfV7nUbOHm3+kSHVOpLBBdRCC+pvtytJj2 r0xVRn1fyN5yn9LVtEtG1yJRCEvIIpy9KtHAszBWjq8h4x3CxsSdkyUCBzYTBPJLdOsrnTba580+ Z459ON66WK6axaWBEDcIfTgRC9XpUkjxPwiuZMMkeZceeKXIMLurkW81+uiaokWlWJiuhZpPI9rb QmOltJb25M0LSO80U1vRUDOv2qZVOI3PQNsDI0OZLFtX83a9qlja6bcXb/oqwjSGzsV4pEqRfYZ1 jWNXkAA+MqP8kLU5o9RqzI1HaL33ZnYUMQEso4p93Qfr/HvSem1aiprtXfalTT6cxOHa3eeNEZPD 61f49yO0yPXI1utS0sXKLpyj65eWpKGBZ/3PxsCKcxLx2+IAlhTjyXL00JgGQ7nQ9sanTZDDFI2e IWR/COtn9Hxen/kDot/bXWr6i8E1vZXCWKRn0xFDK/rcg26qXZEoBQ/CCa9RTN03Fw+rm872icJy 3h+gx7qrbk94zJdWxvz3+X3lrzvo40zXYGkSNi9tcRNwmhkIpyjbcdOoIIPcYq8qtP8AnEPydHep Lcazfz2imrWwESM1DWhkCnamxoK/LFXj3k38s/zMl84/XvKenXNj9QuZZbDULtZIIeMM3pFGlK8S eLfEn7S8uuKvtrFXYqgtb1ODStHvtTnHKGyt5biRe5ESFiB86UxV85a7+T2j+Vta069vIlun1y0P rROi+jDfRxxm4WMf8XcndBT4QrDJR5ud2fCEsnDIXYQHnCXzTrMkV1qA+txaTax2f1yPkeSK0jh5 kpRJOJHqMvwtsfh2XNX2hIcUY3uene7vsmUNLlkJ9a9Xd5Huv5cmJ0NAezCo9wc15BHN62GSMxcS CPJ7D+QcMn6N80TRx7t9TiEocEkxmYsvp0qvD1Pt9DWmxRs3nZ0aAt889os/iZpcJBAAAplM7iPV buFqK0sNs6Derek1wslB0+H1Er8xmbquYdf2TzLsxXdJjpnIRSErC8bEKBcNRa9TQVXfpviGjLz6 /BT1O1jjKzRhVjlJ4qjhhtTpQsetcSyxSJ2KCxbU3/6Zb/o5/wCNcPRxv8t8Eu1fQmGntP5x1ue5 0/UIhZQaFpsTxGYyhna3qrTXE7PGvH4Cg4hiRQmlhmSKdUYVInqyTyXpGoWOhvBqUSQi4keWLTxJ JN9XhkA427O7sh4DbjEqRr0Vf2milO7Kxs7C0hs7KCO2tLdRHBbwqEjRF2Cqq0AAxVu5tbW6gaC6 hSeBxR4pVDow91YEHFWL6t5LmtrcSeUJW0e8Vh+4ineK0Kb1UW7R3NshJp8QgJxVjur6rrEKqnnX y9FdxwFvq+sW4WJ4T2kjl9Ro4wO7vPAx7JviqXWNtqGv6Kumtf3k02mzWw1f6+rXdrI/pxyi5trg CGdJSrowjEq8eW6nqZwjxGmE5cItgf5iwz6bHb6ZcXrve8pmktYJONqtnHJwsQbcUWLjHyHQ8mDE saLTH7RkY46vn9ztvZ3FHJqQSPp337/xuwXNE+jLxM0Zjk9JLg2zetFDKvNC6bgFaEkHoV7gkd8u wZDGQ7nU9q6HHkxSmR6wNqvmPL7Pc+o9P0ZLCFb3ypBb3XlzVoxNLooZI7YCWMETWvFWjUSCnOP7 LV5bGvLePnid2AiXRbdItPOlRpKiLYFY09PhOF+EQlo+LU5LQ7g4s4c/gfuTXFg7FVs00UMTzTOs cUal5JHIVVVRUsxOwAGKvIPMv/OQtlb3Ult5fsPrkSFl+v3DNGhYd44QObp7syewIocxcurhA1zL uNH2Jnzx4tox8+vuSW3/AOcifMCMWuNMtJlAHGOP1ISSBuC5ealT/kmnvlI146hzpezGWtpxv4/t ej+SfzW8t+aWW1QtYaoR/vFOR8ZFa+jINpOhNNmpvxAzMx5YzGzo9Vo8uCVZBX3Jr55kYeXzAoLG 9urKyIFK8bq8ihc71+yjsx9hljirfPflb/Evl6WxidYr+F1udNnevGO5iB4Fqb8HDMj0/ZY4soTM SCOYeI6DrV7Hq1paJE0UWo3ZW6/a9KW2gnS4ikYAqCJII0FDua/Toe3tIJQOar4Y1/shXy9Tu/EM pCY+mf6AQR9gV9Hv9K1Lyrca7qWm2k1zb23rXDNAjMzJAHflVa8ufLbNVq8OTDnjihOYjI/zjtv0 9wasUxKBkQLCpoHmTWtO80X2qQQw3OmSpLZC0aR4C0cbRRqFZUeio8Mzo29RKdu+dL2XpTixg3uR e/fubPnyHwYT0U8+4oD8BCeTPzD1Dzf591aK5tIbO30uKeK1jiLM3F50B5sftH93tQDNhlyGXNwt BjEJl6JlTtUbp8vwvCkCzSOa0YOwIHYhCKfPFqyDrdKd3cpLHHGIVheMtzChhufmT4YphGjd2hsW xN/+mW/6Of8AjXD0cb/LfBmFr/vNF/qL+rJOtlzKpixdirsVdirFPzC1/wA0aJpqXWiWdvJCiyy6 jqN46iC1iiUNykj9WCRlbfdCStPstXFXn7+ZtRuNY/S/la5ga41iK1tZbVFiSRrpbUyJHHHeS2XO H039VCj8/tAruMnE1zYSF8nm86a955803N1Fa+rfRRCEQIBH9XtldzGkxZuKuWYluTHevAHjmu1m aWQ7+mP45O/7Ojg0kBOzPKd+GJoD+sf0fZ1ZLpf5UadcS2cOoavHFM3NL60tZYxcRXQRJltwZFmW TjE/x/Ch6MNjTMKXCAaiT5/im6XbGpkfqEfIAfptSuvy88k2t8bSbzBdoFjllc3EKcUiiA5GdwkQ BZj+7IChgCtGYVyyMTV8H2tUu19QdjPbzjH9TP8A8ibnzFDBq2g6pHMlnpgtZNPE6lHRLlZG4cTX gvprG6xk1TlQhembPEJAUXVaicJEGA4bG46X5eXX7Hpt5/cr/wAZYv8Ak6uWNUOfwP3K+LB2KvEf z38/WNxbweWdKvfWLvJJq3oVKAQsqpA8gHE1csWVWrVKNtscXVZeGO3N3HYuiGbOOIegWfI1X6xb xfNO+guxVcjujq6MVdSGVlJVlZSGVlZSCCCKgjcHcYYyMTYadRp4ZoGExYL6D8nebdS81eU9Fmuy TfWmsw2d3OQFE/ox+uJKAAVKMvKgA5g0oNs3uHJxxBfNtbpjgyyxnp+A9Qd1RGdzRVBLE9gNzlji vmnTViu9MSdlZRfM98wqVdZLmQ3JII4srK71FKUPTJ8AlGjuC9PpcIOCMZfjqpQ6NNCl1ax3jrpt 2Y+dqg4MoiYuAsqkMOTN8XelB86J6LHKYmR6o3Xxah2aASOL0np+1l3kjytoGqXV5BerJCtlaI1q 1u7RsixsQaKPgcKCPhdSPbL5bOJ2jI4px4NvSk3kzyp5f0fzbqd/pNzdXI1KESk3IjAAk9OevwLH ufWG3EUwZYgcnB0MzKZJ/G7PMqdonNjpt3FcI8Yd4G+24RuwJBFDRhttQ/PDTi5MsSN+aA1QS/XZ GlIZ3+IkAr7UKtuDt3wFuxVw7IXFsTf/AKZb/o5/41w9HG/y3wYz+Zf5vtoYGhaAytqyRp9cvCA6 2xZAVRVaqtLxIb4gVXaoNdqNRqBjHmz7O7LlqpnpAcz+gef49/CtVvbvV7n61qkz31xy5CW5YysC OlC9SKV2HbtmrlqJk3b2WHsrTY40IA+8X9/6Ex0bzf5m0WRH0zUri1VOkKOfRO4+1C1Ym6ftKcnD VTj1tx9R2Hpsg2HDLvH6uT6I/LP8yLXzfYPFOqW+tWgBu7ddkdDsJogSTwJ2Kk1U7bgqzbXFlE42 Hidbo56fIYS/tDNstcRJ/N1jf6h5cvbGxRZZrpVieJpDFzgd1W4VZF3V2hLhD/NTcdcQpY75d8pa R5b0S61bX1sbG+MrXbXarEItPQRi3git5HRVX0oQFrxHIk7UNMMjZREUEg/Kjy9omr+UUtL+KddZ 0m9na5vhJNbXjTzt6kkjuqWsxSavLhIm448gWG0JRBFFkCRyV9U8rW3ky91PzBpMkN/Jcwq+o297 JKbvlFsHia2guZXDhkDL6XYNXMfPphMAA1TZjy8JvmyLRfKCy6vBr3mBrS71BI+Ok28SExWqsA0j I8vxySMR/ecVouwUbk2YMAxigxyZDIqPlTWbDUPzD83LDJzlgSytkbi4VkthMJFRj8LenPK6tx6H qewuY0y+8/uV/wCMsX/J1cWUOfwP3K+LBiP5qXPmu38mXj+WYHmvaMbgwuEmS3SN5JDDXcuxQIOP xfFVdxkZXWzKFX6uT5z8ueT9Y8weYjoFtC9peRDm/wBYR0RE9FZlZwu4RkkVQ3GgZgaHautx6aRl Uuoes1Pa2OOGJxbGE6A7wBvt3b1vujfNn5ceYfKtlDd6u9qonlEMUMU3OVzQlmROPJgAP60xloqF ksoe0nGREQonzJ+wCz8GIpPIZBGYJODLy+sEoEr2+AsZAD2BFR37nKcgjXMbdP2ufop5fE4jCR4u cpUPlC9o/MquY7unrX5T6ky6Nb2FtH60lrq0epXTCVUaKN4xbkGI/bDIrMpr/wAMtM3uixmWMVu+ b9uZa1UzIGP7Nr+NMk178xdX1LR/MOgmytbbVhp8x9G1vFuJ4UlRAS8TRxLzRJq/aIrTswzJOIuq GUbdzB9PvLK8s4riykWW2dR6bJ0pTpTsR4Hpkg9pgnCURwnZEYtqL8sectI8u+a7Wa9uI0imjmtL kMwAVXVZV9uZeJAF6kE0ByJFui7XnAgUbkOib6No7xX02rRtFPa3/q3CXschb1hdS+rEEjA4KkcI VA3KreA7nNChbq+zZ3MjyTvMd3KNsorUpzeWUSAkenEitQeJqwqD8sWqZPcF82mQ0Jt7jmdyEkQo WpuaH4lJ9q40iOU9Ql+Lcm//AEy3/Rz/AMa4ejjf5b4PnwaD5g1/WdQaxtJLyZ57md3Xiq7zMSOU rqnLk3GnKvsBWmqzDiPEfSHd6bXw0kOAS8SXcKAHx6n8bK0H5b+eZoI5v0RLGklTSSSBWUA7Fk9T mK+HGvjlBgLriH2/qc0dv4v5s/s/4pJ7zR9Ts4FuLq1lhgeaS2SV43VTNEWDoCQN19NvuOJwkC9n JwdsYMuQQF2e8bX3e9MfIuuSaH5v0nUkYKkdwkdyxNFFvMwjnLeIWJi9PEDwy7Rzqdd7j+0GmE9P xfxQ/sP6/g+uM3DwTsVecatLdea/McwSCK+8u6HM9smntOI3ur5B++nC0+IWx+COp/vAx6hSCHIw RF2SR3GrHxebpdzVs9RuX8xQJq9stxqV/ZXjQBrq0ngD8Ixd237oW/qxM7gURVkHKhbKMcyZSBrZ hk33702tUt7CPTbry35QvNSllZ4dSsdZNrP9akhLepdK/wBaujb3CyQuGIQhiwDDdDl1NVvR9J0D 8pda00atYaLot1aOCXnW0tWoVbkyseHVX6++KvP9B0ttPS01vy55eubVP0jLe2gheO3L6XNcufSF vLKlBLAxKRlRvxPw0GWiNx2DWZ1LcvZfrlve6bbXls/qW1ybeaCShHJJHRlNDvuDlTfDn8D9yNxY OxVaI4w7SBQHegdwBUgdKn2rir5y/Nm1utX89ahc/XQumQBIFuHUyemIeELwwwoeUjG6kYL0q3Id gTrdZljxV9R7uW9E7nps7TQ6ueGJ4ABI/wAXM13Ae9JvKnk6y1fU7E/U9UudPkeIma5ims1MAjma Wf14BDAyyF4hGqOx+Gvc5j3KP1CA2PLfexQ33772HNlPWZsn8czfmR92yJ1D8sNf0w+u+nRXaCFR NLFdyzp+5WkkjieSwEJcfHReYqCKjDGQl16noBt0HKV1y6MfzOeI2lL/AEx/WG/LV/ceWL+5uokD F2WO502YM0og9ISC4jaONHjUu3Ah4nBK0DAnfJ0er8OdAAxI5jvvl1Hnz+HNxddx6gAzkTKO2/d9 /wCOaWXOm6v5juptVn0eZrS+uZJ7V7aRJYnUUjeOWQFeIDpuJOINBUds2m8vVXNwARHa+SO0XR9T vbyzkGl39mJZY2uyYJoT6ML1dXYAK1Uqq7nrtkowN8izGoML4ZUfeyXzT5QlvLWzm0KyvZJI7gpd QSTtByhaF9yk0kaOvMr138O+WzxWNgw/PZDtORIS6x/LXzzdwOtlaWdiiCiQXEreooqByCW0c8Z6 mg5jpvlZxEc9mIyg8t3p1voFxo/lTTbWdijW9IUtwwdVVUCirlI3ZvgqSQOvTKsp6Of2fH1EoXKn apjohBuXjJcB12EcgiYkHahP9cQ05+VqeovNDdSRJLLQij8pOZNd9yKYlOMAi6CCxbU3/wCmW/6O f+NcPRxv8t8GH+e/JPnPTo7a58oTTpocl5Hf6hp9gwW7i+A/WFgVzweKYnmU/Zk3CtX4ap4IyN1v TgHIQa8001Dzd5JbQnebXoobSRPSE0VyUueQH2U4t63qj+WnKvUZqI4cnF9P2bOWZxrmxfRbnVvN OmXFq9pP5ifUlt2tLe4t2tbXT+EPH1ri7ZeHql/3hEPJ1P2RmeNMeIcPpA+1x/F233LyvzFo1zo+ qanol8VuJ9N5xXbQqw9T4EdTGOo5xyBqdiadt65YRCe3ePt/sekx9oyy4TxH6sc4n3xAIPvPFR83 1v5d1/TtY0Kw1O2uBJBdoAjt8JMiko6EGnxK6spHiM2QNvKEUaLvNmry6N5Z1TVIU9SeztpZbeLY c5Qp9NN9viegwoeU39hbaV5ZsrG8tIrT0GtfrrxvI2qzRq6meWkYLoZN3YKQ9K8d6Y5BLhPDzdsc chACBlIda+nz97G2n1COysL1tStLTy/Guo6TpFrqtuyn/RH4Ja3QMi8vrS2bwv8Auy4XYLyYkYuC QjOQr1bW67LEkDuT7yB5lvRZ6jc/4ut7mawt4vVhGnXIPorJWa6IuZIDIeUvx8PsgLtU0OSMglyN onp54/qiY33iki85T6Rda7dyX3mOMTzwIL6CzsnDzXEMlY47qWN4UrbSQx/tcxuu29YTyxjzLZh0 mXLvCJPuCf3F5cXPlZdS0/zNJqOjh6zWIiW3me0jmKTwFuImilji5DkG+39mnbIjK47Fw5xqVEPZ Z4YobSKGJQkUbwJGg6BVkUAD5DK2+HP4H7kViwdirGvPXmi90HT42sbYzXU3qN6zxySQwxwryd5F jKs56KkYYMxPgDTF1WpGIDqTsPf+Pk2Y8fE8O1ay1Kax1C6SCdbq1qLi5cKqIZGaV5bmWMSwCSWe 5qq1YxIeY4knNZphPLLj5xlve/PkAORoRjuduI7bhychERw9R+PvPwZJd6lrHlieXS7jV/Xtlhg/ RSQnT7Z4FEYi4z/XHTnHyj5D0gW3bb7OXiMcnq4eu/P9H6UEmO1/cmuh6wBpT22tRiTSHR4/rV7J JLPfTS/HMkNpJF6jwAu6R9SygUXjQmvJiJl6fq8unx72UZbb8mKweUvOd1bWq3Wn6attZxCKwDrz ukQU+IiQekrN6asEpRTStaZkw7MiJSlxS9Zs0a+5BMyAKGzJYpotOsLfS9T0C7msLanG7Kx6ihcH +8ZYy8/Ik1r6WbuGSAAjWwdXk0mWzJN7LzT+Wz3slsvmXT7e/eMXF0jMsZAUBf3ruUAdQAOLHkB2 wnUgHYNY0x6lldlYaVqOnRXOlXkF7BLUrexSCWNh/kGNihyI1G+6TphWypqOreWvLNnHPq11DbMq twZhWWSm7enGvKRyAf2QcpnkJ9zdDGB72M3Pm+48woHt9KuLXRlPK31G5onrPuBwj3+Ar8QYMfAh TtlRLsNH9R9yGwOxRtpexRQmJooixNeckYcH2P7Q+jFqnAk3ZUb26S5lEixCL4QCASakd6nfFlCP CKu1DFmm/wD0y3/Rz/xrh6ON/lvgzC1/3mi/1F/VknWy5lLNKhkl1HUbi70WGwlhuDFZ3oaKWS6h 4KfWJRQ0dWJXixr8NcWKZXV1b2lrNdXMixW9ujSzSsaKqICzMT4ACuKvlu50vzN591fzF5w0LT2P lqOeb6tezzn1ropJx5w+v6RCekF+A/ZoEUkjjmNqNP4g25u17L1/gT3jxRPTr8PxuxzRdNfWNa0f RZbtvQmvUt2WtHggu7krL6URWTg/NtyQPjFW6UyrETxCJsAbD4OTrBAYzkgYmcyTIbGhI7VY6dSK NvrXzRpEmpeV7/TYJxBPJblbe4lqypKg5RvJ3Kh1Bb2zOdC8hs9VkvtG026uNBv/AKxcRm+vZGVL g3EsicoVWWF3pFVqNy4nqSMu4ZVydjHtWIEuh5AdB3vMZrvzBqVbK6ee4kjmkuXtnULwuZBSV/Tp SN6MaolFHI7b5p8sMpJHDzdtoZ6HGYZDk9QFkHvPdt0+LF/Nmqa3oE9vbRC4069lVbhmdHhYxEso Uq4UsrMpqCKbd8u0unljsy2cftvtTFqeEY9xG908sNN1e9sIby00u/ltZYw8Tra3ElUoKUYI3L5i te1cxp6PLKRIFu40fbmjx4YxMuEgAVR/QHpv5M+QBL5juZNct7mKOK2jvLfTnnmji5SXJdJHgV1X d4mb0326ErXpssWOcIgS5vI63Niy5TLGPT58yepe93n9yv8Axli/5Ork2mHP4H7lfFg818/fnnoX ky+vLa8sJ7oWbwwO0Dw8/WuIjOn7t2VvT9NT8f8AMKU74L3pNL/Lf/OQf5W64tpH+ll028u1Ym1v 1MPplDTjJMawAt+z8e/z2woTbUvzI/Lq3s7mCK+t9VFHWew04LelqqeayLFyRVp9oyEKP2jgAAFB O5YRYaHcPpp1iBNQ0yedknsdEtr6cRWsFAqQmKRngqVPOQenQE0XoMicEDzAczHjNblkGi6RY2Vt HKlmlveSorXTk+rMXb4nEk7fHIeRPxHLAAOTbGICHuvNVhZ6jcWF4kq3EYSS3jgilupJYXUfvBHA jsoEgZDXwrXfCg5ADSHl88abFpt7qjWd/wDo7Tmdb25FrJSJowC4dSA60DA7r036Y2wOeIfM/wCZ XmK388eeLi90iIrbLBwiaYrGWjto2kkkbkQF2DUFa0HjtkSXFyS4pWzD/nG7TvzA1HVNVtPL+oya Vo7wr+kb3h6kaych6YjVhT1SvLoVPGvxA0wNb6V0H8s/LWl3BvZ0fVdUcgyX9+xnkJFCPtVHw0+F mq3+UcaTaN84f7ww/wDGX/jU4ly9H9R9zEsi7F2KuxV2Kpv/ANMt/wBHP/GuHo43+W+DGvyk/N23 1hbnRNaLW97Y3k9nb381RDcsJZXWJJCAgeOEIOFanrknWHm9Zrih82/85IfnTp1xpsnkzy5cx3Yu CV1q7jLERiKQUgRhQElk+PqKbd8VZ7oSeXYvLunguJPKui28Nrp1vA3Jb254Bnk+E0epNa9DWvjk w7bTwlGIjD657k/zQ3pHlvTbD8xLTzBf+XbawGuBYLBtmktr22hldCqgAR+vb+py6fEi/tHIlwdR GIltLi7y9F1uG1u9KvtPmuzZi5tpY3uEdVkiSRChlUvUArWoJFMDjvEPzQ/Lz8zNE0a3vvImvX2p aZaQqkunUhNyEUUWSEwRRiReNPhVajqK9p+JLvYeHHueAt+Zf5kW07JJrt+k0TcXjkkaoZT0ZW9+ tcHiS718OPcEl1rX9a128W71a7kvbpUWFJZDVgikkKKe7HAZE82QiByTO288+aYDZWN3qd+NLsCk T6fbXD2h9FCA0YKghW4igZlNMeM8rRwDnT6j/Jj8yPyu1/U57TQrK40rX54VE0N47zPPHAWb4Jmk l58fUYmvFu9DgtlT1m8/uV/4yxf8nVxZw5/A/cr4sH52eaDrJ8x6n+m3d9XFzKL55aljMHIatffp gVnX5PeRvNx8z6P5k/Qt7JoUPqXBvIYS6sqq0Y4AbuTJQUWppvSmEMoEAgl755l1WYaK1NIv49PW e2XULi4t/q0MVq1xGs5k+sGJmT0ywPBW6+FSDblSzRIpNtf5DSpmE0sHDixeAVegYbChQ/8ADD7s k5ARVhJ6ljbyUkHKNTSanqdB9ulRy8cCByVgiBy4UB2ADNTcgVpU+1cUsD17z7pPlnzhBNp7PcSy MIvMtnAYzDJAqEIJA+xuV5DjRl+D7ZpxGVZc0YcyxGjyZyfDjxEc/wAd7NtI8l/lJ5o1WHzxp+m2 15qIZSLoeqvGVFoPVtiyxiRQQfjj5dD4HJAg7h10omJo7FnFtaWtrF6VrCkEQJIjiUItT1NFAGFC riqQ+cP94Yf+Mv8AxqcBczR/UfcxLIuxdirsVdiqb/8ATLf9HP8Axrh6ON/lvgwyy8veVf0EdFbW RbwzO09/p13bepEbp29SSQMQBUP9lvtCg8MtA8mzHgIj6sfF52hNY0rW7nT7u01bznbz+W7OIvbw pJK97c8ONwizSBkZeEy0BqW4gVPXI04U9NIEnhlwvkvIuI9e/IDzzcWOuw6DdRS6ijepJoNoTWOK 8ajNseisqltv2gPEnJRLl6XJzgTwxlzPue/eebTzFbeXhqsmso+tWN1ZXMFmEVraMi6jVw0SlXcC NmrRlNO464Vzzhw1CFDv6q3kJ4b/AMy+Yl12y02PXi0fFYYy0txZtEqm45zs8hid/wB36Y+FClN6 1LOBiaLhQmJCw9Bgggt4UggjWGGJQkcUYCqqjYBVGwAyLJ4v/wA5F+YPLGmaQ6f4as/MGs0U3VzN AZBYRSHjFJPLEBInqt8Mal15b+FMVeLfln+Qvm3ztPBqV1EdJ8uSsJHvZBxeWMmpFtEdzXsxHH59 MVeq/wDOQ+lW+taebTy5p+m3lxp9u13ruqhYmvIIonWOCITbEGV1cEcq0U/Sqmv5B/kbF5Ut7fzP rqMfM08bejbE/BaRyrTiR3lKmjV6VoO5Kr2O8/uV/wCMsX/J1cWcOfwP3K+LBJrzyZ5RvdTfVbzR bG51KRDFJeS28TyshXgQXZST8Pw/LbpirE/IN9Pofm/XPI96w4h21XRmACg2871kUKvT4zX/ACn9 SmwwDZJZ9fWVrf2VxY3cYmtLqN4biFt1eORSrKfmDhQ8o1PW28iTW2keZpmntZRKdL1WIGaSS3g4 7XMSj1BKgdVLIrBzvsTxwGYjzNOdppSn6QDI+QthX/KzrDTvNFzLpCNf6PcxRtdSXCTW831gySFu Hqonwxpx2MfxV+1tlOTVwiR19zsMHZ2fJZjGqrmOG+fJLvMv5oa/qyvbWbfoyzbkpFux9d1qQKzU VkqtNkAIP7RGY2XX9Iuz0vYU5G8pofzRz+J/V82GgACgAA3NBt1NT+JzXSkZGy9JhwwxREYCohMN G17WtGufrGlXk1pMwCsYXZQ4FaB1B4uASaBgaVyzFnnDkXC1vZeDP6pij3jb8fF7Z5H/ADD1uDTA +vXNxr+q3npyQ6fbR2qG1tgu008irbxq09eSozEleJVQOWbHLrIYYCWUiNvA5MAlkIxXKI72beW/ PWm67qVxpkdrc2WoW0K3EtvciEn03PEHlBLOla9q5bp9TDNHigbHx/S0ZMZgaKt5w/3hh/4y/wDG py4uTo/qPuYlkXYuxV2KuxVN/wDplv8Ao5/41w9HG/y3weaW/mbzHa3VzYSNbXD2spH1TV7VbsLC SeDQyK0MpjcD4Sztx+ztx4gYM0cseKJbcWlMr4ZGEh0/SPJ2pebNUutH1G2tdP0VZpoZYRPDaOHj ZkKsF/fmjb7Gux7ZdRRPT5CD+84qG+5fN9n5P80XhHoaXcEMAVd4zGpB8Gfiv45Ci6yGDJLlEn4M r8qeTtd0U6hrd/aLHLpwhSyZplHp3ksitDJzi9SnFVO3Ukgd8ZemJkeijDPxY4+UyXq/mn8wPJlx 5UEGgaXc2etTNC81xcBZjAIpFkkAo8nqmQKUAVe9TQ7ZQdXHoXbZNLrMljICIAEnbah9/kzH6/ci Dy95stP39xa+kdQayHrepY3Kr9bREWrSKCFkCr8VUFKn4Ts8seKIPV5fFLhkR0S/81fzM0jXdPsf L2hXEkkGpE3GoStDNBytYSCIl9ZYyRJIV5U24gr3zEDmFhFr5lvtG8uWmhx2tjb6BFcQtq0MUMry X6mRVkNyxkqysn2kUUIHH7Hw40tvVvPP5pWdl5PuRpVvc297cAWFsWjVBavNIsCPIAx4UWTnGKfF TwyRgQLYiYJp47Z2psrKextJ5rexuZIZp7aKQxq0tsFET1TiwK8Adj1364KTbKbL89PN2naHDptt ZWV3NpYjtm1O5mmk+sBeMaRsp4Unbo7mVhy3I7YKTb26DzJ5f1aFv0ZqVre+jLEJRbzJIV/er9ri TTpiQWcCL+B+5N1dH+ywanWhriQwBbwJee/m1pl5aQ6f510ta6n5bl9WZa8RJaPtKrHoAoJ5Mfsx mSm5wFWcaXqVrqem2uo2jFrW8iSeFiKHhIoYVB6HfcdsKvn38/76Sfz3HbVBhtLCBVG9RI8krv8A epj+7NdrzyD1PsxjBlOXcAPn/Y81zXPYOeqRtIwPBRXYEk/6oFSckIWHGyauMJ8JEj7hxV7wLl9l OQh0LA9DQqQVPzoQNsTAhYaqMidpAAXZiYj/AGVIi10+e7heVX9GEKTHMQrciBUFQ4KlPc7EdPHN jpdJXqk8r2x254gOPF9PU9/kPL7/AHc+h+VrvUvMWlWOm+W1OlWKwxPqeryozujyRh3WNXPJ5WZq lmap61+JXOFp+xTmzSyZfV6jQ6Ve1/q+bpMuuGOAjHbZ6z5L8veTvK9syaasj3so/wBK1C55S3U5 6kvJTuRXitBXeld86AaYxFAOv/MRKM8z3Ms9lETA0UfqVR3IqfhP7PXI5IgdXO0EyZHboxrKnaOx V2KuxVN/+mW/6Of+NcPRxv8ALfB4xqMaXNzDp2oTCG49VxompzEFlkZiTZXIUjnFJT4Kew2dVLav UYZaaZzYxcD9cf8AfDz7+9lkx1QPwv8A3J8kNb3nlrSJXtWgg0q/V/Sns44wsnNulAigurcaqwFC M22DPDJATidi5mLU4MY3AhLrspap5ytbewkubK2nuyqsUYxSQQnjDJOD6sqopBjgdl4cq02y0lGb tXHEen1FMfOlrrnl3Rk0WGF7qz1ELdatqkcDyNNdmRR6dFEgiVVjjRB9oigBqpJjqvEhDhgLt0eh lhzZjPUTMf0+WzA5I5YmgSaJ4XuolubVZKAywPXjKlC1VPE9fiH7QG2aLNpZ4xZe90PbWDUSMQeE g9ev47k58mR61L5osI9Jd47kzwS3bpWn1ZHBl9Yj9howyjlsWoBvTMvs7xTMVfC6b2jGjjiIAj4v l099fpet2/kxfOPkbTG4yQS21xfzadexcOcZkvZt6EnkkqBeSMOngwBG2iIEGzu8dIzBFDZ57rnk /wA76DKdJvtLuNanlAFve2lrJJbzq6/tiFZeBVqqyntv03yoluATry3+R3mOXRphf6VYJ9aePhZX nweksay/vvTs2UCQtPRRzqq9+RNJRqt2MgbVrD/nGrzRbc0bzXztZyzSwfV2qpPQK7Tu4H+yxqPe ty7vtTyz/wCccNMmjhh1zU5LqzgdWjsrZFt4CFB+F1HJm3/ysfSvq8gzXSPy48v6A0ctgGjjjZI4 rZeKxCN3QcCAOTgEFhyJILHtticndsyx49999j9xZdFBDCvGJFQHqFAH6sgZE80iIHJfgSsnhhnh kgmQSQyqUkjYVVlYUKkHsRirzr8t7uTy5rOs+Q9RlPDTi2oaPPK395YzHkxLMSTwc1ZjSrFqbLgC vOPzntY9S1g+cNJlF95ans4Vk1OAiWBZ4ZJY5FLJyIPER7EZiavDKdV0d72J2jj0xkJ3Uq+y/wBb zC1v7W6maGD1HkT7SiCYkUJG9E23HfMH8pk7no5dv6UfxX8CmVlZzXBhlhaJRL6qwySOivWN+ElI W/0ggMtDwjbL4aTIBuREOs1nbmlmdsZnIfD7ea7WvLtiJo4G1UXVmYv9PezjcxQzOSBDNK6UVuO6 8gD34qQpOXjwYsZABBkR+KdHre1c+qvi9MB0HL4p95d8uw+c9Qt/qlpHY6ZbKV1Ga25x2swHAwyJ bN8EUpSo4r8DD4yoWiyZUIGZocnV5MggL6vctI0iztrZbO19O1toV2DGle5O9WdmO5J3J3OZ+0BQ Dr95myU5sRZCqR0lum+FGX1EFCKHfff6Blc+Lry+Dbj4enP4oTzD6wsoVaOVFV6UkYMtaHoftHMb NXk7Ts6+I8+SQZQ7d2KuxV2Ksh+pSf4SrxPLn61O/GtK/dvh6OFxjxvsfOnmXy5Y22tauYbaKJpR dtFJxQMGe01pydvi6om/+Su4pQX8P4+bqpS3/HeE1ltoNS1mLTtTmSDWdPuZV0LUpAZPrFvFO8Yt ryvCr/ua79eoqeQzQ6jFPQzOTEOLEfqj3eY/SP0cs/FMZ4iMjU+hRA8geYry1TTbw2trafu1nu4p pLiVkjiubcqiPFGtXguuPJmPHsD2py+0uIQ9EZGXmyj2bLi3IpA6x5m1XQdQuNI0O7lg0y3cUjkI nJkC0kIeYO4Xn+zX7VT+1tfpu0s4wx4j6pb/AD5O40PYGHUEzlfCDQr7UPYXUnmKxuLO+WCS50uy u7uKYxqrPbR2lxAISicFPpzXqOpFO9TWhO10eoOYEEbxdX212WNHOPCSYT+d7WzTyBo0uheWPMl2 0BsoNNtJJeD/ALpzHBJdshV2A6oAVZgO3+quVDIIgunnjMiHqnkxYtH8raNpciLF9UsIGvJ6lYg7 RhpH5SfEechY1bfxyvh2u23j3qmTZBm7FXYq7FVC8/uV/wCMsX/J1cWcOfwP3K+LBLdd8x6JoFtD c6xdrZW08y28c0gbh6jhmAZgCEFEPxNQe+Ko76zb+h9Y9VPq5XmJuQ4cTvy5dKYq8b/OLU9B1tYG 8s3B1TzFDFdWROmMz8Ibm3kjbncJW3Vkc04yMCAzcfiyjPqIYxcpCPvZwhKXIW8ztLbRhBrq3enm 3ujpiy2SzWji5W9tZ43hWOqchyVWVyPhK0qaUycc0JCwQQx4CNiEqnvb69f6ppSxXVzcE+rYWHK6 u1WoHKR4Q1uvLo1ZQVHevRhlM5ECJrv/ABv9iyiIiyQnnlXzFpum6bFotzcv5cukQ/Wbf6lIL6WS vJ5PXcPHvy+yYyV7GgGaPX6HJLLxcJye+VRj/m8/t3c3BniI1fD7hufizHy/oOu+bIn0bQ7OfQfL KVF5q10GW4nLElvSDEu5k6mRj8VSSa/C1mk7JkJjLnPFPoOg93u+Q+1jl1YMeGGweuaL5I0bSLCK xtQwghFFUGlT3ZjuxYncknOiGYgUBTrDgBNk2mq6TpyrxECkeJqT95yJzS72Ywx7kTHGkahEUKo2 AG2QJtmBSR+cP94Yf+Mv/GpyJc3R/UfcxLIuxdirsVTnRPL811Is1yhS1Xeh2L+w9vfCA4ufUCIo c2Y8E4cKDhSnHtTpTJOtti7eU/L13q1vq1z6TvFHDxiYIwJSO5Rg/KtVYXp28VGEzJScW526pdrX 5d6LqunazbTTwNJqcc0cRYDhF6s7XCtQGtVdvwxtHhnuYD5n8h6/perSW2m395daJcxzPZwQXNxJ JF6f1QKkkhrItS09KPuPDjmN+R05lfBG/cGXiZgKuTANa8karpwt306wuZoLia/9aMpKWiNvcygF ahiyyKoZa0rWoryoDqdHGdEHd2nZXbGTTAxMeKPPu3eifkd5Tms9e1C91eD0JYbSJYOalQDJc3Ec qB3C86/VIn27FfGuT0+EYYkcyXH7T109ZkEiOGMeQ/H42Zl5+tzr2r2fli3QLpt/G1z5iu1BUSQQ MFt7QzAUHqSOWah5cEI/ay+ABO/J18xIDYbpxpnkvyjaLcFrOz9a7VY7pkpSSKNQqRuD1RQNl6YT kH8LEYZH6uae2EWl6fZQ2VmyRWtuojhi58gqDooLEmg6Dwytt4T3Ij61bf79T/ghivCe531q2/36 n/BDFeE9zvrVt/v1P+CGK8J7lC8ubcxLSVD+8i/aHaRcWUIm+XQ/cr/Wrb/fqf8ABDFjwnuQmqWm j6rp8+n6gIp7S4XjLEzAVoaggggqykAqw3B3G+BeE9zxzUfyQm066lm0KXTdTtC5mjs9TRGKttsB x4FutGVowOpVjvmLqNMcgoSlH3Gj+PeG3HIx6X8EwHlf8zpxFHC+jafDSkjNK7SL7oFEqf7E/f2z Vw7Aw3cjKXvP4LknWZKoCvgiLX8krG+dJvN3mCTWnWh+qITBahga1EauTXsdwD/Lm502mw4R6Ygf j5lwspyT5ks40zyn5X0y1W1sFjtbZPsww+nGg/2KgZmDORyAcc6W+dphHp+ioa1Rj/lPX8K0wHPI 9UjTAdEXHJYxDjG8SDwUqP1ZWZE820YyOQX/AFq2/wB+p/wQwJ4T3O+tW3+/U/4IYrwnud9atv8A fqf8EMV4T3Ie5jsrx4opOEygluNQdwOu2BnEyjZGy39B6T/yyp92NL48+936D0n/AJZU+7Gl8efe qw6Zp0J5RW0asOjcQT95w0iWWR5lE4tbsVf/2Q== uuid:65d85b9d-fe97-8341-862c-85494630e2d7 xmp.did:1392258e-45ec-43c8-b01c-2bb3989e89bd uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 xmp.iid:01749fe5-0bd8-4cc2-ac11-bd6c1faeb7f8 xmp.did:01749fe5-0bd8-4cc2-ac11-bd6c1faeb7f8 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:9eeb8828-6dcd-4786-a099-ab23f428b955 2017-11-10T16:19:46+01:00 Adobe Illustrator CC 22.0 (Macintosh) / saved xmp.iid:1392258e-45ec-43c8-b01c-2bb3989e89bd 2017-11-10T16:35:18+01:00 Adobe Illustrator CC 22.0 (Macintosh) / Print False False 1 210.000000 297.000000 Millimeters bromello bromello Regular TrueType Version 1.000 False bromello.ttf Cyan Magenta Yellow Black PANTONE 707 C PANTONE 707 C 2 Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 PANTONE 707 C 2 SPOT 100.000000 LAB 80.784317 27 3 LETT SPOT 100.000000 CMYK 0.000000 89.999998 0.000000 0.000000 PANTONE 707 C SPOT 100.000000 LAB 80.784317 27 3 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 6 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 7 0 obj <>stream HWɊ$GWY!ߗt:!Kj(3{= no-Gǘ:z?߷_G? ߾C_{}ƭJ򑎀i.go.Y[/2k[=!K>۵8:@[&CV8ri$_s^ aܗP l:Ҭbsr q[κchdf-aCꖞNHگW~ Xu %u&(aKrJLFK)GY00Ա: &FϕdB)BJƠ(|-auB#vX/?D8ڸRCDxeb 2l)F>HW9O(PjT6R!,܌?X&XFF2H0jS?L_N?_?F@SqF <8Txv"f`A0]S(+1IU(] -[7;K2Dr"gzq.q .%Y}MDȴ<0‰}0YUvEhx|u vL#Ӈ~OBxqq - ):ۇlf fGW|Gxxd`ht~FX:F}94\\ӓ{D0B>?;!Gh6ط el]ܺ l]N]KD60(m]"N] a mԶbwބDVc@r$Nщ/"4Qvy9rj"[)lڬ(,h.0z_g+s33T7ʹ{  88TC>H-$ޢ<:Ȭw+4҃Ұ@P\'jDNmHJ`8^UXٚP3˪ ,2.Lna}1f*N-#rWc }zaZ,j o3P?T@sSS"g?YލJ7_l\O(@" 7Zb͠/UByփ'J35U;H?ҎlWwytpOqeLVWL9S 0ŕvkyd?τnɜ/e9ߏVdHP| 04*R`GF}/l3GH B6Pm$/G0nـ>TdevQ0df0TWPFx34'E*鴆u^GA^j >/VɬTzjP84-?A\1„=j0ȅl,[Tg5MvfRl9iJj:Q< bU", FY')r uIcAZySJffjP_GQkɡM<ڎpR+&.%[T:r=|V$^dK֗Ѷx= R. v,;V]^M#;w !> 1w yh@3A5G?wq|ƕB^&_o;ٽ 15sRgj'mzhRPaƮ쉺ʧ}=ՅL;ِ&-(ȕ:<c~@/ m̉m~ [% &MJ?$$. ئMA! N$aJ)H~ފJB,]Vcӓo^ZSCx iTu$9 ws!c{t"S (wqqϛ,Gd  `xBfMs[tiҾ"jx +͏Ȃ=@KN1̘Hgj?Lz(8F*i iKN wqI)gE.B8f܊ Nԑ 'CdJ޻(@)?n # XwsJ650FqΖs,k--ȓ).wy,+y-kQK f@f`{d\Ֆ{j> 7^'YU1zX7T1$ʻ$]e~]8eZT,3_?m Bt*_nF06UkB*Qz^@P{%}~ȓ]V+LP⟿?mrU`0DQ5V U|̀)GyR5yغJu,OCg%8Kr -.dN -^,6\y/ƙUrar`1:3 59QDBլq5ֿ9)L^4_ҧC) $El|%(nRc+Ϡ.4>x./ IdeSîXІ<( ]@7ăq$8 UOd|~e8<@/SLh8O Vv0֣/ Toqyd?%* ș*Ow<#=׍=r*}KƾgFTໄ'VAkQfoLp/d𖕳=#frm(sf}IzO!W@+ xW!<|i_Y=ª2C{mx?^wv*$ٌ[8gSrܙ 6@jI!*--uC~I4&69n\c&)[EhAʒc^>fFP1ْ֯gZRϒ&dO95]R~QutVsh 9Vvig5=}&-ߘF4Bvn[P߉Gb^z)3)s6ய2SCI4=B-UOmq?A g JiGdOs%X" ckAig/sZ Sva_~ř?DXˑ6> W!-AT»dʿ-*}7h).Qc)2^+owCWCqJ7n'hP ~*;n}h!)I. jDOQҸ_r[*U6,Yk_ָݛpzvXV3?C-] -̎wrڑԧҝPXߒ 2{+!^H %B\|W-#ų;A)#y$CZQ M1B џk A^ 4ksM̧,ky 9S+{B0%_Acm . c.L$MMk,Z?NmTT>3u^Sy!_Ԯ ] T̢R=j2/b)~aqko.ؤP[ q_g 7;}5Od7weIp{M6ezgȷHtS;'ıQv~Cʀ y y;zT`܃LB4b:A0Ԅ6 c,P[Xx:pZA-1 TaxtK`p0H<`paے0CNCu\'|Fk.uw:֤2NK[6bsT~Pcrb$0 8&/hY(E+{d=cfFh*yJ2F%a" \ԪPᚴL4MT5!nj̐ߨ.:X%;~kjBGM+b,,X' _*.Qfb̮0dS>Uߔ-c$f1C! a>.\=!}.<FǑ(4 sZYx;,#e hR.*UKi٬Uu;xЋ]I.=h ^ePiݭ}7Wt.u-0ru /Iy/xDq6#1My#M:WJp0BBZZTwzX퀕md -e0f5My5%Nސ~xXpiMXDhN 69ȱ)= liY F@8P5p gBmct;CA02%`+jpfL6 cmBܖ0nq%vXT?-7Nq@ih|O72تGfXF-1{#xĴiK̂b7x`CC" r>`WI+'fNBl}Dø9#]?l 8E0*G(ZS;gPCa~2;̡WgS!/D~Յ}ݿ1EncIG`Iljs-K#LD%aT*mdȺAg5KKQ[J'Z{C0q g<."gmB, (F!`W^G}C0 EИRL`?vZ_lT%1|@ E ?TD$jFFGf #F2Lk@S: -,`"E;)eN ? #$>dsMK;?@1|ۚMlc?dK%E D罊7FV?` H  '®ptnBӷͰѧ덓S4"T /»&7ĥQ'N1cᏪ[Ԋ;T hcɋ!" K~GV:QbQS>WypjeU 5[(}%:Dr}Aa,3V=黠Fl=j@F̀fA#J>hFU}z+')6:unK},==#7w4_"#fgϴV&m(PF̜6")vm$0brQml̋jȷS8ɝ[yէ HQS$?\k ( pŚŽEn9Ẁv \}AR$G@Ƨ1 HǸh;p~!./TƶE`?9ר)!IwYڪ$PK]Yv.  tLEݚ94T45)€ !#P@i_ +z1d{S_Qa+=*[QK3.72}KVMzWSͰ`43{J^\bta'+cxc̭Wqlk-v`9.߰&٥ OX&*{$]-9k<-/L i>~4BW @&Dy@.#'Fޤ &CÞH<.G@Tw\6w˄V_c95>ǟ]6hm<1yb7^ ־ZT1Xc_Vz<۵yh'h nb":FW_VQj?;ߩ+95HA?V,vGl0 ܻ^,0˾14k˹/-`UWZKmȧ q *nM"|ʣ.Wwab1X>qW)tvj&XBN{\(=Z\4 .g{bZ.ʴXGz?qt{ ͯ U 2ӭhJq3ydUVM| }w&ȱ4fC4)b ^c.^`Ȋ&Y'-(_`5?}Ti G';P@ ) ֱ1ɑK7_۞3`#+}' f&O 5T!h,JmjL "/;=r*:#8`-h(t4 oُȒDCq8 IӱAlƿ87@(ޒkK:e('S4^ Ex~¿W6{YloT;G꓏\x('xxxXv_?:?7%IGgtholJ{QA;"]su}T,yh(2AQ'$ ։7~#8(ϻVH$G=;^2ÖBjcLA_{]p,7xqA8 Bzg;@y*\\:2_&DdNS1 eq ,7Y'c_ J hhj+vR441{+q7xC'+p^kl`ktJLsIcI !=8-~|jrW|}W<zPE$*+`TҒuJ\Yn-zQDޚIeU@~@ jy's~56A~02rݡpOlgi(EQMGiPsJ|WF&s{t {};< eBiAz/z=Lu[3 flr3)fu ɷ&@n>NYK[bHgAcU$(nP[ Ej43)Z}D(:ߊOݯD*]9s~?/vq z}[ ̵{HOe *ٮT G~W*3<D4H6^:J9X,se!T+6c!T/MQQάèt,k)^[q^!`):E*ƘWhiiљlM㒩}]L.$s[ rȮ)zDdKh4QwA Q`$,[WH3?@g9}xFsM eIn4cxɇr7#DUc>`Mz`4E%)?qup%5 SFposo-xm4S}9;(i CӜEqH'k^=<&4bAt5I@أ—Zt[SnV$ S'lnPpgi=ar+I$,;G6z=4L,364,prm\lO$%D(?FvaAZѲj`k .^եUK$P\jjѩz6]\bhlJX< |u_GӕXTv.* rőim%굠P΂P&0I3NFK[Ʉ6;eto&w6>i9lS%8ga ;> =sWu1^؏b t0ׇ(|f|>gQ6ޟi:0 (fjWzB>&jl>kJ{R,Y(K.~cN,V֯W"Fl Pןy,Xs`,5To{棺Ϋ=wgPU7cso|P8q=mC..jP?=hg_ J](~\{@j(D87(I&Ҷg9qrr&Vȟ[6J`@ٻELnx^?Ggwx3;hзFy *^[dO%'{Vnk#%g~Ħ1]7ӆ!mԼD-}e|踥XyZ+{l7{] mtN,%j쫩4 r+锩wWFIAEyM\)J}jmi/JwoH¹2i2rj+ќ<*@VYi\@^`jl+_AH{cP+Z|Ⱥ݅Vo ${Gʣm3nfÛAl3i1-iL[7K:"̡mWO՞i.Hw2*j|fv<*vGm. xgB-Eg\<1E*w]ȡʵջP|Z9\-p{޼"\7//{#𞜫YpjȂW٪F XHƓ~RwU}O,BfLa¹s3 KFqdlW0TqSށJ9{#J enq1ޑfWM;4055/Qi7Qހu1R}Mګ&8фf;゚5.r-N[^zA&* M]'FD*,FgmӲ(۶Ϥ}tޫnC܍l4NF,ʕtU;~JLmw {'.W xasu a/+֢ڜ\^ޝyщ]@s4CQ${Ӓ1Ȭ-v./ahGX8d"@Zt"$y$b1ޅ3q\g蚜-טp4t f]/% #u\t"=-!scYnSj)Law+)aAE>뤪iY2n#hv ]iR2 ubBZI*'˲bexy`c"j"<~;!H St3X |-C3 U(hۥeRC veI*r-"*zB;ZlR0& 쥦%""HPRz=q+`}3h)j8"aE[FPW4=e0^#{rM:ȇBN91pҨ^G?ҞD-_~]d :_BJkF 6+bFS=p=iA mRfN&)*Nuj)S]E5:WNxRhRYe~)Įgݽ"d3X/ Uwiq!gzR]R {XHgH_L>%:T;kEgJ]1ma6ϖtPUĪE(fSnljUh3z}&Rvu4>߃2%4ɟƱGqY><`o>|6I\KP;6&Id-@ kS*&cp,?'tIφ. kOH"kSuǕJuSN(Ԍ-z %`[G<*J|\6ij, URư%3Rwsl|Bo'î,%D/bĽԜHB o%x>("oɝF^Pk)1 "gn9!cxS}ʾE,AE8ĩCDv{n6}/υ $[!ũ4nc)5g6 eaKVRaUo{Ph&64=)C.=8>eq]BءԸ:Є('Zw]4 C O!mcQD,~4 Ț#]DB*ڿX|K8u0:6cmZ/ΚdǨ4"DQ!Qr.&s $Xjl@ǏgWc d+LMp'Qc_^G98-8#l$%к< 7՛kþ:#)]a޴ȓcʲO18 rLG" ;V>Ƌ77WD~.X9xluG]\ NՇ }Lñ1f= U GZLxכD2Òwmcmi3:8Z\mI^0elAٰ==m>л 3j߆7pmuّgeS 3H ^@ro)qb}q[48iC8)Gc=1v껂wJ6؏s+f1U<傖c#@jʤu }ZOc%n 4X^aLզ>%7=8֬B+|8(G`I!:;r~o S_ n~ޘ+I$ȱ{=@D "AT~W?b=rhPեcs4T_G.}avȄ8{<&P]'PQ7yj9vTUb0%+|*A۶=̬KST(a_9'ouѧ&+ x.k^W'/z] r4o $7FtS+sc0fVhT'B2r/!{tKk;͵ӆqe?9!Eh]c!Ĕn9|a@'wdyERW$hJs_E0ɍg[J_b[[m1@lGǓ)\<  , -t9ŎlYn&ɣ|eNkfWZa~hV*%C}dk_ST׸#++s~15Q9lMCX|=YSĝ;rA7jsuɭilD a`~Nub1 fі"Ey<'U1}lE=_(QwbO˙BQj\zplvG%j2V$fNFǧE 7޿hsGY,s9DlƖw[F. HIHCk >|#cXȸUaiIEdS l3h(Ғ(vNEӼS8ܐ{_kn_U5\|¶0M)los^OTUqW{Bjn~[7J=Um XJ4ۙdb-^9*O]>z[pSz@T4ǦN5:pg\fc'C&M)YSyR]:"J* E.CCbz#q5VtkWIU¼Ff5ys ࡷVRdZ;VnVhfd7>DKY0슝A BT㳆E}'?pKpLoӴL`'# VRYyr?0-z);(y2#6[2 x?=Гص>(U0kn3^c,tƬşSBjD3ǫgVG|oewO|3,?P}{2a`kGu])xh+F>3?mԆtr+)kq:ZtnBn|d[(IX*_6zV)&)0 [FϨvU;%UiE1ȣ]SEL`)9ǘaCۺp!y~˺!(x9Y@a(hv xBc# =o$- ;PW:JYa{<̧w,%)4{~wNbE"ߵCVUN.KMI=5h]E o]4fI~^ |0a5G(5AQɁ-Nꗘr*uC=Vr.>%D\̕Q $|B;ZBLduNj 0!y>k88aK[ұfϦiPCI-fJoٱ4y ӕ$Ԙ9 `x̉ #0 ? AVU _c‘)=" @ľrUԟ.bռ@ w7vq|  p'"%1 Q/rNZWrx}Ոlixk7 cMЖ 6萱||lWFl ՎRӷ:AK_8ʿ5?L:UT[+MOw졒_\\O<2ÈTuccTq< sq,pl3t3mLçjS Y]lwYᓝ#wqB( WlwٺGv~K>'~1;vD+t"+ٲKR^r;v8yiqMݖV;}ʏn4!HFANH mSw~eh,H95xqo֘4 X(4+9V}|ز<+˲I~^?/pŒЇS"cް 4|f-T> ?̥m4Ze +m $u:<2p#SpcÆ"i'bsGYʹr5.JuT^XLoM#D_I2G aj1tF~;"f†#΃6+撱9cLe׫ܸ!J>MiVX>2!@{<#`^[GA~(&.@=#aEtО v)W -e(t HW|aYC!n0\bd]a;g[.Y& ~ƥf.Vzb5LF W-1/ûbqsuUm=z9.6'yKwS&hB:²J갍()HS<&cgdO&v2VNg6` GңОvjvP)+"vTPa:Ũw_=Mh3q—Ɲr'w iuM9vX{$dM#pn [/i0)n/6̜f'UÂW TN#Y(VJr nZtGB?TAqEaggQ $M{w׎3Q4ZUy}勉 rhfjNF1o?Ę|KejL~jo=KvcR QwCW2}T=b*fT_خ4уʽQ=u;Rsr~CO>ݺϋW-$;}W&C܆4bL t4iXTI[| ܼ=\0nyUs7t;e'^"YB@uۦ2e6ԡ /a*zKGԑ)XqF/2/Fzy='^2#7PxxB7WB$hJipѪ#* H'i3|D.VHWi[.yC}ltsq.x+RSlP4hOv_wh'5D$g} FýE=:/mm>521Dh]dk{$0fYu&YyBup߿? ?[5K6}擏q= CybFIiy1q !_qzދz[S@v&z稑ёѫcE-rR$KMN1F2XHK\ #JnH2hNC3J^gVϖLQ]7/18!0MBn7бot {ɖg/Xrpd89]j}ĔxiW(u)F.6\k`.RnJ VN` ] &N#Ӱ 6'ȵy0A{A֚f] /* ΀v8MC Ɓ.UUuiXF'k~g7 PP 4FMQͻ}ZPEB>"j ~JQ-T9s M~L:y[B8j,ZaFOcs1x8rY3<diٰTW ЪJ׿ 輐[Qeup{Gs: 3WCnBXo|FE.\- q]ʇ_TXl^13^g ߪ]Fs|ffamƥz:nEzUhP|I-E=TpΠ,3U65u\ajK@e\AdYcymGAҹȲG;O1E\C`bw ٽM l'C~u64iY Pqu'^Dنsj"~U@8vE]?UVEuAMI+-gX=}U|>2}% PlsDwYV8bDPYމt[TG[Sij4x @Ϝ4۝SGl9U Ӻ$~#\y)vs;Gh̺I Jѡ? Aqd↍똨75B ZBd:N,(g[`l<2ЪSs+|P(/0OlDWrP& E<ТeeTam3p'1̂__6"&,i^->9;#N}d'I 3IDqȞixw' oq!i8w:X Zq}6*7-"۴Se.Zq[xnOhuc o+0K8ܣ^ FtR>b졤1:98ݡ-iJz1G g t< 7a!HaEdqGPVc$z8BS8Dg [AJBrP氒Dv;Rmᬥ"+ɸ@P!g42M4Jy.GG`9rӮґDjP*z}\pMs<4(/{8!y,X Apj|>k!ܛOmɍ%]1f:xc8p>T;a:%Ft>7, 2@;*bG`{)ikåKSz7ln=K±tl[|93PA;nX|&Y;aBS>8fg;e4O>̽Z:[Vi`mqh;-[cD:ٯC5r*L֧dU4U˥\G]~iD:Vp̚a]o"E;AX}}fX=Tm7 +HG^7cbB4w`97R}f:cUVPV-dWtAvR"@A98jjotc fx"&$z )kR:-sIPO̘"0'CA@7~cn8 ]ڣT(q%S%OdqHyT4t#3gK67$Y,E.K=lѾ탠ۑ ' D15Cn%Hf+-uG"s0KԮ<%)lP.<{OW):DfZ*EzBOZBl|MS{ QmoDH8^C;w-mVbG1IDPkѶg6VlBI=$~an-jP(XSԠCZQpU̫k~C%W'Jf[ %-ДnZH8iA}`>7 iufIKRrE%M ic ~++H"HېA%M̃Ҁ0YVBT eKmR|݃~s1[$6Bipl[2w <+'9k)fZ:Gh&FcQzJ1Jq䓹T֎CCB32efPDh~ulnB:'iN[,Lɱ.\Kv#kwP,k(0`'^WR!6+]&%IzKQ\֎BN\ Tj$apcp+Nok39.#p##Xzy%As43qpwa\?@D!azDzE$V WZlBYkm:",9#Qp=6%-X.=Q ;U4 eylkұ7DG}G-,/QfVvGt*S}lz5z4N]%Y|X]=HYci86fv~48( guŒXj~ۍuK1cۙ^wsD~_grʩ<'0c?@{*dOإ3aq[oa/;쬷c(Ijҭba8﫚,Gqs`_ͪ25,b-U^Mc5#dn{՞]؉K\׋]AHf733-lM'xnR݄͉;q;:Ȼw9qoNa\XKbžLa -31ܶ&6spS2ߠ%%}-lLx_e_%t+2Q{RU<(B.x|$ayKF P"/ Œe!jPt9Wfd Fˁɠ>W9vqNT ˕ gfLrYa>t1:Z)E8mQb^ N6}?{Mjh t$˞-APӡ('YL#,GԤI)8Z],yff]=A ej/ *D8wH8KظEp KHP$$%8C]twR*ȯ*x xwMdv?AD J3fM[Ӯraa98o{M=;˷*Ȅ"܂3o{{ RB~LO;  v]:MaKW Bo[#erP1s4+%jKc`nUp]W1GQpH|zt6D8<~c \N\m>VV'=- iգxaQ,,.6 $fvꋠ<b/9J"b/Qe uEU%5-`=yʂݪQˁ,ItJ2x<ᗓZNRFߎ|C1I~54 a5s LOx̃z0g׮~'-nwn:3[*xvrk8lp3)ďIITIŖL\@Fs7`}%Z 2#- P2+3ujҊr ߀|(vZd;GW>J6Lrѳ,R5\*x X rb^,Km4L-o[2I:  eB1Q8g%^$u7'7 oee+N~V\X ]U-KP枹P2PÉȅFc6KG_33\_\+ *~o"En-m?| hj;-%EstOmXGr۶Y0'˩۴G݂ ogp3dw^ JIL S{+QW9BRI悜sܯ簏]$Zd _w ډV[ /$ -kNmԼlr#^ /P[O4_Ac&felS6hNK J9~eDKgן\ M=´]1ZsAm(FɌk电p !c $p$VkiT7DhoPkY ιkO=qYcρhzY,"V84w ny õ? XT9Cbaו l˙<`cLp/O<&p6#?e3Ge.Y~RfGKZg!^,4-QMKRcvC\ifF0*2irraR~FK!2GίzWTO] m^~}" j:4pIC`o, xh5p*̭`LС\t?Ν(1vʦhI>LW j&[.pے=54tIJAaQ^Hkĥ?N[>BX ?Pr7 aOmJ>&ہKѕ?K3a. cUˆ__Nb?(rhзOvjvAxޫpEv"`u?*SLQ=8 Y3U4\ p;u.ypU:]1;8tnqL9GƒƝ_, uFo-4u>܏gt`3AYmWQǫah1c,mmvgY{U[gs_z3J[Kv8UIU KiW4cXVܟ%=_D^=0꫊`08)ZR$Q< Ș"t4m7Ⲫ͞EP95f^ݲ$ Y +S&ʖtjuUc] Z_ՒxAX{FT,TuU!xx0$ TBW͙oR`%',qWZ+tF""Z{䪒ݼ2;Ext=CRPF]Uf#cٍ p-8lZ!ACn??q܎ĩx-I1J%\:w`^qqq%3R5qS)0űp3^{2Wza/ ؓXtgZ4#ܰp'S{Ph105R/ЍKlʯ({הɴ) =ʓ܂:wlVLp-iÍcP\Sn7żZ VdK5'/ha2jNe8btLJ0WL#@4rib9JSB0TůlTG{AX,@"AqQ@).W ns ̕j\+<+Q>yU,[ozME9 J,*op:_J^{:TƷOR%gC {!a翸[Vgdipd^RV aDq@O*I-[tZ U|Tt\X*<>ٹNfҚ:Yf9ip:ɋ2EnT9j<1lbprɋ3RFazK 2KxZ2ƌz$MYkmbHk)}S>Twx_J DzEN/߿7D+Ü!W%|K΢MIf7QV-\¬m,E>3} Ҳq9(Ⱥ𵌔cS $ 47<ʤSaƗv杮-Y|a&fT&.J(޶KoѴTRve%yq"LoőuYh$ Ń>#G>g{Q'jnq'slfĊ4MOR58&s[ƒ:.I 8Zawr3s$);0_ý-1G=_Q|z;%[l:Fˋ״Qy4[1grE4f_ 1,y{vcc{Xc\ucΩ)__u+uEaC׽BsybYP;-& ؞ibalYITs#%)=C\փخ8*f)]qYXѡ~^=?2Mj܀GZ|72.jF@Jy]6DȠR^X;Ӆy C'|zKU c]&h+| 6=ކx"zB >sX+5XjҿYւb^4p_V** ǹBpFTJY2JunxQ6UmŦ*Ë`,}m:.vQD J+)k"*tү+xZʴp3oܷKf5.["_:)nG TWNYO (`/F,L/15pysg+oaPxΡKͩz5|KDWt'_+&F<<4yuTRJe{ڶU _H$;y1< ϲ-SNVeȬƊqL1EU'PG|XZ#bm3dJ .n bRVg^鬚Zy)|J\[{rݴo&y F+U2;Bv} }>C&ä3fon]|ȝ0,^=f43O =tTa*^f:fg3F4.d1Q_1̬wU-x:ϫ@wmA4xZL6 {FiC13y€`:0wS 4z$> +&; o&9kYtƂ]E{VE|U&fVE/ !l^Zu3j;eL鱃n!'?Ruل>81-pe{kY|pCw9,Q(9I# O $!*= n ]ѩtQ0TpKQ.v\|EjAue\+Upπu0ӰIhY,.;r$}Z`#/`}|$ϵ|J)`-f4b]pCN.h}]ka+ >` u4`{Y:E0ҍdha|` )tT;QN0]) m~zԧ;qӔ .`wadn'o³KzF LZ9,\ ^DmSG?U'eCȜ+2,T0i(nKd#c7SAD0)[9 bDJFlXbغoeZ*:~}^IZZةWƚNb s+L",>/g+̛yci$),h6D©oe$hv(zyOSkܯlLdx*<3e"xmz O7ꛌ {^\1J .2m#K]WcoBɑ4c ̦W7!'MӒ|1Axؾبi'编USrpS[<< ɠWn8j!S nl~K(1UYhqe'²Ԟڧ8lMC2=>d;̔=bCU6Oý=hUIir}1EקѧR|Ia1K\ DWw!bhZtl [_í9TfP{,v'Rai3Gڭ#ŦZjt@Tq>:'/KDv}>+o?6@1T*`Sh)mߞ+NsbBr#Ah(厑ǣCCVFFF&o V[d}80Jgt0EO/Kt9윑H&۹lJdaUtV\DFhTKX uM]qHD#ƪɆ󚸴cCX5MMxK"+ˇKX>U.W"1zy}6I_,JuWאGFD[Z|N"r\=,k%x,]o޷ A~3ow/^M#ж.}ܴԴulVr"z{Ӹb`OTk۱`1@xg>pw9"p r; ]Ec!4R^D4S]};=Iػ댦m{Z=JoPq֩Z4̉͒=/R%q! ʸsЖEW~#1ݖ]~޼+ןjKBzs4l0@ zZ \_ 7^j\'Kc ]*rg2C#V\B-Ad(1>>uA'>7a]b{بQܼ;m]RێsW?ũQ ؠ=q/sX64F}<ΚLm}JInQyq-ɯ¥';kݶ!<{5Sc.]|$ iÒ$W #ef !?돏To/"#uoF$8?}3쪕HusdRUAs4c*mX-6_DCo)$xKAJ‚` ZoL5ll"#ԢtԢǻ\$"1gQZW^$~iE-=Y'YeEBv%e_ӤYjbjBQa5+ K!ѯL UCYZz䇸)@u'Nt lkЉ95Z'8ńI6zў?o_~W;>矿K5YUIaoWV(q4iߢRߊwط_%R~n ;?dǿ$tB﯍2\,E=JCmbپvD5laUail1"4b֫ŠyT&c5&"yA4A1v,PB%ٕQ*شj0c*nmF^ߨuw@| xd̤򠭢 rTbcc5L $)L߷6f[S6]tꍳ/}B->i9 Ob6$`EB(#NZa$I e0Z=="g-?Md'q'O IZ'J> .d\BD"wDм{$>N#s, 8Z*"$lP0-`f<0 9$TSc[UB1@=]>&ОOs|=%\"Z)odnU% eAגk5 OǠr':_ngc&Ֆ` ݥ 46А\(a 6[Fݬsq̕Oz?r~[萟_LIaz3NK\IF?9c՘/ *MwH pe4IXEOd؂.%|Yw:Ej:]=g2 uWn[-8yA2eDZ@:_# WW6#]|ls(ʸXݗR Z>t$sQA;sԧ7vMe!5*XMMTBFSLI\"YW~F+h10-b%YÅ˦~8+|3uD?6mp:u88s`yu/[ؿOIaRn|Xh +,g4WzMtpYue wj,~Cu/!- 6 I _,A" bOX妟(͏|096 +ೠ 6xK8Ngq^ }E}EAԅȢRB$d#~w#P= +o ǤJOѹZ,t?T) $㫢&e`Gt*_+-:RR./%Q. B.], e2>Uӕx#K7$L/BgZ=W{|u۵{-ܗRh=H/f$XٓO/Ljv J%m&sTc>e<*t-Rb@R8f!A;o}.|=B !sm[F(P;h?G?Ra}I&VpĪWK)OG!ZBF+cZxK;׋ge|.lD6R*F*zB=߸:67ﻭ6hteNK']ǹǑ!Uח*OżxuCr[Z dVjEQXVS,bE ٺУC|=}/{&Ւ?C@xk0BR՟"BMӼ$D-x) _&jfe1 RBXb‰mi00\6̚ʠb,{jS%,_j ,-M{yy#tJhkC '7?G~ŨN^/`UdAr$NRAؙ>Cs ڊ;V2r|}FK~5~[L4Lyv3:\.JE'aYun uF:RQ[Ш3F1 j&vUmfZy_?1/UEQ.,fΈYx1I׿z0nx>gᖕqoA[;oBB8<Tԕɻm$FBoTSL^Hh }v5yt~]z]Ř"D}1,2ۆ 妇TR:mŨg4 =9TMxԘ#fHs vGY){ȳ#4',Xݢ)ݛp цqk"n. ,$b]a5ۆ/٭R |k pC;Kb}Zq#c; EM}: p*uAaX6gSV_D`qf6 cX`Ҋ h0u>LBdntO|v#gߩkTɳO50<[&*S:DZ⭦@x)} ӆr"?H-nqMa735!Rda&r ! ]VױYulB&PUh_|jq5,r֡GSlOf7SR_wb:{K!ysuXbvqUvRXSYGnw^&m9՟J[ 4U8BΙ8nz7+cwv;lu7[ɰ5 $o{OF>ӹ):$]PR O}' H* sRvW4 ܝb#kd:sǕyyȼ,1y<џ5*SMӄUa¢>ґ9cث_Y)͜' JR8INǖ/Jxbq;Xot4XGq#r-8l$lN~11gkGmZif/J$U%]W-鎫H(ٓ x@'AAˆWb `5=bdv֣R'^aGuO&I]5jv2S}rMթmh<^1~`K%$$Ū5ͷVv.JkKvwo '~M"́o{aP]\ӍoD/b~t&^:U:~?c4IB^ rK ⧪(L,b¾-dgz.C75Qn? ~"Weg5V7Q=j>T1@t\p}`hg/ɱ#Cib3X*lpg;\.{w. a0[s24.9Xi@ <KpCOWUd `|s^9\=]x+@|*)25~4x0S6\>mCNgW1 qm*w[bc[\F];v/4*?X mGWepʙymw+> SRF(41\mf=6C=-5fX )a`݁99hF 80U .IPmxO*& p Oޓzb=ß=aNܓ@YwF55 OGп ±;AŐV t[=Y8j#B;%l+kWR^{@d?\Yts۷='q[S |Nk;v8.ڐ\fu\z˓s{ d4Tͣell YF7~>s eLᇥ{v^ Ց-yȨw4Gl*KD%lőoIrqk6q5uQ9zsf7`l*ג=Ś?LFђP~Gcstt 3>N kИ7<)鏬ٓc"qXʎV JRTFyɹaw@VnҼBlv|\B =jCea*vqmEI4RV\jߩ57&3s>-SHϤRU[4sD{ZIO4=EFv,DF,f, ./,xb ċ%1gD-&Ft#WDxM>z2l#ԼuÕǧ,^5o- W\rrSSez&~`ea/%~AyLù8C%y./OfƏnPn.ܩwnr^ liawLڎBgd]{Id]]enlt06Ͼomϯ{UH@ƃg] 2#3}phx_-ƸԼxmRP6vޖa-at0$0| (r/JDc;="Z^?0%} EBqs#avt\L0<7b3d}OPT::Gxi<ӎ^wi}j]\3,J?~Nd*ީQUȅw[&I_GuxAs");L/q)oB?"sC:'uv/lQT~y'}ҌH=º&<))oG\~yvŔ4ON&l/)Mgh(븑g'eEN@~v%Ǒ0*1_lG r!Ap-QReѳ;.;~ndR 8lےo͓UVȧ%NyF%%x$b~)%IBz)|OBg)tt %MW};ˋF,p i 1a-A{~4FCJanގA%O楟wt^"O(g03*p`\ "K1G WUԂ)7襅S){CmΠ,LdjjX Tq3M82K'j].$G*k0Btϙ""%z} h4M#M:gҲb}^=:~3m[xXĈ(wF/%j;oe2_`UR !8̃\g 8ƁǁR7qMJAog=}d37f#t#o4,! Nbwh ?+v u]gߧ$[ϟ6jHbg1n:)AlZ~+_MڌΰXХZy'_`I⽕jv7c3-;1f"TtH3Gi5X)zq0a鴀~;4곙 _u",fg0?i}a ~zXm HŽ'Lqinqn9ʹ$!U)thkβnA&ʃ7HpSZT >i^_1{'%.5УJ͂pӚv$odTf&ro R|:گc$I_pp^g+͕w)wtA0rmqvM=iJ荙gMCuΌ[ǵsM9 s*Ύtvwɜ,(JoLd,h)a|G>_h^FұΖVj=Lʸ*Nei ş6?@u{,y}^Q^uKx3bPa~pOz.\<燝L&%sT89p XM0nJ$d E',ҙuC FV^T3pr|z~߇ə5r,\=d'WE&#E`jX(D?/<Ĵ0rhŮtŖv 6DKy:xD{r4.DP"jZ}]q͊EH/a?dK":jZZ?Lݗ> źfn|.ulMc5rw -^ljH`秗46p*{/3$Gv1Yfj`"*,Q}n!rlFlĦ:a+{MT(*TԈ5i$aI fG0S3BAl F..K:3㭼((𠕮W6$`+;vpgh sd}T̘/]&E+fvyI`Lq*mcb\o}ρzqBvzn4x򼇍ms<[bB6m'mu' vo@8m4ssqjF^[ݔgز1QT S;]Mh$.mHh:̀vM䰣*̕p^ЄjΫZf_HryC4i`ё 5л'b]Xf"_O"WvYR}jY6UX<PYlqKm),a^Jbʫbjꛃű4'A?JgU<7q62 MR oyf@My.vb1fgƩ׷˖kKnP9VHZ;SKЇQp9tkR+>P`U=;Bׂg=g(Mp"Ե݇$ &:WdWJ}}dz 17}6PL1(daÉhiB}8*_㘉;_ą]n|d q٭ѯKz@ LY]r<^- B=a # 7!On"(t}%~8BHp8=yJ{d"BTi{'Ys0"0c'd ˝V/,eë*(3'YTZqg?vi)1ɂGY4tvxfYуoH HY3ݧ'˿R6bj%5^,*Y(=eyWI N7M CJG&VTTg;,B?lg7fCVK!ω 1ۦY( 'ìPҼ(gz]R$;/03Uo[1p #蚣j* ,-:O8E;RCq|7FԉT҄\uW߾bw ׫fj +j;Rs:kcͥ#FTx 96|fER ̖vX;)Q5Sxߦb~`-nya lo%ko^JJ=8N-űVv4)@>ؠMw1Ś;]Hwk_yW+I qN2 1oi_cA2ƪJFd>LIF6/Ο9wA 'h,E@&ekbcd|+GzQWymj֥'u3X"*9 XGP< u։5zԖ8=wy̍m׹zuMQYS U9WqB!Dܲ`?5Ǻx<%4u)_1zk&8oR7-N8`:K?s!z+Zcm}SW:SįrWIe'D`^+obTc f}R[M:{d_!^ehk`"5uέ HODDLv e6O W7:+3cWw-;7KQ'5j 6)&y˶q;#),|}t \bVkWZt1em*Nv&˴SooX!rljYݷQr}-Kc̓]SԈ ws{E nn^;Xajcl~֙n 1a\mq7?ooF5!ZI$ z<Mm7vjqA7{EjX圎mzRYAuʼnp.7 #_u=lb p,kn-^jUD6E,"_ۋ&msB9OaLJ2=KaBp!Y~PF<&ݴYxpUv7mQz\ /TT/NBvM(游0u=U9ȒFZxD*//ԩӞC:jnZEY"uȌaNaǻnbR:gXoNڃH'JISJGXM}m8udwX }*lvexaW6M?Yj5_8",zʲ"م5yu.m[0IڎDa: 5d Ł2VGFS f6{`W wuBy*FD~C#kH$1 k,X C'"~%3Ó]K{ hℎpt9[`Y#6U[f(GYf8*2%\'Yrp+dk;K\a{L^eh=4"Jgjv`LŻM L/f2Q?9 L LK+.RLS}8"^BA,ZR7a\"{c>ce=wN]1.2<<ފ}_&WVC2\쪋v!f~]L'+'zTW{IJ $ߧxƨqℲFV.AZM;_\N5oܜ ؒ%Fnlh>p"SLF6_ )MZ#GdX<{J ̊'ʚk=--pZfDT6f0ydv⋡˹r6$S1 LJu}QGԥ=XrURrKvxs( g 1v/Zel%._6"X眵s(n5#=YK"Ƭu't}OK}.Q[ `n47k-̀ýLF w]ou5c1=2$ c?[n Yf@Io4֩r i^c} W]䌙^9iej}U}/9u2%qqύˊF&?sz?a8~dzm<hZz}x'~HT.P\Q$g7jSoio%#?wa#>~X9$PMzab앭*6ϲ)%pw}$0m%Xz)-akbsXy}ܕ:2;Q*~X 4I;ax.4:D cFUael`U*R_en6E<j$XU :"{>Lkֱof,N^0W@$0fZG7q,ze` `N)5ƬK 1|o}_ R8A^a? ۲L쉙:Vu 8_eő]4)S=^c@ISrP`ێ3?.TT DכACg8y(?ԘQ7N88~I=W)O P-J'bT4&K }g@DۡG{,vyrgק{ɵ mAak =Z!K/p lA9OCbƉp!m׮\Qw|RVd܀vRcu {DZ='AOGS|RA}B*_D*r3PTY)B s@C'S}UsDݾnpV`L@@@\HXcʼZ{~1bnZW7zk*0İ1a)Pkn܍R r~T&L=w"|c"w 0|vIn~C"OK{b2lJu/Z~0 ^(}5\ u`)(pZ늻@@lA?`H|; Ʌ@燢" `ůn+( /PtI[n9oZAl|B7h xSC*CS:\C;<|]ͯb=c]4@4 HWǕV7̯"! !rͭG sD+/[H*#[FOcDf2"C ^?…F /8:DzJpt~xvw4MXжрo̵Ǟ+_"N!5ijthqdc+V:jN8r/CyaJ-{0'L~c6NN@,,e6gJB',&濣dj dbL(bPf\so b׏6sTPɈFPoS(Jt)8=)PՂ)#7/.sje h`4Dnϲp&I&e%c"МoAz(/!=AUU{xA P>kmdO`;nAS>;dmGZ[KJ,t=a zNSmŏea(eJPlywζ>KD 3hȼ>]p:+XuydI@*uG;c0{D. L$Q,qĽ_D"H<\{ Jp>wNg X/7WZ,إ'5$ @UcAq^*:?c0!!ToCW/ŧU0OuY;V3"'T?OsF1wv*̯472913=ʈ#Ow*㖐kUotjTéL~ SvS]){d>1PSlk)uz?̧A2|~UV=Z8+S:<WqwS'Vz^s> isgMZ2P!1uw2Gͮ"} g{k̭95:GO=c;SҢrg^z/ Rt;ð5T{@Y-SՉE L6ٕa=SB;n "殇6I==Z3)a3Q)ۍN<Ew͐N/~,)RtbDrkzTs4jUVhYo<.ya?e[1 PTifkk ֎7l$jGL4ͻw?:y9սJ_Nn H,,_ur]zX[:%$2jTocM`){B)[vD!UΥi̳m'W脳Q$v@&< giX3Rꛯ0E"7ϿLeF u$ǜP&]HZ"I i7CC.xaɚ}eC v;(bzJ aFk4HQTk:1;~AWiTɽ-|(z;@:Vcl=ޔv2H%E?֪/$2BF& *U.Z4dհ PTZR?$a%IsCgi̤pwHd>KYzwZ|LV;*N},{W}22_j|2ë׉;DڜEP?wnUQtm}͉%%Pu*_t~x`őISZ+["o9*ե2\ww{4,K䘕*HUfs,5i@<~kbUAp pEiq^ʁMF} !V)Wl#Iq$e [*2 ǂ(ǹw0nARǯbOq=ġ]qe\gd8VuIݺUݣUP^P8}|_=7&EjeѨu*2}X)wvWxEmri ެ9Ayo> ')e,k7#*КsW#g<}G4v2Wrv#"iU{ ??T cwyJF68mhkڼ@TƴҬ])j`KbZȧSևh40q((0l H bV+ʪbπWH>@'7'3d@8$aߴҹ`Bᵧt\]"MBY/'M(WBFuӍgJ7 N+VhA! ; 2򘂟O%=7~_-ZV,!^j dO,=UbٝМ38Rfe ;a]%זI;JԃfiIY:չ~-n>C?M`3OIPj_IP2+ {UE BD>tL0C)<ŰYj-i̭j3_DZ'4]2]2f* d|:?^Ӂ{5Scqs=Pyb(kif$Oi>ȡO%;tl|qIuuqoHUe=`@${t\8Гq : AWwOMYR*4My`ړfRY1C|jV%VJOUZ8Vj>hY9D*(&VtVv ^F|ޗ2cGo̟zQJzxJ/kELO#)eQ'm4y&=RsL{|+XS_Aa@3%9:5E[喞h)Ә:IHƝA3K$(5 y3ZPאV!wMIrȽGP$b(I*UFtw1Z%j0sgݐOazb fv~ťaZkU@WKR0Gmwj532or,IvZ*3>\ ܯo֔k I]EhF(L{@.V@-4ɚ5!#C{~ ^M;5[LDgPv|YaEXd2h_܀,)}wRk $GYr4#p3=›Ԉ0&0JJO''S4̈gʠNA2RuPT?=/4 U~kyf?Vo56hy&K ,R(Q kjBY^sU+Q~Iq2E<"\f9sqF-0˲ NLhts]҄|;hi&h,~Қr5Qb4 R3"d9U,4ܦT9 ?ug3r}ۮ F۷B.׶g\y=PVĘFPqسzZPm "5LР|KyCE!rN"<+d?.34Nù,$Ծҫ.^:O b6G^Y dŦki'&܌@dchV(o+x a.%}*s?k+"zL8&T(qz勖Y4`D~C]Rchɮ*e iSHru8(M;бܚ7hбR}]a;=VgOq Ty5E=htY ʆ^{%$[˫CT|rLŊ|U* |/E0r2ifƔ L5-Ue7R'7ێPڽ)|x=^ UeI&Gemڬɧcb)R69ޑIv1&)rMеPOon 'Jkz z륩tM*LVx<+GM4  ɤR6mgbsW{Ͽ1VT z=޾ UNZ|Fc.Ck Ktw%> E>p:m.tZi1~eB[A!6!,ei b.p/\: =v*ꄯm/ my SLBjx_HH0ZE9 c+\+j6fk9=`[ͷ --@m޿oyI> s]{ f9 je72۵24GP(2°zWKh<|˾-(OxQ iBۦ=LQ Ӹm\ڞcd)V ޺U|'t>I̽v4~wmq$?K_"KE_u\'@qNⱵL\Kw[7T! -\[:͝Z_/{$6mS ҋgJlGV~ >2WܴҨe?ZW -q-]3Fqo}0ӱ,ԗ i?gx[;E iMLטU)\)O}?N^H>0pZ:r SKWZ>J9o*=L$}%ޭV̝GK3r%>zxha׭)-U%ELvf_+G{u.qn!f> Rx>n*l^L L 5U!GD"$U߹΅>qiݭ밿Cĕ]Kws/Pxk˿R oQi'~WǮiD:&@Hp%-o:(Ryr;ޅԭo!I?l@mꞅ:i{b}<#E4JkLwU]qw$[:ic ;< ?P͂f6IK'u*5SoXHHc($H|zA)G5k$@v(tXD[6-oڬiدn s$1Gb*{NpG. !z>r d8&=isxr(w-KOL烕xrrNGhr_]L3SEN阷$% SԩxZ hR Ķqz2E9u!{ż>pqw쩙jYMa3>_Bpa"tvK;~#:W)X,} =`-0EȹA pஷ }={q (H懹&8Haqin Oa;W{nAT.&IohkpzR,ןD )C uI@3?IVДL1Naf<8<3P$􍿖Z,Yy@ :G-Q g>K jҟaa '{o6 K9gzf7s{FLi%!\r[&֌~.Y}ԸkbPfJAV[FTn. VAS^kJO>'b֙u~Ӑw%dDs_zJ,ns"}5πL8; Jߣ,͑xth@]VMi [@@WLZdǓ3rW/:9䂢#g:̛sun\YtsR7nu妸s\eBCith!/ؽ&~-\U:Gu ;$p\3{fPghGZ\r9P/~jȵF-kڎd1RBy M 1˞'ǧ,-\< _i .7z*M=dq]%Yv8*}zfȋ`d;'?B(R& 3f#$|bֻշ4 NK?;k'SkSs6Ն뤼%=&lCz̺JgM菄ỷK;T9>`DM2V2Ao Troi)HRm!!3]S~^n{Bo"`X1mR5fUJԍRm*Uw럊މE,! `R ' $S>MôeD2@V}׃y]mĮ)~Ab Oe)f˻ǡG~CD-Ǖ嚟@@dZj6]e2 W*$EpfU{{-5L`KrO)0C4/m ]Akgʤ ,Aؘk6'c͆svw ڜOttoiy4+i'7cwKS :{JA"6nܫnc2}[*2;d4h]3m:;kG,u}a#pF&_3)+ ~1{LHG-NV:/D$)lc۹Ʈoqg? I*y {IK͜00tv p3DB. f#Οk= 4 r!]7ÙϨb@pmZ `-IS1}D0f}HƉ÷mٮŮB5p1K, ;\u-%uh5& {C,aIiZ~K`mɵDJ[r8*rV)MۆJݒJJ+xWFsvߵھ1 oB(U99/MDִxO4_[O94ҳ}qEa [SbA,ogEA KߌмɷHR\w23m#Zqr{U7z$}$Sqi&KrpU&=l%^Sſt*(=w[%4>1.x3xo[`uO [ߵG«}Ui^W\tfu}a6i﷊[ju{!ڳ~UMݶ3]C/ 4v !ˬxiޒgE LX:d{ 9-AmOK4٢i%>#nw>4[+b?(MGun\\VȢlmYO:uaɆZ֣ziEmB5nG/3q~aJԔƹ2oN{<5]hpL$ Ǻc Yb% D4v17l]*$ym|owg3a;;cfԈf2QL!3(3iNGY uϽ^=eArq>/M{iY61+r28{+`Kн *G@H%bi>WXNpM2;٭'*1<{=*IH'R cGCʧReFR&F[#@vhBKn ա֘ՙ **zY>~E6Zd )pvBڰhJ&^,fߋDXA9#]ۛpE-tU(o󤲏f\j-ILj1RyCGU+ h~fS^@u+!?*Q 0Oaۉ-F@2̯x Ze7}|ԞۼlC># Z+ci5Γ#p߉ 8wrc̘\Z4 M3A9; _L9#"u"h~syRdM/WC'x"[+,|D:ٍoٗr?{`߂dH#`7x,+Ğ5 #!΂ܯ inWa68CO݂P 5CN L3=)Sn nkv3`ܧ*j"߸3Uu &OJPi1G1O  <.vfʿŵ0v0?P<Oy9ĥe\WM `mBrzO^OhܑX+ogІcKo:( r41c |mQ8SƀWA7x޸ɼP?QnhT\ Gp1ѓs"'U@8ݕ$972y9DVtlx"_KuyeW0t+@Q2Ȟ>` QϱCnIN\z8d!#$ӟ$*"4դO,8oI ,m$SntK!׼FS (y?q@$kg6U+ %A_tQ⺐14e*#KBt+&+á}ʞkoM Wǯbfܷ,*?*+$aK{r \jvv*c>hb.Uv:FygaO*(* x7mNs}M] 6/ső[Ti/$ɴwUW{F;w{Fs)0)60k9WyetTҟ0 §keئ_:?HX`IFuҳl}LWG{,- i鎎#`ҥ3j{jvLο]"h}bg61mv:tIfF5qVjQkjvjU:>S4tn%<׌Dz<a@;7>A1@Pzp1L_!IbU Ԟfܢ,Rr 7TV%Uj>kcGGroiu-e4Yx['osHcNcl$?~CNy#ٔ#'e)ͭهAWZ@k+&kTG=ApJnQIJm@`{3'gK;m^wֈv@+j*nV3|F̝- wH#ň,a/O\O5???6b3I<ʟIolߌ>C}~!ŦQ3g=?WxμXј&SRl\EO6tzG:)"KXw(Ymݧ8uFT'{Iݯ+7ϔouoG4+zv =$BCծGeyr "-}LTC-իܖFAZz7<Ж#_Y줝af G ;w 8N4yγ<~T헼D~z'od MV~#TZWHXv>"iݙ}E UpGiI\P柋mCR߫5e茼 97.0ʴE}֑R0 X}TJᚤAT$À,5t%A.tm|Bƴ27w0BDE%j) -w?>iZA՝8[nR믖RuĈ#X8iE[Z1C :fW 2?5kʼnִaS<2ͻ:<S&ɷHe'#%3Ջ%{x.1S*~<|u J9oП`pqUbõN)гak 0k _toV2\Eǐٴr^,~LÔ)vu &;բu!54R٘Ç-+k"un%LWΪPtӼsr/89;{ Gl쿎aH3i ;mT#w:s^|?ǑHWN0szgA"6C!_qrrQ]=x{#W!Ri&ua)t`9uONDzFcrDQ;e:+f׼>eq8+7&q4Ԕk惿Ecz۵=@U%աAˆ!KbT1t?cguio;r#x. 7bɡdδ)"֘|ˍEAL mGWY^?n+O @{u#Va./EhmNIͩ B_Z%uw'ml*ᵚk˳~lYЉnm6(Vݝ4\jSi]*3J H*ٛϏŬ0~B TH憈UwiBEpD|6n{XXF !hǝ/6"}Rvy, .>#2ae> =HzߚffH^N;ZgzԽ]ތj= u* RN&kxo^695sb#ˣV>B ÍdPD=H!4; ~?y^<_b@!ݲ!rṆ>e5(Pp(/$>is<^u8ZKOA5Vpϲn Z$T[bBt2<7~lszG8>!$~& }|:</#8}WeLaZt~F&ZU^UcWyB^0u! $$&ļb 7&ɂ "'S|ÂZ$bZ} ųŭ_{Vb3ЭРts"9׆b:pX22\*f< g.7PnApȐCWMA)HGWu $Dё}(%ߧ#e m஌د?LNh8˵(1 G`\'냎8$"r ["ذ1FG[?ꅾZp\彧1AI9y{;Vwv\&[Dyx1c^Ȗ&7 Jee)q)txw/<*G2c}f{=w_Bro8TGljC'[֦7~X]`=դ1{/q3g/1c췟?;wK<Rx(* Za񓆭#z nB p~}T}(\)t B1b6O'dV 3yJPk蘑s   MT@эr§Z-vH F CxҌ"?29`d rLH u˄ P8h k wv[M}?J|>T/!0ͱY)}@.fؾz'&HiA!D;Ll9zATuN_Up:tQ3cF2Wa`xzwbi9T;/^[ waJEilsam,;[ֻ|n8˞6B i9VPYt׊XxwcIi(-v 0Sk(EAI&t'rNQ(ZuTvptd*>7%Hq)^AmkƯ~<3{  aW^1ZƀTu(]O!*Wi.$D^}Me3RV0Ӿ@(l&'G8^^`ܙ<:2tӯ'^\7/g--Jn5h B9E=wҊoz]($k*Nc'n0<#CjӃ*\-`hZe$nlfF-) Bm-rsWϵ1s}#Kb[6gt@/@Э,BnNE꜂Az#2X4 o;6vqڙH+cN~/& !O[yH-jmw{]lƅ&[]KL,R! N G qA)8N3m*4<'R?*1e1K +kp(IES(HSejы1d=v|7s&P;CCwzt v{ͨ'ӑљ 1BQM^ 'M'ww l*kGLۿU&}*QOW}M lsL 13X,D/'`=޴5W_=BM=1CmR+D->Wm83)bxW`6$BGֿ)k, g[U#A8Wsx[qC<<ةq^fb"' r6\1e;䆖,bw!>Bx؍Ys @FȊ{8s+{Yb?5m|%Pe4bľ(/gm,]Xnn-UDR3;QXL)KFo_asDj4hsuߓΕ]Ѝcy[ղWi\#yWq/z7s]eǡ8,MUE39lf8{eV A@F!l|iUsO}iPaDkZP`Kg9yΡuBmYw~ř hRF mԯzX[J3X{jBz:u1fUƝV+Dߨ8M/"-[8@.ph QT ,M3gk 4xYPUOݧ VB\QhFiC#N*]!GfLĥZũb4 ߚ: lR&DA9t^#7͈ iznQ=@B_#b> ,;2R޸A8$1 ~>kPÓ%XV/QwޤqtRP:n}8U ch494e'J;9M 5oe}jAcVwQiug4W\IM<:@ЕDP(:. w' g=k?@Ůby#(+Wx:Iܩm^4*]ΡQ 1*䡍) ~!2-YDB|v"Ƒ}jՍ[aa-Y@Bu+m1_C ao1\ Ts¡@C1+Ty۝Tq0:Dsq0 S,)TaKOO;x$I;qő;SNm&z7Jr:#o4ek@gbh11R3?.r"*"M$~YaY;)]W>xO+׮)OQ.&z'(#Gi~խ9&6]؏aJ3祐/:ȍu&b6z2r2C>k9bOs~'1u##הH`)D~&EF¶ۅsf@cͳM+נx+5lɧ)@qu=K: XosZicX#KƟ~o.,++JDHPJXEGy#+eO_ЪӼ !~fб`~Qh% [/yH%˝GN vMP6'"kY w+:*M)˫L-&tˌ W)D)G8OBϺ{i< 'җ3z_fDdP$*a:x&WK;jfA/ү\ܪ])eX6lNJigԬ?Iv,L_^D;-ÐA68N fF_yHٹ:\xoާguO߯غkq0GO7;V"ylgy\O͹-٨;H.v{}M wۦ6N2;3C{tI'ʒ`qЉ_l@|*(-z< Ί/G?ntف+ MjK,z*'G&PS8!g-$bD=9!&QS[ip,N!rϓ}5]v}300 7Z;r^[+M$?F/5\]͑!'(*(A[KR! '$'5K<3'N:X4)w1{" 0U*9 <=?nCBXe8ذQ n䴄XlO:ABx<`ge_O3%Ĕ>L7QY}cY”oB)׼SI̟,avhw S8֭oݡ#vaB>CG@"ޭOh.`WjL;^74S-|mwǗ4(Jlk1b*2wGJvIly+EMGj!N1g*|&~ Z. SZ\yFv3ӍtpCێoDagL)._jOݮuyJBTiTK+z|$f\DV*O m WCZWѭ(<ɵUָϬ~gB[zoBZl9W䶯˺Y3r 29N.Ƒ-G+(A59L#^gYIBDBRBQv云]xcH@\ē>˒ӄ#&¡CJ^NVTqzW"9JݧvfZiǦqV"k''m|N5QPK[1G2*n(~&:(4 X< ޣlIҺr WתՑ;S|,yo~C`Edz9% QͶ8$)pYGi@Ѭ/ߒ;ݦx.9‹fj7<Bu8rCAfZ2p4$XڶY1?N]:Hp&םjGGiq,}I6ZznrIWC/QQg&]1==tvGV/\"F"[*se6|:Уkys~%PLd"m@ĝh*Z5OAʘ:.33KfN4VKC? 39m3!nBΧ+ YJ[Q6?ߓ\Sciͥ`ywT)c;&Af"2Mޅӳ[м3Ntw#Y.eUEUDs f*kƇ}}f"S(vQQDzTbG(VDv;IP⽕OƆKm:e GHsw.KþQkY2tX_ #2RۊC{:>c@#/W3b7`?9~:kRːdaW)`R9w9ܔV̮.Y{8֐Hɨ?`(n2\p͓g fp,%iemE+LpG2j[:Oka_bYJ%_U\UrJ܎B!fp>.b_Ġc_mSkXb w0TwefhLYӚv%&ފ2(MFt.h3WB<O>w(V,ZI l߰GC]4 8ڭNz!fF nB *<5'A~*<%e(\XW:ۑjZ{JH63'2nΙInSQyYj'ʂINï5qtyv3'Rgg%3'+19CG ٷj9"JOaeەFh [ĶoBqFTR`zRBړ Q_bͬHMg 3Vp@LmC-DIKM= f 6shրFt5 MSKs]Qb;o~27#?e > Wߚ$g}C+)ٞ}rT\V(S)_ _'WHr*Ze,ɼzĆx oq̢1k#Pd՚E7w {[ЇTD+48WLJ^y_kZp٤*yr" 5&]"-C79gDB Zte=}ըٳV|QcT'I_gM*m\K|gWvgğ! {9oO]eFtxGYd_%p^ST.9ъ#b bs(*ȞR.ԜEIHpȩqDdT'>H&U`}=V[h+ՙ% y>9^N* ?YVH 5C@X &[9'CCW-{ 6B m%2dd)mtV P:29Z::i6Vn9fՕlj1j*njzqsp N6-.V" :DU8|i͒Gۢ-t0hz]P!C ܫ|N \m :*qO83$ZSH SO 5[RXbfN1{yaX50Yi7͜qDVӋ?*)}&ϧIDPGKSɪK&{TB֮:R'Tjݷd=X v19B!>5[$COY+ lL: vWS@;a[k|b9=dY+=LwgodU1fla[(`"Sj,NsċS' y| *\VzMY~8Y3.+v}bٟ5PwSJvsep:?nMqʉ=F q{y0S>?Q/<:na՞LxX+:vk \!nֽpM:O"? +ɠr*7fU,T]lo}\j[yZJay_N]0R|?:@}tM} 9[}ut4ޛu2jϚLwb_)j2k?Fa;Ȭ͝:$XMgݍ +vȌ[zɧ8\RW~޲J W\$tz-qFFZB)~?|)I{Su%vyО⟛xw%JIb&Oew)6;i*|,V#҃hvH O'LzYJqdmYq`IhM֭+xv1ʱ88#[y֣)}.3RIIePMt4dÝ4tȋQ5=midMkA Ok C[A1+;dFL^ ]Y%)gFfݥVY;5LYG!y,E}*q/UXRJsO2v[?_&BیŘT{i&fKg|E=2E":+zԻ8\zE fZpzzu78Ѱ pBtNp8G V>D ȁ6liدC!){ XEL#:<D{;JxɆ2<3%E?~Ίcz-2>LBg㚧y*>܉N56T2n]*TnG٤."▹llPܩ"-Ďf ZS3b5!΀ ɭ\6C)ע<݊.\j>ڊk=V+>AF=`ˤJ;K2fz˨#j܏uQ58.u^ْeYdOhBHοʶv$f[Sc[ = UkɮԹ4lN ne<4{)oBNIG9Szs#L WvO,jG͖ 2m:S0b! j ͘CNGoc{z=Bqd+>wטЌܤ1nQ(xN-003!p9*XWo$qس/=H~˿M=ޮܴ[`tW$8YY04\WI:qIbKCp_=ŠWz%+ +qDx‘~@Rk|xi&;cΝM.T,umH.E Ȅ06hꁴz">,h@X:El4qǾ/ gA~ YPیzBjq /3|Kxc~3']|UI8:9}6 cpkaPOI^Ĕ*]8gYw/Kny+/9Se2O44áO'֧GmXţ]}j3pˆ $ G>rD25j,شrrYh@SJ(EߜK Y=GT=Ӷ3ߊKB ^Vo}*cY3اyNhtˮ83BhI2u d̪`TWG8J=̶sWė(& KSH 8R1q%̚@ϪL#|XL_fPq_"7R6a[Cm,>sK2 eѐ }K8e]'*^Ks$XU KHÂ^sIuS mH^kٚ[{o+zȰNBJEϩKpA%-g.NVˆNDشޔR痃7jsEn+P*+[sP:I&b Q8Jw5z+KkUcG>uoJLIPqO9IQs}) %$VXߧ9z#D|ֹ_F-FY|uK]2餄 L|u;MDxgY fXvZ|.ҒɦkJsb1MB)]o) #BnDR ʼg' luNJCF tIc‚GˣN% ?H$SAgvC/IauHp/anz g<昔O7K2^\Ԙ>l;%=9% Fyl%&ܬ(C[hEcb|Ȁ bw030ǏoUKHnVb>2FYq>WfW#n6+R{& eJAc9Ivt|2&_A}`ca^C}HT{9Hĭ >cft^$&:;mB ' e$znųċԁT.0 W |7zH.(!I0'GP {=5d*1,eL"eY`NU , q~0פ>Wjv}S+ٜD8ϞY֟}W(=RҙdSƶDs IƜu54J<|nj/Ti~y_ ^(;_vu(ZU6C[k`dB`m@o4SC\/ A)fၷ~7}ŵ !AʡOx#fTr C8fa; .H44(w=p^2uN)[ȱ#ew͢5. Fmx" %qrS#2H]56͑oX O5Q"DCk1īI^ejxHEDYb^7Nk8j #[U\Md2_X]A >bO'_![3*Q'G@rL5O﷮ M;N\6mZI _~a]- 'yUo齒ݑ|bkuzjFDXN%h5Z턲B) sfnxHC-]<庭K/_v+7,}mzbhs@(8yu*h}ec{+4g*;wSl `Z=UN_ `݅\M@ٶa&|Pl6zlf0_/ Yy.Y&Pd,RgY{#!E7~_4P༇ F`]v3pLd1J's^Lbo FnJ? <vܯ. UeU&5( l!4h}XuB,{~򽅽xRx{kR7@?:/ &FOCQ%Z|"BuQ^ 5Y#;oYp>ꐲ_MG|o3^~=u:"j ĦCu] ݀0թBu67]2Glr(D#}y79U_Js7OL][ ֜T-!`iGeY.p]2K nS6S>.GUr]Ykr6ZB`k`3iueO}9b*#"*=uԓIvw%ƽ2 ,x˝ت/L7wc@e\S I­ b%z_}|jg!ڠ+|WNwj8}HH3S7OEBUؤY!rN*jdlEjfn_؂w/qP5VPUH8J)^Y<4*y4yb 98@a+4ңhmD3Q Z!*D]7!mFaPb7Xq^bܒ7MƟlY 76[|8Be6{w6k9ՊIj0N&4mk7cv8=%Ԭg(.M,^rBdHtPu0cWv;JHvKp5/O@]AUq>$KE9 x:M"_?y3->h0H>ߺD3/BRaJYSjd5΋(0ۮPS\d %zf?'NSirn"_)7N ){&=UIs`1;H: ՔYȳܜQťm;]e+btvn[_uT D}}9z?*qQjC(޴dX'$]Z}"lȰj:󇡙&Э瓰k|xVGA{-qْ4QlJ ul)u _kp"a48FۊbOqږiTIL/.eЊ&&jac>Ir쨆5 D'rQ z|;xL UVF (~٩u(F_dYYR}~MaLGIiAW8u?|7TYc2AmA=<g8YGӽ|&퉒e*hJN&h$ڞ$ڏXTju997t!32PZ3H)%'L_1s=Nv–ty7}V_.r:5>{F_GL٣է._56*ρVx(I%"esʂHa#h gؗvka8[.l"Bt!BW6q^ΩZTq6sXQ3s)skplJ”$qa [5n2Έ\5OȷF% 8U4{j]BDQH eTmnvW*xJ,{р+R)h:obvl;J 2tZCudz3դS]ܮL@HEt>o_[H,ۗpc#uoy1y]t'MӉn"p7 p x  )hqs>5ӝ'ҋUQ=4/ [jYTYĤmw瀔ͱeT:jeݝج[ '"׻\Qn+(&"a,gvkxW M.]N^Lwָ_*>5rFbj5A|kffwP]Q j[/4V@uxCH_apO^lS;S*\BYHqYr#^_PƉj*n`G$#`vKt9apW;J$Ώ՚{&5t(;,5Տ$E;/͠^y~氮5oyݏCƃ]m:XAZ%vsPytaMfu3Yg c//qyCʲ c4R:ۼ&?y򗐎6*܏*D}1e'f'h9 + zϻrd5u7(Ϥ mbcn>Hi0yl͐/D krą,murnY@QC+76KE-||?F< ؊M0h`{DOh{vB^bJ2|ve|ըr:. A Ag{+{dpˋ )q/IvDU-eaP90ᚲfNq?1_=P>lllfJ\ ʤy:/Cjc/JŇl-J98->`5̉iX9 >5A\~K!s|aFlj5ht(%%n<;yӖXhQY)䏒|9BUT1S\ZY^ɹRʸ~~SV,hL1)'IbV1bx.r-@nĄWO5ReMm{(~MOUq -♺nu"bS0Hm4F*\ -e+|D&.kmqR`t.;Dkl<ÒW:E3In0u5U$! 1.H{VQQ>rn ^~C/sFO H%yi4\l#)8ΖN'MeW{#PΞda,nl.T]!)56ϬQ3]XJҲͅX=`L],@j2[zꢿYPyD5y4s8)ʈ٪YG x 9_V4p9[ ^($>o'~pC~_옐k`lZy3kHN=QȫԓS9"C1LR' 1/%RWJ'*[XbKopժ%e pZ+:$~}<B҇ ],cX,^z-C/?R!ݝu3S7%n49s+5 Ұs՞1p%.:a {ҥ 6}!!a}%\Mw%s=?:b/P gp].l(O}*K8E ^UDo?7zeg}E ɔ~Ҿj%L>2IJ:%¡oҔHUdI ᕗPJ  Dՠl ubte'Bn#4} LEXWXM-ExKedvg@   *PlPQ*J>DT* 0oYCS]lʻ1!d@Joh xU%dл?0tTkaipĚpƼUS~ݧFbڊHFړ 9)$yW,$fё=G볅?jR w8-rML#*F+M=njvGd!Ou0,hMƸx:`$H\i`o_E?{+:#5f6< gOO.JsH#=(DO{p[*j1 xfg݁VgD&Q4Vſ|X eHG  PQ6=QfQ}!2fB䆒ܱN|MW\S'q>f$ &x~W{@#6"> SJy(L]d^|0Qq]G?M,Vԃ`u9c OdڄR ᡻9 *f+W!\gŭ -_:Rʩ10 tAօeԳ\~F5J̀ CfJT#"a`9L-N#a}8yre/(ݶ^ҡ@gP{?w;&.9LSA[σn.ՃXܮj#7h2jʺgӐ#ԕw$+'Y>C݆1M,.}'阐xh5o^nZzsFs)&smк7G(l&"%$vCL%j"7ڱ@vr4+&ToAUUcyFH&a/6GGq[6@$B}nB|!_wD$H+aͧ14x7ͲfƤCl%d_F7FӧI`$!WWG ^Y18cX#iܲv]¸ͮ8/Gm^؅PvgW&r4H8{J hFP0ڃ u>ՈbpK*-g3ƔKCK|CMqujm02!n1djm"@R יTa@QOh+6N&5R_-AlGi>J]{azI#)#q)>w7ϴX#HL zSE3kvHMtn8 l+S q_"f$26 Kz].ns]kF^^*0qw+hы'+^3`J߅b%Da#dfij8ȝDr s ChQ8ͷx}+[Jc1UtYiһm^RF_R*YEm}t%0&5AQ-[tI>-jBdvc9vOY0|_ƋX mN1KfP/_P$a3i5yB_;! =q22~Ŧ`Vvzh]HTK601:nO!rbci#cqdAmK %ޅa_O2jTҲ^;Nx' tD8kVVѧ?2~ze88pӱ lDK +A9\ڌ= Єx]gJS4b 3hz Yz.DnߠS_ǃdJ P.^`0'AS>ePЅxVġke0BHN!o3 rS%%TxoAd{T夼z]39y_ pNx/v&|4f"ɗKhf)Dxx^=ؠc>IEj[*wDokeO(@nq=!;N(c} {8&!6KS#OUˑ6ZN,2IJ8ܜbu{ZWW%@뎙$8f鴅;^R+ԯ0Febj>Vj0[eT,* f7yÑ5Nn`9SwD̀R5ž"ǦmI#LF*'/ BUGk*j!MS!fr\!>JETƒZ(=hp/½ӤW.lom8ls#iMM(q ZSJO8X Ѽ_ybՃ,ʾy} Ԋ?²ڴb OB.fsG`}!E#awt-`׮#(EBuaD\GPtK l:݈ʊB7js^QI1JE1@o{wxEp鳹f0=Je/,GfHu2^=+yJps|Y x'zbx q4O:P*;9bo q&:gr0tkDe@{660AVAIJ)rE(VMej'~| X).aya xx,aVljۣzdHBM\&*'}ic ?  4z D9_ġ_)SWvuZ$e7ꋏl=;ŁD`d; P^ ʾ hRljUEG_Hnϝ D5 E9%{Lu:j6^f 6r"ކ@zXڋfH1e0%*5QZ%4OOdG АIbl'9Ō[yOIy=-5W3dTE.\\:mNMTƸדYj>%l14uP&r+5`#&s{xZKj@: qAYBNHv?j:ne~*Ϡ @`@bг?iF\0gdt!b:O <~O^Qa(NY tdG<@>C4 E̦SdEXrClwzLox[q-?t'@ޠX(p wrpL "-&ixA*dbTVÎd PRS)[☲Ym04_4c&D/ !)eWOz_h6ר֘RbJKKm]dӒ6Kte͒5aKyㅂR <{kbblveIwuSA'hUE X Ҵ0r3 ?J6g>9窩/,VW\ېQ/Hzs5 OW Ui7a'~ģ)pxZks,Mcku[aJU<>wiq_RO 7珝A n/;ɶ2@0pTKytWdٙ:y hxvFag$$s{&%̌6\'ʯ>i0nKh8FbݮML`^LV 2rY$iKvbɠĸݾ6N[WHZ0\ I't`@N!bsVh=6-Ӻ'ݬQc#|a$Pl(Ed BJ 1+aS@ mᅧ$ U2- mkB6 z^|,EIfD~[7]|)ķ9I(kސaE{v#G&PnnL)(zcobt&d6:c<ŧ}Ѩ5]E k7g۴:GR:P=)u[j+-{C+!͵W垯 =lzHCPd %RR֢VW Fq$ْTU-ک0Pêe o:]i;ߞsh7R|-g%ڸɺ*!n^jw8C8TuT8*Gif/L{J͛-r*W@PPb҃/:Md;aZ:R \7G8"TZ@gͩhXj6 9*$`rbVVCcA @ R98KBbc ֤4`(Cģcы#nHzlz>KsuM |w3‰XRZ3T 3.0݄w3S\ÑX\"V,%gQze%tpF V)>'U7R">.tLeCՖ k-Vg32;сKr' 3Ā%2f{cybF/hZܣc7i1i,;3qןVLI)ѩX6,H2UhtT; gha)wwrӭΉT9P`2ūs)C&k5/^l(,+g*| zlVƮ H~E˥0Vne3u >u(q5^+f- }8tVvf_qmCoOɛ1WsAG4)> (yjc8VXHVKJ̵%Ե-FzF~ąs? lKvE"Z&\0]Sl5`DL'"u@DFX=*nٟ度~%G/ׅ5zKZ.V8SM8!` '-n B[Ltb}.p fcn@ڟS:a75!`^5t `~X|}$`q8р#k_}wdJ8\vڷ`!A5{ÃfzJsҵs7avuS};(ˋ~71jn.~qg;rRKhUxcFU4ʨi.ov2.O+T1v*Ҳׄi=7Wt-$LN}թr3 }H4Y"RޔDp:/S˂v mD%O#+|TpSт3iO?5h3Q`,2k N؝h-}{gtyoJji2J[F V_U$"0N/v`%֛u,d fQ)]͂<t9bS-S݆ 7u)Gj}2Q7)qLw ,e\;E1"o%0J,_MS?t5+DhvKOuX_E>.smjx&S9 MTǫ46e9XNM4" 'LID.%n9%'ho!$ǀլ'ShLMA=nĆHbVoѨ57dvb/Ԟ+j V㶫pP;;xs~wN/ 5E7N+^\OҖG1;- W! WC"=O<2' 7tİ{Ē ઽIeƆ/{=J4 ڞlrv,bn3ϲ"=sbDqI>!NA+qKpŇ1H3u]eiڙ-P~3mD[_,#x-X}&g^uWC|s6[@'x=E3+qJV'/^(eYGgaoAY)|AUPcKL S2D}wcup,uS*-t˅p:x"G2hH86])՚t޷31>Khx'?  5֒$4lotS~ F9Iµnn{NxAyqgtDwLKƒ!yC,BwO؃!hʱ wéj]N,i7QlZ$.=,p?@:8G#l\V2Y*ݶɔʹQxd;J59+.7,U☪ۺͤn6q޷³'n}58NNneYm]dc7Qb^ĉk]\U kC۝ݪ5s$'h4uk(Sya%[hrtk ztOIXQ ?q=Z|&7^n}8X/[`73[0޿Mݎݙi}Yk%|,B*12K؁PYkw׉~*PPaW-[9_ Cz 3Kh|JCht0fҰ*kc5*+FlYbu>HTkOhզtgz3b*љ%ZJFʁ?K7rjĎ?QQ@`DKf MoP)0,( xgbjеhiSuV zt y6 =@J_2"-^[ZO!13 J[Rj0"<#?7seag+9Ӓl\KIɀ'0$6(~$t3\FdJ= f3ߌ;5JFtK`.*#)u4lm9`$P:Ѓl&oh^;y[ (9^)T,]$D.~+0ٝ?4hQI'rLծhoYax0H/"p7VuP63FirN֣b(O(=F;QWzo's}ճ|uhd|ס DO[]M$/|T\Wu%) M @l?̗^Z2ț.wt~VEz 4 ]-'4W)݄:!B-Rը'J׌Svowi}{Qkܽe&ZEqoim9sDN'`HuX|Kv6m<e6*ͱN#Q'fV>a aƍ'g9=d@ ~EAl(f>C3vǞ6@RLO\9"iUX:i_Vh#8|@b^pd[;Y_OB Ƅ-ul:ѵ!90y\k!t%[G'z`YFJcLie ]$&[_ 9'ãbztBi^B5[f5r|fVe-Ѩ*E mW׷̗###+w/#.A++3aJn)8kE]_Ox֕eO@^: rÓ+zj}1uW c-.L-0}." BKz\ LÁ"dt s5?`.Wag%@fkK.:鸕NS{R:&RPt'KB'sfݤ ~J$nTKB£x; S\Oюmx!P9 ҉cwʆь\q5O#`r 1tn5c-KlHsȪrrcRMƻ"?`D࣋ѳT'OȢERep\Xok$>&MBn/\-U\+PI 'K*'O by#)KʜH?C(Y{يͯlK+ŻLIKŃj -g)l j8e#w;M6`?d$]U@a Q VM$v@w,BJ%d2˧W(iE(mhQd'TEw"/ԚY~PPky]@'y}ѰTջ8&  &d(nkkbիo(NUk <-ҧ =}%&{[fZ{<}tb f `JA#"%kn7*fhdH3ҩ@4h޴ De=̱HmPdwO LgОVD+-!]EA/fu5[qK&צG{jKřt-S/k 7ZƜuꅁk1;@,ROLY?ZAb=zEސa{Y3!L7Xn?zsY4;CTѧД&f pKܮx_WWnPd$KhtbW!:GJأ ,:6KwQ] 2"P.jxY#wC/'%qG?L"72BuC@ؚ`MA"y pgczp/Js1pB41gq]z yNvME K?y+aYxB4}NBDz&՚xWԔˡbdrJaݬq"黊@~q2%)zl//l3!FF} 3Rj>H:f^i[KN(0)̆< Yt1I[A:cМz5nF| @D XC-" Uh𱉞21i2>Jfu50QN4șG7B.կƁq87uz)P^E$TY)*0ha6SIy <|HZ)xKтҬIYI wRT}"jLڅ#BHbJ6Au5@VC&pVٔ5"Ɏ|P;|Uq@SɡVwsMcM\/fqIN;7SԀ>LiZMnKWݢyC9~Th#vɷaG|djPzI53K5;] n>2b r>iMC-j( D__ȏb$zTF͜|q䨩gBπZ: 1} CMSƞCcw8?o31yE42flu $%.JU~8̣G>E]*D x{8aKQ&xQ$!s8vW]Sf8%*ʺY%h|,w异Js7ZiUG+U;8Ҳ[+.wauz,)wײ+k剅X$7I9lgSɭY55tAK%%#ի@h5Zܷ),۳9f6h-gd{-꟯JqX^m_;P$^Æ,GQ4#'ȒNK办s}"ph`S=+lVJWPx`8lN/-g=ڋt2 ;ˠ_DW%)~aNT7xU4oO1#c/N+Nh C$hW܌Ysy,<.p Fu1w^H H*9/|@p F|Lr`E)a^S\hFsoIi_urcG9}?\YslIۃQQuB0B"da>ѭѣmd9X?u\nK(V¶7wAr? j1GVGĽekНû3qi.Fܰ׎ 釧2X5A})9Ϊ.J.*xVw{x!v^TSPʜ~$q{XrJZN #=D֭j^8 5և[qc?zU`U  n  =d2Ȉ7,0LθO!8~VM7y<:\6f)r<1GZ\&׊+u+]ϑP5yq'/VM)ՃJ,pR |ql69FSbcl0B?b&pi|/=r-e߾Y8hLêhȇFȞ j[]ԣ'Ŷh9 2wus8{dF6ڹD{vP;Da}@qanDM\L9s)YqِِPݑPKڌ Pȟ C j2gL9h>d)kٷ碞A=dUS;YöP`ٹւ m>ԽBQHAwϗ5xlIGXZ'YYeena@an \W?~Uǥ>xy~[56{kqTШ ºae;!qO@b>N.GOp~%H.dY.nYmA3sfТvA"%19g_ (Ea;FϜBݵIe bBy$+l)d X3NwCDSߢF@o P#Oׂذ ~7itgm2{z2BW = |c,Uw%nS"ΞPIv(H U$+iD,3 cn'/ Ӂhγ>cFJa9wAoNSwQݵnѠ;0D?%UI As%3jmHJJw8O jm 8.PJ2}ߓו-> '^5TbU-IaJ:TOIY}?_Wst_RPUqy*f ٶG)ȴ+ddu^>n*o,.̹[T94߾U46.worWTFjl54z։ztGߝn. _yB>wZ,A~wXTx?w_bn[D:Ky7@%N|~Ⰰ%V\h Mzzr*nU8\/5o鏌Lob\NIt4l2S1u:(Tvj\2)_z@T9 R@h/` O0ۈTˢ2(1( Ip}4kw,Gy8*Zf=1#payT<9Gֻ-G=r5Ae6{G;{,Z LytqH́އ_9ihz`|޸g"cKɼey<ꔪѢCYA^FwfuGg;=c6^bZ)5H`Df}jƍ*ÍzͿ "/ʏ|A)U^;L C`Cuw:qFPKH*#r@4 ΀p۟'\O4=I3 "m:3dnA{*qa.`w`~k3Q2HSPi@KR&T:ٮrI+d A33(zIvUV&Zz`Z4Im]_\w73G?*;e%=IMz 8>2o_k&54KӐ!+BV2JD*r<=?HO XKoicW=O|`>g JdSbܙY2 rp'!z=L$hNxnnFʦ?f6 =!0<Z+D(040gAMItq2@d!$JyAXz~,$!ksW&͋]3 `";7)bE(\,/⡧K6MOGs: VoBFԸ|ف IJFǣDk%:\ :otj=eڸkvKÞ6%ea_/?B#3NES 6E@%w.c8-9"+m+3~}O'd5c" >cS0@;T;-ljz 21i{<'.`8:, wQ~G35/N&7䋾<6zD7.`tĞ$n-"Xg\.P,ɘr%ZOa`} qT+k,:=u'Ӄ,C:v܏o("5ꍹ2Pdu(0)">^e(Pl"=ĺ〕L8"Ws(Vև O]DKnShC\l(b}A'[*IKufIgUV؅H:pG &£ c鶶rB]E]0n-hiGl͘Pyaaȭ7fa_z1ثj35jmZv̢դzجKfA0"P' HDFDe@]JVM̔p"#5ƐGsːNA+X):I4vHynv'vUg9_%WcokXXmt܂#yz#(r~JꇺNO-5Fh!J1娦N=_֝2޷s n>^lEޔ-Yw?FR<(7q<:vOFG ( ]o^? 2uޑ=Jznth'|&q4\X NdoVajѭf?ƉC$x&"}?4#d$D:[D={o[NZW f^6)rSS80C-&R,RRz:΍J;[.{)sQMlUD;*X )݁jJDh_44i|[M jj֎ڢ$*Q=̠4ge]ֳt3 =ԁ[ TXꡍ9DKu$bt9p#ʊT0p?M*8k֥iPrΤo.uIj)o1$%A5Q0Sb !(e'< Sr5mR85fFdG`]vEPHYԠ`swT}{ܘ +Tj{s3n7tpaLB&`#$u} Sz4DL %8tZn$6+^Yb&#~nHp~Jnkd_%__DpWI\ \G$d01>_ GJ'rJ00`n[:c8.%@@qt!M!U$r:DS >]z2I`vz6>cI/R# K*PN4$…1TcʉRoBguw؂}!ZcU Uۓ^|} mMP}D-?.w^. 'T `ӌ6ڻE+QF3ISG+-DzW9&eDzqbwU|ZlyNVuE _y"z]jv l@Bs?ܸ+ĪeՄ})Jщ!JIFKe^-HUpo>XUgvoN|9 /]BŠ&KM٭\rw:Clߚ):kWC7L #AN (oރgxEdZ?阐i,(fZ|ӣmcUP3Ρ p-SR۸E ]O\*S6 $}ܱ#lD#KNV|RY M zOQoZ#NUa縏y_ LCHgP|YS/{}]^ގ*IOV.^1+;q?Nj]QWFx/-c8:p8? &w)>B:3z(#H/Y/ل7Ƕ'Va=W8>y*zss)ttLp4?NPԒq8@Y/{u:R$ EԆ]5LBiyu#a[m 0)ެ)My1)}er<5gj6 Y: x`W9T/kgPj.bXш5 # 5l70R7Z4 F]vĕtз@[:D r2H:UQxX --7\=6,I_PxR`ګply+57_jL B,EJ].&Ȱsoʸ6tcQ)KLE9, 4o{ݟNV%;ĔC&qd_+dW@QfJW'ݨQa*8>dWTTWC eQ$.o% [`r9:& XfْPX3m#c>j`#ƅb0K-'[^) Xby%h@LdhqWa7]M5%[LŔ 4AWa+ZWr6Wu;gNcI`G¨/@pY xQYG횃 Weҭd;|))/nBنp -P8G&3L@#ha瘶Pѻ4AhAB]œW!>} #03m n)}Ou)|mS,}U5mkT\#b!nwQ(h 0`,o? F(· U?Gh[HF]J}ϧw'4.^j_ o ; ɯx8p?nS謯fXd?l7 ]׻yޚ]o Qjqkщ:Jx{j&eid3D+MER zt܅{%l!O M̛X nQT*7u\\ƽv͉pw6~jZ:25J7b?U6p-~BKp,>b☪`"! Nrl+o6s 9Z̳X$6Z )9o⸧YRbo 0Н_8s+Qif&qէ@6[ͣx4iԟ߁W*CO:钇(zXKZ}b :Y mBRl$kbI:ojsPuCJP\t/XYi m_]D6.Wjbk!mg Aĺa9BzfUx@wn/ Szc#ifraV6F~{{0=(;+U}U^0@ ~GVvp*?xp>1VN>@kYym>Ѓ@աg? 5zo T׃wej-QC_|0tz=xN1=3/qI})>y 5jV|i5۠_#~o,(ϐش\„FyFѴEz%1 WLxP n-NiPz(]~?[=cj@ƤMofP{ӵvg){T޾^Ggf^mȱ%,1U /*(>QE|[jDŽ2j^_.b F788׼{ opތEDT٢\P:kcT 3Zz1?YݝV6Bi=u8/[BQN_U>,nQ\[kZ٣. ;Cjaqq;nВv T7>N5'K:|ٍkbY}}5ge>nzÔtvxW!JzjpNu@ǖ16.}ؙtj&諾 gE 1<*^PpNfieYAjP@ny?1{ȷF34pU$ۺӓ{#vos&'Nj B(e.d"򬇃B8Dïq'k'ȩQdnsXsw8;}n.KK.xdIk"êkjkݝthza 9zoPz=Q;#k`x]kG;T=2Kǫ0 J:&Bbσbc q4xКeV~J~79' @(>lj5==cАsn]ZU8Ԏ͢g!KnzdS[С^^Tz3.M@}zlpKi,qB$B@!'8|T/]diu6F$He Ѧ^ ,rFx)u|}Q&5vxގ :&1RW]:;-) XiMZIgqx#8i&3k\VMEOӹI3Th Ǻ)P]3qn#-Es?}9<}Z ~JvYq~'xPD= X28`>Q,9G l{IPe5&} C滵AtDLvFޞ4*Q Cl/muStkg  6 b>7[eh׳$Œf-}~"ew*Mlf]/[:Zf:uB]ՅDcr13ȼ'6-=F(F,.3|3K9 f' zE6m BI,;nzi7:z8~42IU-l wۇ3f7vN%hW[ 鄼.. ^`"-#38vǵdzǵ׏pTٕlڎre-gbh+Wd :9gP*t,3 KkǗq?pha-sNKU/J$lX&hp8c0#irB_GZ=^Gaٹ͇1Xs,5 IIj8pAp6A.Rɱ$Nk=HKǘ30Yxcw|A*5f@"Sɔ(2"X-_&O@}(٦!9|mCl޴/yjb{%Acl RbyLwQ:ݟK+Rǧ{bdm̦-F:?c>ڔ57'N4;)x3oT3욷U=&J@OPШϜ=PtO0;ׯ#tOrAWQj(VpڗuͅO1G4,S8 Zl5=.c`̙Z`5M})܈U=If}`0D!Ѡyr@H"VhLe+(3["l9x8Ood0SLh,yd? ͡هc]&0fQB'n~Uh!$ {V@K$-Kw_-S=VK1BJz2[){fv߹BG=t)F?iGMw)cXY&0U[EkC]_cyߣOi_Մ:w Rs?mcRv oY|0lc7z%#IʹuԨxJ% ocd mWlypL[0Iz.2{U0~^v[֝Q-v(kJh<Ʉ9]@B;^V}(,DF2EC zF-'[MbG1y9^qVc9caXLnu MT3; 50R?;ց2|'vuӞ!4YeaIE ͊*F]*fCt?Nax88&=5@hAaXI3Z 9*\'u=?|'rV Kb_<|[jMHmU.8eSp`Wy3>|n *X}M]M!f2~Wl.PehC|m@YV }Te8o[v%qrqHb|RJry!F/QȆE+P Q,E7cP(sϲFbtTMقh r1옸!KXԌF'}t,tgv 4.K6 .:y¤]f@)S6ڇd%WL?3(Oh.(1@N*+vڍ6aBCl3( MmM8_ŷZJFgW^ uV"?ف s#$󸓞GbMXU7ƽvT?*m֫"j^*@5b>5gHbb֤Yyqw`٨ >oO;gχAEz:刃F]!v QFuh ۽EփL2>2QK|w)^,ݼU. 3mk9J oc<:{h;/ӉjبFB,[-+oKm.)U2v oFwfo˩A:ӇZ#9Na.?{ut% ~m}٥T%c'`j cc4?24IΒR*OJ#U`%Odm&1Zgl٨m D<]Ω角S!_E^i `[ӔS& a @`)dzeJ;b4Q#CzcςN/I,hMIpG߱& ANZ*Qr::ԯ}w7Ʒ`\rCE]-4i~ EDއ1qX[*޷WX!': `w<0@z[!4 oyV_jrj=A ao +t-:a.ZnGډ-{؎-ۃ" cظg˨^2q52#f=Uq}3hm>^SOCz(ZG: yy퐻e3[ 7?VI|{Kǁ^?xIB+P*8rN*< -E񁄳dA!Tшz|:uܪd[N?mؽ䕝`UPC9n)o<^ݤP 9^ݙcElDFxW7u#;~Zc 9[dmVNRFDەF黙BNZ]RCo gv%G \_Ku7ZX7RtM3{o؍V/B\i䀏M.EH XNjQJ[5Y!/~ch>߆Cި)4Ak[-GV;gWa6{WR+ӄtv̒Qjˬ[xmaO1u!aZӒ}e.x[@1mo AGofShB"l\=k%c ikj(v F>&wo6!Q i q^Ym"YC,l \+@yEqWBJ],z6N<;@.;[L&BFn9Vq:Fݪ*?{zWnjGM/cNk\Eӹco u>o2Ԙ\&`vq7yo=YKt vI҆MN[ʠLѤLB6ߛj!%+вECSr2u[kEvJ g ZqJ3lF>#(e;(PȃG}zD4SܚOCZZa(# IWNjUTpݘ*{?u2u%. ρ3[C7Gs;@WѮ݊]kZ`òBQDYD!{w^Lr%GG3 + ~$f264?oBK'&kLQ*qn2 ӫӧߎaGR?Yg%49y5Q}RaQ8o4vE<4Ju1oE|Y*I$a_D$RۛBEeu2!K\p?}=eۉc.MgݫѼ>\w~~SOU8F  mm#]?,beٻN˼DZ5bzKNe|,D﫶[NA9d̗]Q*K ylӑL=*> GKMP=5lMDieFNt8dX&XGhndzfY2@~;q $3#Tef͌ɑU":6-?>Vov99n<.ӬVYTSdһ{,V?WzuJ?2>?eqK҉FNMB_5rN-|2zjԢF}xxRSaJASf80EG)Ve/9X B| ۉ*jxr;f/]xlR:,/f,Iq Nxhg&9 nW=|]Fgd+KLFUL<9 x ם:>$x!]XOf/F% '`VP >/\Ijpm'z0 7 x?~I|F[Y8ۉ CVSْ0Px>MtΊPS≋$)3 W ] ˉc}sŹ,vl|^[u;}FmeuRї^u{vd_Gp7yǣ!' :WT]W<&:@!7TR{Z9Z2a8n%Dv Q{" ­s ̴>h/᪖G;C! 1ƕ,\J>Z:jiPTg,.wŢrd%ܛܭɦM^$ԂO~{Kh{rb9@߉Qt I yI@+9Zh^ } [nQ==T}2- ; X4XZحqDٮ~#H>30m1VXh)ZaZCl rNٻ hl>])Sf8^xSf9Co>dS\!SOEwZO$4 nD)-PrYoY <p/X~e l2zDloھ 7Az?uX58dza*:eam`,PwcJo1sA9yA%6/TZFV q5U9<ԠC+^GӢ Mq<-8o`f6,LED1?n_hdf9GGbwOSp6 1׈`|+B"BQhI C1‹& FY!nEeAE|d ZprvS??D+4kqķ]ߧ<'ɜ`WtYݤt=ВZ}B#(/- )'nCU  ^8=B}B_ ,,SȤ8\0HM0;^ 飰PXǂ339,Tam\Oщܣ*>!2wюS_s!$G#4Ʃ2A?|UB FlݯD@#:i!;;w3ǖ.P!Opoe&LZ)j}ylS I{>;C?CoSc=7,O'f\|J!^]q:Pۦ-@$"x/ߘ@bGK&I4U8L܅v !Tuv#'O'X tjo H)(_M Z.DXI%sS;JC!*H$#׌x(T^x9{$8Ǵ=7!8 H`!Q'k qUnϻ-qT$W7wRom> 5 Ucn`Jl+w^ ; >RSU_e4G0r|aZ`-؈taq*Ϸ%Ÿ5+ocZ%A9{l*ՉIN%\k^԰[ "o/#-V,O`\ zh߽+M&}i}K 8-MFBuQ:paXJt}eX8Rᒣ9G؋Q8äDb}%xZst FCDiCX$D$rX4r$@x!!JbAXx`f&"0\JrmUbǚh੦=ܑAgϸc ԾtAضa]0z鉚&ǖ8JD?A[z^ьq-#QX c ՏJ`.IbPg(-Z0ԉ0b/pA$#'c0>',HX!ZR(ޟyS\o9ah .#yP"7`)?1ZBfw(ѣ J> erb0]вJJp!w$EDH7K" f`F5-"4UJ*즮#ɲGe3VPi=!0Ef7AḮUt=uHi-(7[L51 RҵZvmهiyX\(]7H79퐶Ll#%T f%e Wʬq-@˰höBUI$J7mg촚O  >2hbFa2GY-gIkRB3bYSQDѾmZx|40&S.{Gv#*Um\ )V41!ңCB(OЊrh̸B%^kx([yz7MߔMpuܿY7)i('v qTR3d*ћKSPf=.x7@>cOxNKR³-S'=H#űt "ey k}"TŀrX=t[@(rywϼ f`ĠLg͒Wf_cFp.d*eח>K/YI/ba?QhBExqK%;H質ΣiX@Si]i $gU]@GI# 4#+bN\9eڴpJ f86kdF?nJIOis#,>?8)]4'@}~ Efxo-hܷhm{VaZIw.5b !x %hX( w)7"4WWz{ iFX'R( n|5 1[@jI|*>=_y='f@)Drzp|L3\C΂ą;j^x@M*R1'K|a9VF\ꢟ&uHƻT 8۪IL,˄Wʊ!xUⱖ:J$-~#qEaݔ$F&?ĶaOO"EJ8o%OudGt}N ͺSN nl%(LH۶M_\` tR{\>5,ݸՎٛ`!cؙH禙+Fa2iYC&:J3Q e'ከ/X4­i 4?^sn9Y-J@mz3YQdn5Y]4Qю#6Vvq0șqKhf=1tX= #sy棶|[ba>A7ƛRu&08fZKN (= *UQZ1Pg9@rY& C=櫃-qKd eҳhe=MEAJ[sN~ Ÿ9=gHy5hPoh3搢'tCTCjZ1|ufL v;VZ.{!jNc69ri&J OI0)pu60VH)b3zzЏ#e^ Z1 rԱ#\\|W̋^@wfUHNMW AH{p Dw-W (keg/xI'I]T8k>؍+"ۡLտCu K+D7s~tS\|\E_s(W*n< V➚xHo|Ǐ'_yyx'υ,EWm >/0Jvs0̅UMtb죁:7%~~Fo$4C@2Mm1զOFIΨ=E[%n7L>jG,i'>[\H=[ba[ C&.p8 |-8mpDIS km ~^DgFgjpװAK{vGo֔60<,n#x?VȔ .fFk4k`{u͂ɑhTu/r3%pS;ohEX?&@|,m"pfz.#bVΜsg߰F-͹4e-8 WLz;2:%=iԊfNɑ}t-3v n= dgy`wΦLFKsaXdCROکZdʢSeF=;6Jz)k;W0DH8cyӂ 2VKR";KtE \H'NSb͚ 2;M"t'VU)mWzQwMԀɦg8q`CvsU?#>N _X$5^?Ntev9)=$ֽ4z_5};>Qi8L[3j8/aK),<:EI [yѲ4:Ʌm6M$=A¡=Fئ: mEO3W[qu'-Y1<zZk =M]M@HGphHS847hW_+Gy]:VPU ڴH`1S0Z6^ԣ&${,* n rw`m 1s铆BM2|<^ъ&ù8:רXÎm/XD`W*eǹȚ;c |cjn((pc-_eZdq>an?X75\g0FQ,0[KG\M>D ]8wM:\aލ=S*ZmTuttPX&o&üEk̊nޢ+u ,@mh@4Wۇ.nsv˳Q*.hLhںeL~SNR!'up=~B4N8a"?vvv=rޏptetPB"p 93A$"ul80B lpbP;яoG,ԌJH<#}y6y3±G@aS?8q)O:C᠐=ڃR~`  ZG[>hdCt| FGKdJ:lB&fu[q`_iewk@Y̐,Ɇћ|ogZހɚtVB)Y'j F#d}8U(aoKQ~I0T~ Zi1&=5ϑX⁔gee.J7!d<Xuk2HTR6SXHp "ad^\r-m :Uܱ6Oi^D @RT65 }8aM_JSܗ jb->!2YT0 4,`I 1z7(8{Z53=UiIjNVx P+r!MQ OMOC`=i۞(C(z ~ICC0hV ϴ;(LOJ:#]p'=mQ`9`I(GWTVRV6jԵ?5<Ȕis9e[ ]3CŵagJUXIĴwz]{pRȰI,@DU+&=_'J \2KӡݻG-ek^FRE8+}o^yޏj9Hbiid'd`/O.]u!WX$$+0_"Ău NtWﯧ> F5Mj2jDb39OX*BΌe:"lohJ,4IZ׿&~-Jg^)t{*XJ8Oy2<FJ3SR,/RtW*!>j%j(k@aG{uٳ+h`ZuI[  <}gpw cpd %58]ћs'ӃQZPFE "$걐#g9)[Fc&IcށKַf .!;B-3y #^%[1[$GpxJaIƁI*53m4Ya<”k^{U(K(otFqWA >q^%J8g岡JX3)'\y BSHQ(jtֱJ%VƣS\ Bv8'B|TdWRQ IJOI29oSj.i j R y NC'XW͉NeX^PH BMo5{h$ֺ׏]¬oUyw?n#I%.]jMOD&ɚL!]Pti溭z㬽ěGeJXkczg+1ʮr8f+ =R\l}ZM ?hB7y +D{p=a5)y V]p.@4 t R/ʽR'Te^?TlP$g^ i*M+79"tj-$@Ż%eh5׸ ઴QyѩO`EL)}*_L%t )Rj:tE_AҊNztiIbk=ˊc%Q*IzYl]BCA-1 ?$[_:iPrTٗ"t"DGvx5b'c=E GIZW8xa$WRbR "nzH EKF1k ՓQ^fQk$Ȗ% %Q^Sf^}x"# ݒbՠg֬խMqi>2NE Mr"9L.D1 JAzK?J5uѴCt f{ARҏP#BQqϝ'. ,~WA'`/eNeQmz'D{Eډtq,X'dV-]lW0DH ΄3SiiTt OC-PDu5"ЅVБe"zIw؊i-)DΛ0m1U<ɶcbB7)t&x0HSSQv5֗Rd>eۇbJpcI bk|_yib7IA/I.kb Io.(0]l+w- szȝkJ+q2npm}qB2ؔhޡ>5hޥuσBaNfI9]WfUŲaEtfC&E =lxNRi|9Lz;3G?$gwz%<敘0,ڻ t۰.Zz6/c~JYJ#z(Va!ysB`qÃ:?p='6K@2 /50inF%h/>D|Gަ W;yM=I]Q#c.Qer(1 \ddJ F* '+<ꆥ$nib8`˔u#)CYT,ow29 U cG!v7o)XjDt5fQܼ몹WcFz"?4+Tr12OwY )bGMrZt[ZDHInlJr! РE * iJ2 [m;a3پ̙f{:LJ6|ab%Tl+0 2 ٛU +Ѽ<# [r)Q@GmW y QcGWml '݆|*qDVifִa(JR T_)sal+53/b<6R!+HD( ESWW!zɫmEirҼ$ed W jђZ%N5,&iY[juU؅8*k4qE޴S5G@rvR].][t)3Uⰹ -*D/Sj ,v@A*&$OJb˔pŻ!D$CA+_rF)߀Q!0N*1KWfk]ˆřWZ!ș#u@PGw%W`ED{~WU-PZA°P5[* A3L]zĄ|h?c*׻ݜo՘bRFpnMD:j, ^r!Z@LקY"kŀG0IMMQ $xޔ(l(dfl\ x8)P/KGbX娞6i6hBb%ʞ^C&(_aJֹZ`'0a"**4zU޲ӂy"JS 9 f!hfu/I0WVt&(g Ty}>-(->%k)(Lҋ# fwJXbuQ=*k1*BwqPGh[>h"`ShO`6EZ/4Y| " /"Vh\o=@B%G8!B5s2+#G$3qCw W[LcךjӖc=r̕ nfȒLoΰW6rS :Zk[߀$AR9UeP;V_t14;ut.=[A'2mlY,8!IӖ;i!`'xqM2֊'lX}YޠjaN)m?Hؘ֫!k8ݠhq^Dڌͪ0͹=2cΉ^hrg9uj3-F/=JYkte ; 0uaɄ7HҼjuASOk,SaeLXԆ-ӂ , .6_k9l$x9F}B:̅|2H{sOAB!+B ~ IٙJjAYB.75i4Dj28Cck#=ԉO@ttčPzu&IP7ʦ:hhB6?QI\/+MjEv<px-$i’YN)e0%] `KWЀUI AẪ: ]:,gu Ko|;psh:*G(^EGYQthn 0UQ }(F$4y.ԃaW Ltܚ qP lMұ@sSZQ1d{2Fqܫ4izٺZ.f{ d/(uAaJɽ +Sb-7SC/!p u|E)ed@q۹u[CÖJBTP3d@ h.}5g@({WRMt w+HIB\IN,1od\b1MC`nNsG5z(;!9Ȇe؜9<v]J;So$dMD⯲0; {>d1e żz_lZ^P;hz^ FM?8Rmxl? Fu7C8Ӎ(_. G53(?-Dj%(n]c)ѻ#AM!mσ_gYnKAInNǡQkBgmpkyW|\ k[+4.Wx޼^I^6K$d`4M!r@8s+92*'J&]s>{_3ծB7`-] `/%Y94,D0+-l34W8\F2(P9XQQRO>eL!6Fj~a7r5B>FdCW e %=!u, 6D2 k7{ҴaJ߀iKjEUơ/PV00|蔉20D 6Oչƒx鶊⍩f$ɆE<O媐"3I eԴɛV(=yYs`n&w=v,ࡆ5\gP6GgqJ"+2Y=ƗmS=z֌hxɶ/J_K3T ;7j6<&YIni Rm?*1 s&dmJSeL볩HShJ7cm>qOYlAĮ1Dtkr4X:^@: 3MC'^;:s)h{+5]T.rv^@*8,Q*^dc .#< X:(P$V;m$=8 [, $:W)$Sib|T ;9 eG(v(r> 6c̺/ĺ=H"W}]c׷jZZڼ\*W @hh9vOʦFC:B^Ӆ3X-r>^t ~5R.7RsD.KQ% 4FKB򦚺[\3M-;弪IYM8S.&N]/?NZ.b'{"0ˀ :6Qς:q`k#4Yo$i:t|'xexo&Lt.7SڠFB nU7k#KNHy64^F5YyǿlIIDy ]<4Шݾ鑿 Q>p034Kl{0l^w6̢9uS%rexw) Ajv|›b-AlPwMIeשΉc[N V!Rv,v N1 p%."ѩ*ia4b㩅+B^sMTٌ@P7Bi\2m>DYkϖzQQ{Z!jR}~[D-i Ŭ]?V܆?;e:jP)wV=zu ?{s4 59&?UҤ Npph8*cϻ# (vt()%*D+a8OhEm:{ XoEP6SBV#i/{4GOAri ܓ+Ph?:Hw IJR@r"ÜEy8zˋp {垔ŋ#K$t}QAW=< 8x+Np~W GRjfzGƯRkYY8VyQlG(t7[Bh to;xݢ~6tߥ 8ʹPߤKh7e9g.<|GMڣ%I8HlbKpT]Gǃz۳ C)s`)O^c;)ԘO$ת=J(>.p"q> [*1ǓtsYaGST=6 F3qc*TWIv%7 QFJQo,WU(}y(v %$E(?{X~vyͱ +E'4xBނTIi [ӏ:8 p8|_5^\ӧn)'g0IG3.饩x6X5] o'Kc5)@-6 =S3xyi`; / :#DeR ƒV\20kSqUY[̣z M_q|K~9'"wOh. ǀQoǗW4R}EqWXGVfy8P9~w1F(ų(c+؆vd2D<3ҘL_KIUߪ D#曹i_"aD`}u,7g, 2U?aRvQV6[D|rvWy®RÉY4rCXpQЛ98Uw-s~ҭWnDfkC@o]wV,À7}?3H_lK6@ך-!/[liTVPH 8 3ϭې Cl.Q[0m#NkvQ^k2}nϰe27(kr Twlzjm;sFHw9*Ej!%c?`!" &i oWcȌxJw ?c*cuuf@WzRlDzmBbA P?}|+OOƱ*2,D߭~r9Nec6jU j1fW zi7l.]C1#0d.R8EYuslB7UPI|vFJ1l5\jvA买8A 3hq2@ܩ U(j4UѦnZsf`uFTuj+оdWE`k b_NQk듏$O1G43%ұ]PlnIMè%fɀC4#]#7$KeiWb]Zr/uK6IV`2 2i 5kÁ8'l- C.C:Mtz=*odK0H@jb #MWVz9~ҊkX_{.JI"r~ ̡j7<)Vۧ2Bqj䆬ʷT'MNm@P1JlI3nVI!њ{纄(|aoR'Q7y0 .J4U<쓻5'XtCD3Y;sG")'&'Ÿv[wkgF]z 9b+c!kڤYMғg9C" ;fMNhW)in׈ k!HH:wb9w|͊kHS1O تL@ )q$rHNf<q Hzv?۩$kZc0+[H95sGV̂!u1z8q;N YAٽ)=)^2B|;O,Rϊ! ? $B ]wQ[f](R@Ur%F3P[J$e#ęmBșC"ϭXܝ³ɆOU5I"oOdOq-9Ir2̅Z9ޜ]/KU` Q a>dsД8}\lBRi%V-U_%(s8?BLCX /eN3Rt#=jW(U{_QCRDe4s"S䆯,ͳUzk/|\7PdnCӽpDfhw(N/ΗރY^2p0o.P/Аs8,w%h~̽wD:!Yź:bN}!X7o 0+y$~k8-e<}. K7c<e=v򒈸è-ȔCX͚TK|o59Uo:&UK\?&" y|b  ajY$xPɞY%vFxd`fYJv?[NcJu;Zء80q7!~_%lРn #PvGD=][Zwg1l^>jvVM(^ ]a{[Q&m`⢶hʱ%q? w7!ߝX/$A,-&"beO6`=$  rEzdZxw_ 9X,[LN l9ʌ*@k9ǃSNg@4Z.8VA1^H;/jN϶I/@F_j ]`+d3\#<t`GAph~stSГI Ms `957ìx)f +Ok-:'7U }ҫ{  $q8/3G'".Kra;#fdiA5g(r)Ed{X)|99P@D_`8rzM *h(-)|9N:Cg,5'MgHܤNcUYCgV7[7{1 4 sIMx&s,DM rckzc"˾nKIf~ȶ `t(U45jd-`G׎rW;$)^_-ܑQ@eQ@4Q43Q<\lu'~q px]fq|l68]z|x }(3s&QFIs~R<_4ݝ*}Zf!`qBrdڦ%1ԳIP-il8o9ckhoS#?Ck؊4!bS0Gu.O .~O b+J=jmحӏ)*l5¤\xX͜?Є[B\ػNkd#lF5ʾ]):km97qIFлa؊Bo s+PL2: >8ҋWws[3cceu^se0Ö +Oʈ3a )שP[_]𠧯c;$9I inf#ܲn}=״:4&yipyӪgR?RKc3?"Cz$[l3~x$KCf(!qp:w<}Y1 5Nϩ q]+9yc%83@x;Fdg G K ĚuJnz VDɡN]jZuҦ'Rc ] ɂ[%OOr~`?Pȹá/7)-G2F@rA/Ӝ虒/Y#d\"Z,KqؼWQ:`0$?mɿ1Pזe9YeKd"|GlL5m^Mu$m\0rzs&+UGCDBVnH@NEB;Q.qeUrI| b?rҒzS 5?No0/_෯* ox3^=>{$%4㕊2 KU~L"bU)8F:[_RW|GGn579=$ +޶@\nЃBr!]}y+TX oQ !~a$O0^UO1vSZY{z<~1 O8W GĆ%*㔒rҺoY}u7\2dpš ś>͢ф9WH''T(;t}#9.14d|乌QSm 3'8OACI{,-%Hx"+yB-ٹhLoB{HҦ5PX|$vPIJ n8 40u[(vTVBv({i &%P+|8$f{TmyEEB:+Fsb0 NebާޢEucGEE`Sh 4IQlSog@DpEX?)jDӆY\wYAUR5;yZ.\fe9d!HʤUZO5Zs%ZvS&4@M婠b˼90.͍~יd"`e]Z: coO`d83"K+;dL#,yC/M%~})oev/Ԝ#P#ߗS1~ 7uEYyfyq6|>++W+A]:>7 s9 lVo1+Js!>..8g!.ȵ ˑS濾bWA WBoBaW9T9h+{[l- [;Ѷ`fۤ#Udkκ]w|)s5Qؒ'T;kZ%D|CZz,=a9eQ;Cg'j rk'qrqܒZ^pxa:-p۵\Zf0Q *itM=3 Pr Jȼà".z*h P|yEEPd}ve d)- )eL'8}䄔&x;b$NGwBkgj#lޤ-;gC^yEn{gJv1U9էkz':ط:]9?_Yb-^FSoD鷜/_"5Ҥ}I_@CH+~-!CE "J)G(Ԑ`L!#3P;s]Wv$IZ0/h.u$"s.d7:+E=z}Mnj}"۷ͤS1%woZFSc2KUoXjD$tc/[k_U%<] biR %TһUs1y@ӦPH6*n`x\j|OԨ~B)N+@Tfͭ`#MrݷBhDZyfN=@oKJ%/}U(JšQ{ `s~Ww^p&%cCK wD^ fzXܷKsSGu=DvlLFq͉JjA6{3 t wPz[\8 ~%AK qC_]5&8-0B\2[pwԶ[ǩf%07yߊq!xxb̜:bT8R#mG@۱w ˭ثlM ]/ϒ1Ukv#ІPU#:A4.Vw(;G6q9fYBiM`y'?׵s_ViWӷa>Md܄FtKyc256#_cQjG* 쥁1H xIlc檊gt[r }@wV3)'ilQEҎoaS6D4|݁|"%\{!_%14[18UPZ6`nA݅6re0)RזEއ[^"ǑYl9-BּZbi'5V9 :QΪITrT q&mh6 Μx*!fC>N9Uf Z԰7U#árPy,T$|>r.R9P0Tr5r&G>jsAnϯzӻbv}TjbQ-BrԚ2 \8;v%9[2"Տ$@<>^Lr ң5cG ä"q>@3x5βB L'\7O:ϥɚW]O z./cg YGdjAz5H :x-ܨuv.a)_Z#:٣5kmB 3?`U*- :_35iJR]+Ӂ%F Z  *r+4ҚC?4 JjqH+BtjU<ӛb_WjՐ: Z=j8`UDNfnT! {kg$m"N(Bv7LL-Yǝ t.GpŶwp  vuyHo-`7WTyL.L2n^z 3t^AC:v_Q&Sq%B}TxP<}MRc P l`yt5gN"Z×3@1P!9̇HI܎z)"RH7GgQyRT*z(0B@`|]T7E"rQ0Vo@U k}~҉."W>ߴ~$̍ e)jsw Ő6fF(xUYn4BthK!< ѽl~CAZdȫ6OgG@lUSum4 oDjLЦJ:.oV!>! 5ȞH<}ŇP.HoQit3 cWȻZH"t,hY 8j*XݦcMӫ~!MUBfO./:e=Yp ooBA:n}L=1C%'CTzSGي˥!^G4E$s*9@dUMuƣ;Z!!:5)i YyRecu嵞ƓU23}I~NP[M9Dd%juT?yϤ_:6y' S@4 Q}R=3dӶHK&ī~|^+ҊEN^(vWݴ2Q0|z/^ !Qn)ҕYy^1lgQV> %|uyJ yKZ>}lhӻf 1Imi rv·O3&KWV1:Q)֟@̦1sw\R< w tjBL@?oƩnuoU&蕗:Zo[$ğPF"G,OmX\/T2/Ԙϗ(82Fn}Qtx Uz7-8|XTk/S9t =o@Bp-bRH3L=D\ϑ orLIXO=`P>VG;V+:íK0_DϞ7_~rap~]o@N "B̖*+ғ|?b78yٝޣM;x<řerx빙W4Ɏ `Ѽdr a8Yr}Qv6+>္FD4~gZ@# ۚq!PqD^ٔ)3v*IRuyEq[U_x Y=NtqUl''x2}>'7 f{j̋(&$C%u\gF8@ ]ԙp 7/wo]͕;D*yvRQ'Dژ ~%ܰf,{]j?<vۃx6CԱhCx|-T@y!}os' (\{JƚuR_TwC<?]S6P-^^ވ 0 `yF\qDs!\3(|AZkyXUw煉V~DiZLV]ƹ ,qJam4IXm)X;_+km΄bǕXc?A/@]BpKhwPT%JUvWa~*τ*O10,W9l9g I=a:D.{%67GስRUMjϧHͧdt$S>D[[Ϲɲclt)U 5iEԛ<01w[+ryڗ|p\T} -K$關a֎2iaA. l\a7OўߑƬ)qIU˨j@ЦH:ptb,CA `jpUoSlBn;3~$5[ #,/35s\d?qtnnSgaO:2;\O!kaħ&4%RЫ#PD 1,I`01M9g >fX>@\6_M},<9pLϥ`iCFOuF@rٔ@n p"֎ o9r- ڞS%*bՒ"̚\1VꋝU"T4M7 *JRNBP`\mfZ' e%X6!D^qm:]]P78^'FA_!O4 K *Dc n-Ⴍl-"<*hVh5ڪ㥁X6nuACF7仪+Z1f;oދ!MY|Ѡt)mD$մuUe)Z[2VO3lcKYѢSӭj¢\`(߿xB@FZ꺮XQdpH*ƮGZ5[gIUmEv ݹo*%&/Pڈ^ph4aZfn' A [c4CHTcIY)M P^CMJ8V9$Òtq'SS߆:9Ubp㎛ S{ Wm6 #Zy뻤w6}Zj6)MHH44+>ݻJ냋Ӫ-|&k@mAՌly[o̔1Kws撇.*Fd}mʍ:ooĴtWz]Oe#Ϝik(55jxD--aŽ,Al"oE^wTR+F( cy Q4Ir6tqٗ[kH܌+H1h( drrj9Fq.B5ŹҽЌo)qLL_uOUr<29eK߮ ;*Z49]bԢbVhEq ʺv޷#Œ$MQSUro=ZM./2?GN[ Hu,խYj)l"tLp#L ^&tFl+nAj+&T1L^V=Ǡ;Aw dizMq+p=D sُ!41=$W.MxHb9=8>`9CbYF bRo.04#$x-k f"j:4Jẅ{l) ~Q;z`i3NuD@*DFZXX*W|Oiɖs ZSqǧDd&)Gz %^/'bsh#q..wgk. xW,ɒcWL$odPB0IYzjQ^%N"$4* wwױL U݁H!u+I!=&[ [M;]KF=p1(@.q~UpVഁ=B9hi vkM[dWJчTvŴ#*3XaR^n]hТ*_QzXs B;҃#)D/ʜ(sJO^$Gjm4% )gM]sS 2T94}^>QVL̍;hg摥۫+0mj:~zGBvIn@>[#[Ph=#!{%!j$@[o"43Tg䇍k\nv, (Æ2KF<;QQn( y $5l;d&֫8'nWŎWMnF= `jW9TYqw E ct̠ }}03v [hc];?EM83fDžrMÝ, I~Cr2p8hY{Qآὶ6S wͻX6ިv#!34"\uMzD4t{:h|@XmM!ܼ3(A쎭]c؊ YJ:$z\|8TS絣&:^4αi'=lKڤ߲ss];hVw{od 򉫫DN{EntRl c OKrwn(94$Ei*뀮wHRVWoqJ1|Ws"9쁀X3ng Ws'7e[+E eɠ\?7cQQ:A>f;*ilQR 9>::8Y5zt7H|$Qrw}QM{Ź%s8Npյ\rLR`$t\iz`8%VxzKf00G6?,bQm@"!nD쓬|͚-}scT5J }7:ۀaOlȧWż4(.;qD$Et NxB[ERB4uhh~X ly⥏u?A@H_K˴.#,kuIY?UQ#}6vAam=f%qt9T'fD̖PK=c+tԛ4nT#3и-دNt~1^h" jDXFẻ:7;y ><΋ά.btd|>#{>!'wRQ_x)C%/;ɩFZö9>KI۵1tN  {kU!rc׋E-^EJ^@"/VJ#ٚC;Z%pK.! }(WٍuurTZ3қaו5l (YUh7J}癛tTNneIϻ4t]k%R>lq)qܺ1WRmE&{PhL._NJsGο5Jr%Y9@q5@v>Nx4dgш*`y#eK 4ƯjJ!$3*w` :'#z@+(&IyHTaoQJ@p{l,ԏ̆ +BSzfBH )SSs{׆bu/|)p \)6^zef MR;VL!a W5fd~/[2Zb`Ju+('޴ Oн ה׊U.UW%cTjagٸ= fGUYo|/HŹXhHJՂ@:ĥPTEB5K?ҡuE2U2aS%brVGt^tq&$çLRSܑFǑm #!肍~QVjӻgF%Y}EԸl)'%&c\jVeG0G@J)[pn(G[3 fǐSƬxpu8F})}{7"^ij)$`{\_X$߻}.g|v`g 7:Æ.x3$ tB9-nOA۝RW*k'ɧP>032EZX~an`8߈7|RD,;<< v)!h6̈Ft_hSq_]+O뮢bËQ131x+uۅn4G=Mzhg OoV e@pjYRIͿi<>țM5ٳǫ`܃K5҉kv Z:\Ej/,Ae M"m@'RR*.OaS A)NuPcC\LKGYl5ͮ#uY.@rj`'}o:N""=t ?N>ND$LTVi" \A%mLQ[Lu^8TA0X@ X>Y C>KA@ߒ tL@^% O7(/Gua*|'OqDFKt/P$Shs?,=ZZ3 ~N?)IG*zN}^d67yGWُ!67uz>4ӟdH#uE?9n';W9hiQ&~NEst謤ۙcPgn<>zKEzΜ&:nגg$0'u+G}^sgrkO_2:!0(Hf*mVwEWhf 2R7 Ɉ,Πѹyx8&b/Ɍ0G!%\9J+ Qx،P2_݇ Z#jMg0 E_Kbf-۞2&[IŁ-&-i38m X!8m<T/GQ&xR ^xPv.*A\ĨфI"(k|Hd!Nd!;QL'ԝN.C14뱔\/T/AMQӑTKtD tkL|uq.,9yгyU WR i$:ہ+ONVPC_nى@ r;6@NY4n|puTeԂ]uwcq>B|q!'u`FM_ kF}y}g5 |MTڛ1{WRAݖJf3^4;]Yu.!g%U!=hB;ɹ ` \,T^!z jYqIP-i'42uM'4( =t;E(-jœȺ~ ԥupTGN$c>G\L鵩Ew*43S+y$NPI]v5WwBԨDT14ULuHUn='7Cf&rϴƋ͘|-F:G6<6/ \$^3]FlB)67cwqju.Lx""Vl\LJԌkWnL ROpv||ivʀ \q] [3O=~Z/xP%7 Ey*fvN[Qe\pss' [|ߡPΈF9Ht|19m+P:ҶXkjC>+&2QV\\! 0vH8Y8 'ӽW̏0}gSo {55tH.̕lƊ Qtr5I1uˀ=8D>R)eՈgZ|eTB3@t*N>ZET!Cy$^.Z=v!*()\tQ{KzT<lgxCO/X|etDjL%]!|lˆ|O*H,#ؿH1Wv1G&8rTm*aY"h亩ٮ4X@ gjgZѫ"5U\sz\EFkJ tEхomu@g {N&mЪJ!e 3z\I7 C t>ÍoGJvnXzʕEOV8e!⒦/8Ԝk7TkvL]O -sRak}# Io;NF-@7#451mFbjFyGB-ZD7.y [֑P;K;3Z7m4A<6!̖meg-I;rA,W9cM+I.uԢUq2{k4D:ՉvT3wζ\G5MPs)w+ioIZ%dX muk=Û@qcJql^L1o?tM>nlJNBP8!' -Gh۶FyzeRSt vZ2֝0^˜@/k(u9rb=uyLF4X>T7-o[ d,BЕ )V*_4fM)B`<źH+,Oqnőm=tKWY T;y:L"?EybD<;F@7A4*݇l[ʗE4'hUE-UJҁzĨK.UT.'mG5E.,^v3!xJ6r=ms":: _Z`YAȞ#JEЯ]LyUՋ@V2e=&c'HbqyxKdS&&ynKz6KEGrBV?Ű3+ai]́#@@^3djq5Փm[jzmA •DP/k ǀW5rBKzӤ"#SPM6r*ZHDuju̅% },Vz3BFA| laOd+\|2PQ|~[Oa~C`DjWH4Ukx;޷؂(d{~e[2䛄ڋEM!sv\9[H qL]i{vXAt f@`W,TnQ=[pocQ3X_*4RDz!nFQ.20 )6ܧbPʣ/R!ߨԕH 9o4xGn x ("ϿdWKe7J Li$Uɨ_l_l@-1cu~ΗqZ8 .zC5!r CŦ]nAo YQ?Gw5UFmwB_RY  ڎFl<'3׾vYvQJKdZ edj_ ew$QkMy]ܒДčȐAi~Gqm$CW]qQKU#u\Ni/,u,q9d:2;8˨1tVjC30H5MG`\^50]D6_LMؘa"Um_t==ҵ"⩎TVȋ斫&K/lf%BFk*D;ǖ"/a%%nuWVu,[H]<&;4R})vWP - ,yy/FvtFV%,T:c_iOٔU uçٱ8SGEdwPg{@u:F;(=!ݐ%c_!kA sr(Q(D"Sb'd~krQ( Ps JW L8)hiA010urUs:'#m5 ( Qjw!'B-'!#dWX$EZԇ;4Raސ4$}qF(d}G5JyG5F9mAiU(R_SC!f'9Y4n2kw|F3+"puCꊑUoclcj=xEĖDzٺ"$vx֐.'K^G 'ǃrY[kOם*çmyRM%WbrU,*1' 5α΁lzϟM@, BFIcJȐe S\%f$%!]@Hod@MOr}\s D>ǡq~ | hʥ 44j"(\_"}Un;]uXSč zsΖW!_Uru)d" *+߷Li6:lm f*ǛIƅn9p/C`Uth4 Ho *!dNMԛ7 U Ӭ@I^ʀ"U; KUs@%/jr]&H uLHG}iۯ$(IJF;\_EYTƷj!R?wW?qQ4,  ^# tN)"RkBvDIkę[jU~r׫|jy=V=2^"ϼ4޺L/Gґ0ㆬ|FU#*j@3B?@ےx楫WU9RTGI1O R95u-rSeĄ DcJ~$+YbQɃ?q-~<ȮV[<\7L߿N!]nWUP|-ff},;g+韪I窭.Z) !M[ҥ]ӈ7tIrE\!/U>d GGw츆hǪ RJc(ySI)1yqZC%l fLcd]zT!b -llˏӼN(VIOtN}LBVZ7,-Fi!'5yYz[LD mg*v~ ^ܯ(Pߖ<'I&"/7B_L_!z*3#n_H"c\xxYFhJ_^:Ʈ;c8Di\m3PZNَqׅ@ xq֥H4G$,(^=o-UȘ4$s(o?"k[@S!9Q+rh>an_{Yi_4J2qJL3{u'g 7: ". "C/h*!OFr i6JǢXjԁ0|1gV99tMȺu%HIIzgZ$qQm殘 xϺ?,T4xLeL/G>'eNOx4%Li`O:^=:<sdr-['6\" Ws%LZQ ɤ#^!7LПΖ&iF%5%ګэdҋuMR%V+Z-=C!nTPOBU-R:h0`버Lu}},׷'HMG3XKEJ{S;!@{=?+WAڧkIaRM5K8&I0 BR ծWgP Fh+Π (ZÉ+fZ ھWxt1;[h!&t 5]{o@ʅS;_sHnyloK`uA/:zBW="xem_pC+,VϠ -P UIfaɏYaND"0'$O宀ҕEY>P{i'nL^I%@iD -:Z[eM>-'Fܹ¹f9:[ӯT^}GvF0};Ph,ǸMߘs)`GmGЖt˹-JE) z:H6b^lNA=HN(=̾ ri&q.{%4ah!:4yCE"c[C}yMrLN 5hJ)mvZORE2+D 7FF&$uܣf޶YOVj[W+Om⥈c섞шT(CYb 2VVRڑFOHG0>kO]zFQ_k-|0 "bĤgGQ1IpOIy0ld2\olYX$@q0䄦XR5C/s4/ $ڨO84Pw ^r[b;|=쳭{V9i~j) !A5moԝ}@iPwC'O pJ5F"8$)hQ1 z* }z-?Ozi%,&;2di|gDQB8 ɈE;^ Gm!ʊJe&2=pdc墇%w`_4=uֲȠhQr 9lY (U\zѰsY5! i U^ ˡ=kv}~K8]BUdg-o83ՎRôEկ15SNKU 725K-WP,^0o.# K& v!B}FA ` "b]"OCO#\B~"5lpr]?n@< ^n<Ϗh1P/TRmV$!qOV/7p^||߭$9)T/ fFlhnRu*5# &]銂1Z?Rq䐱WUKż/ u7Q;U| '%pw⩂f7;Afs_ QV)Nڥ610G%*<hbU0h -|Tr-U2Q&U3 bi$,@VqAYf !h@ ]鵄hz;K|0 EOk꣈LkvA'FzF/ZdZxɍ3,>zTF{j[]NVBb}>UћB]r >"Nužfrsen ^z\WGgOS 7~rMhZv4=aݬV؄d.C 䞁VVBx}=vOQ|;>෶͆6dzԉX.h {>T}U29dG}hh}Ѩ/uł*H s3e*Hx2-+%|uE>z]JV@AiG/.j%A(Ain_kO᫴{r#y1h F%cp ؐjy%sy(p{o4GlR`e IDzCvC =K$EI|۞;$smH1:zbϨsu= X_k l$c=k@ hjib=O}b"!;H֍5ɵ#vXxxsTL`y*My>yҭHǟǒl-κ4LKyKmsS.&b*{?ui1#SغcMbHhWQZv;虦ڬ>c) HD2HTUHzNֳ>%Dѡc (n&-%lLAB4qDΒX@%Re>x;ic8^L;_rw׬Zvx v1ד=#qˤ|VsudmKTWv+Ӣ|_xy?ӑҊݳ4/NUF*҉jBW~7'TMJq/nLy ^}7]kT\u4zrSRB3ĈG4:_zʆ>Uu7O+IڟLS7Fũ'N-slO*8xRpbf Վ櫊ͼ#fNӟt_T{?n3J͛]ho[3}SuT,f4=Ҍ\H7i% +6yROjHT84k3n"II'AR}y/{Q-.RӘ;'JM(ZbO;p_j8i47/0OqW6vEQR `W;>w[:0K!ٔS皪aqr{!;W玻Ĝ)Y<:?DKuG|WS:ѻ,rYT"V4HQ'41< &`8HAf AV ci+3[ -kM//ױ/@2p[JX>!kT(w <,&enE˧kZV*<ﰙIP6g$(k&Ig3F`HE_Oy%Tܩԗ߰m6dxp˰weY{pT]|zFAMIuPIΗ:ܷ2gZr¾ h$tn~~P ԩnj,yOQ=+!=f}3sa+U_Ӏvfva(s4@5gs㻐NNJ85hZ?O8Y`Ҝ.{돆GіSW1@o)% CE1k#62]c2J|o)j|3M!ckU~\T馘~44Q3HP)f#j2$fʝr'_ӭ[f.c\wQsB'Vf 3oS2r104t^adxfb8Io3aaH =!MpPCǛΈvg;: 1>vPa5A{BN=/ڴAQ!&n$Q+#ί}NGiWFs8ǽ5! h&eۀ1KSP7PMv.=\ Ebzd9pM 3)b=|zoeSȢ?:[L:ڛ7hlo;{ rwhs8|d ^i`E%L'm"WJxѓի _W" voB uBhc~8_T*-r9F(s}['\㑖7; RBʊ]0(M3+fDU-Pj}Ú ]x{`Tn̤NJsL_JT8ǼFCi bJjWjܸR_[P54_JҗsC@8T 'Ei!%%)NgVxne@QM1 !q:NP {&-2ێߔSc$ށ!):6^r#kRZG"kVg>c)s2n-7Km3je[%Fu_r$^{x̲3L#19n1}{MRtjKX̘mRZ;)W6vlSR޶31d|BSLq(9WyJo),4mj-2-CyS~^sxC:.QXXJ]):zh l:Ⱥ9 o7XE~E-k?=?cOt~m/[֖ϻGux./ރ )+ǟd6v٬a5~vV^%B#|~UWTIO>m =Cs..+n2 zV].1i`ʄfץ@x^pi=h3`/^@M!*[<|(1N*%ԥӳ xRK3 X誥oZ1g3 {Y_+75  z2էװF>¹| ,$mavSLy}+趽Pɟ@Wu b-,\R2#u,.o,Uvim,5@%V׮+4u(nsc^C_iVJ?X`~qϓV /,Le)$@[(Mߍ4l]Sz\\j9ퟚDj:' b*#'Př1hD}+"ea[k[Ӏhtghy]>]]?~nfSCs*C݊rRFttGYáHu[r~VyG %Pz ~&f13H5]#|8m{$4n7;&DZEKmvT<im~vI•YmArL;œU,2z{i}FU`By̴1=L ;cdfQqfV9 Q}A{3p$W{EZ@Hy#σ}kx$KvAsZUq S8{- sR%FdAv6UF&9gvo,5(`%4,MԢ6Z0>Nk~рZWOFoB ;eWzNE1s3;Z@G;470\9k㫶X%7Y{J`oOyoooZ]]Vn>%6ѕMjj;oL'xb oQ(j07wҘ ቝfIq#jw( zhJkg.)͑"s .&@(?ڷEy,rROEnH?M4M222"= 1ݭ` *NGrRЙ96H"'l@OEvD'2h "oo'ݩ9vX^_`hn\T;5B[y#ZֆSka'6@^[Q|uz;y&z̥,gC)y-΁5o zRj~i\%y|,{9yfu5 &9Nkfי{0%^̫=ӱ~C֞J^ A3_ 52Z/So ۣ{Mf;7_(Y#$sWhӝjzi^/k[%W7}՟tCCiVݦX:_13_;4JڨUkA=??L:[es2)̓Nڍ@FR%Ynh4:x+4vA^r] l?5w\FZ@1^߰nZӯwHYCߵ'y$rno۰E A"TEnɩ+_  9s#> q^-Ömݒ -U.6 .eH%FR[{N8s!wJ8oRS 1Cwx("-%$FIHg\|:kE`|6⫓- qE+˜fT~iQ,}jk~+5T_t 񫛏e00RfGLܱFy`(?:8mMYG_~TjJ"작Íԗy서g"\M };OwdSb& O2xNj츿LƶZ` lmO2> !& 0qe ,G5WvV@#-݄dV9 LO.pZFh7JҎNod#ؠcEGHִ㎦"\ĺw>(Sz7^Ϳ[ČVfZ+ERt}^0ngN\lH%Gn3+xⲠ}p"cW+fIVmVs o"͒} a{1̎[D /U BgҺQWq4$r/qf S8OjDLף wf坽"ti=NOPbjDAwҡ*C_#s1*e#:C\"KtȊ./_RJ )'bH!׈H<}hTfeDb%Ԃ!Ĩ@c7뼃$;}g{Ehf< @+bRgZ]a Mqpv uw4wɛkSkK廆.*1fa@DYєܥ١!tM:Rʹ|o 98o@=-TY٠38NNby]T.ŏazZKsE\pJ/+.5U[I0Ɍe:R2{ֽ-ckKN/{A#_+"ջGtsakwJ;6x hNF=$K[IRǀ.l].jx)'Z TT*f .QT w+V(0RzaĒӈo[f-%s-`L3XpH ]|N9"j X#[#˦5Cdpb=ДU /xJ-^>Zy]{r:A$! ~\@vK[3ت:Lg!_p/ (ɈDN y|O-esܬfZ|I9ߞ0|ω I#qKcڼ3[̧hg?؏D<^+ |)&qyINCH:OD.]=~t1- qv~O>UH˩.-S.jөyOpX8WvmY J& HjmRV۟`>@P.]H<$AL;Ƈ0t:YK>3~]z\n*0wN NZ?bw}if1-!eV؝ _B~WQF;xjgJ;:]U'n0qG=QM˴}5LC˜]Q)h`~S=߾- R@Qt厹XN!1 ): ~Nuȯ^] (cyЭw]֫wP8Yj@Egh@.T:gANbc{ ,uN=M"&^Ð6@OLlSGlvutZeh'Κ⫨HԀb\Dڛ*7E8NXV8]"a; {}1Zpzm </u[v&b0W: Y#ȧXSqc@U>ZKfz]jz zL ʭu7Խ*{:=|sUUͺvZaԧx10bQDe/hM1b DV|UȜ;FB:#X˦Lݒ[%5m RpEm2W$=ߠ,=ePneY.2ǥ3-1@d{#(1[N3d9"&&I`{0/xmsz{g{Q=_1u4>t72f\Yz'a 0 , @3[w-8)nCMݝ(Y\Ċ$iHvjT|MbJ$5s(Qr]=~rn1/L˟HC'.]t~)$^ͭ+8MH>Gʢ(nsU@@ Pݒ)lMR+@MEURԽ)B,QN){z!NE5;} !URLv#:ET1-=fBl3"lT9Z"!KW.K(C߬UP>9C>״=![_U7jgK%'ވwn{ߋCK;HbewOjkVR<@4H8IүAnV!>e3Pĸd9u[/ L ZKQײzߜ+ffz4R5Sig+ݨ?t++E;/;㿢3 ?68 G&bEZIs{qUrazl @n=ۋKSnx#e:0cS1ݺxM(:vRG2 }Lذ~sbGBeB4+9>ϘxkMD4yrh} E2b"3]BH$2sxɸrw|E7Ǜ_iߐ Z,*d̴BZ71UӨ|H5(;IɊӝB`r5:O}Rn{l;ФbQ1c!ǩ}L\(Rc (] GMޜ)ӪݑURS( e< g' CStFY.[@84#).YX6RE 5Ci?d#RHi a2HwÅ =>lϝ))! $r#&x^C(@VԌbAd>ɅJ.|kN3P3_Av"dښddr,ESo OG]Oȭp1."g=K\$|ji#xŘz+Ea_5Yk"''~زҷA =)싩\;yFEF7LY !GU@^Gx8fgf\lVdDd}GDB=w- ŵ S"d,80/ = 03knCN݉nMu7DktChj?dCYn!$ԊyUqY$< ,ׂO3Ghz5tC ʏLkDxګn阹_^fQ-Gx$YU {Z U7>Q+W9{.|R#A'ԠF֩GZ6%*A&JD:`vyS_U:byKSs9<ū7G,k0"tf2ɰ*@XҟLc{>[* ^<9d+P~bP5o`S³|'wMvz6a+ߝYakfAO;Kg-(R:/Ai[Prip|Fg$d#A3H%P6vl h>r* ǷcQf t@\.<.Y_̓?煢-.YL9!+"؅Ƨ,};Jcڂv$㙚10(P[ol cTdZ}z! 1Ȁ3*96n(t>NE#[^/.92= :t_FiZ.e-Q4oÜjpӆ ! e ~m*GۧE$P27@5,&ȕcZ2T 2Z. qtG% yk7bmzBґl q$.i ;jzsK#PpI^Ag\z\44[Bs#BX1abvP.ヂN|n%Ǖd0\~gIʕ<]Bc:RaGfTvAǰp3#W<#UA_Ł+7;ѐA:B]=='N3o*c_ PwIYTV81uqsBegy{}[p;|\hv򞴮ʵ+?crK1[@1}brk"W,F#jeI'wŝ"PvV7V^gg# WlE2RQ֔ۅCh'&8a3 z>-p; d7ӢULxJF*yw*Uy#uYպq Ymk[4kX;v7cx!$Wt%qg9]ɴ6B9v) }?FH($ܵN"cDrܓg*y ءEB.XS[.B2S#qdSWSb&dЪ!̳BZȻwO~KOԈq+@ A({ؤGGR$Yiz}UW^n!jmH5ijǍ~ۧ4GpgϏQKDymiIJn/̝a %7P#뵴lk-?C",߱IIUkM3z-I-* %+&z"S9I=: @ƎsD"{y %NBEGX1"sLYh2uU Ay%ޓt4P*}8t!M> ۫ts i~h1b~cocZ"tf;<1p*o+b8yB*6)Ցudɱitp+JV6 OAzScoduN7m"m)aqr~W Cbۥo,' $v$oNd.ݕ%8:şMAӲҩ˹U1=~Wp,g=Z;X(tl[v% rDV+e.oFITRْhؠTSBVת4X@VH"?oIxi)8N+ﶖz|&ihۑQvʙ}FSlCs-V^q %B|E~yr^&bR[<~S^b6w; JvџwQnj"۶U٭M캳'rR;o+y-Xn"YP3ן%rڨ )LHhc'5LObܟO،; 8՘'q/VzЊ-ZU[nQ8w&a>?qA0k#Zۧo|TWOBߘPبoڋ]t|.D"!A1Bl3P =X3xg .td1J C Z>cshj=_RnʚU'ķ)h:N%Sۡlf^ޥq1>RTLTk}[v"7`X9P?[X58l]O\7VX!B(`ٱVOt\\"QASKPXyѽI 2Љ.Ѝ6,7Wy .] h m| 0MAttp{j\p-}O|{e@MZw1Q\C<0=] ^]s)]2.!^`aQCW\TԎipE:-N);<ںUL*x:xlDi?Ee-hUn0Qw5a;33֌жy, j\C ~b~Zm._ +jU|{9!ݓd~mtC7XS-sbimL0?Amߤ?mܰ 6hu(ySE#/F켖[֮c&m*38ben?t֧9FU"m/i]QG0kk]^he~&?mk @w` >6TvY HOЧu7XiՂƲ0OQ]UL:GgJSvtf%tDkDf4';,qiJ4fiQGfdj:=T9 ?t%7jauJ _Y0['TdPSv#5 pEl5L⤻m8SY_~b=zB^{ڣ3 qv8A\ 86uӠ2ɀlb3GSh8uxst_iRVKE3WQv+FRVģRx%hP"xjwp mk޴\‚(o)c&4A^yQt A(N{+W~6VO`5(k~g,_)7{U[bED"}s$㖳9 OQi$PJ}ةis!Gzݩ f毻"5?F8gT٤ھ& o"V .Fk@(~NJ - H{4߷DsJ 0YIJZz|*OҠX,Ld u"H\~ݭl5aœO1 ,Զt B̛c8u ,ѯeDP (w:^6V*9zV$7+&VUzg:/^ft)[7>KWJ!'!TN%Df$33=# etH˯\k&!ФvԍdB^PRcg|38zRybR_b:Dh߽/d|}ˌ똼f37y\)|Q+wW))ATV} VЖ?D=7rY mCNw:>8nnj2sʶ=E BQ i)+k=~SC 7[}pբ 2?|y0tڿżi :.0'[ -X>7"!s6o*! HI<: *[h=xKm񚗢E)ϸ/M@i1,+b(Ph^T 1f9^}` Te68btyí 4gTSeF5V\&HCE.W=F<*K-a[Dq`{ ڦQ$Dם© XAd;޻#Bb",~CC;aK@@F+hr0;tM?Ý9~ydޡ\!naĪ ;Lfd'y*|YB&֟óh2qwp;rf/|z}^phLU^>pƾ{;i>qGs2 jU-,E]QjH^!-^ҙ{Iz{rH<ꭚTԂ ț5ڪQkr㧯^E!^z)W3F`Vg-ޓOU>}J3 8!kC:enL+c 4ϲ'V<}Q4 ny:F!]3!'@BQG섒^)WhKޟH"\J@YVґR.ЕQpԋ-(^[zPnԩUIK^A}6/x5y.R {eVwBjC29&df[ۚC@E*[ Ws`YHvMc77 g^P+g@7Q"ܞLʆUD)PVzܡq@Gd7mr)#ۃX5 qȸTB'ao]FKA1>ފ1"i,h:˿碨QΌ/nH hox<[{fZB no;LhW,/:!Zy_* I'#sYnɸ|W} 5Uս>꾯UWz|$bШa`sfp@k5=A^htKV\~ s0T@gʽH`I4 ,”V bd%ǝQpŵ=Y8JmJ,~FwHZۯ:~7{TStUz q ]@UrjQ"Q!)8{ݣ!wM# ƚGqK%/[iSU(ji9wȡgaQ6zXf5|TvH܈ PlY!tTBa9HF ."}UDGYȘĘNwoC j꼻Z^, isED+5nePb@y^Wjpfkbͨ4tP2i.=">vh-^4Xob۽h"(0SW܅9(1%(F1N9pYFUI@WSTՔh4E5kPDN;'z{j;`MO_W?ϫ5:TW&5Wq3^g"HBmlzOJZh#;XxTYS<9J:䣆r# Q ((|z}Kq-ls)/LuǢǏ~g؂8')XX{:F@sˣ^$/R ْ &]h7*B'B%vw-/yP8󬺻*"%5FSE%{ul+&ie^|z3ez+FЬEt#܌W'few'PkO!)Z[,k=F%(KR7YgZC5"qzzb/W FvitS}&VŒ]g <'JPY#h' C* %jԪrlQ0={ʣ1fy"m4EKCLʝODC$&rz`R8JP 9ZoD 9"%L_3;aca Q,y" FPI|Y5Yнy:MQ?Fag9 _dE ExB<=b76I> ""&4F@ CjcLjZ9nO)#؄B#hx`` ȮBɚθޖ^9GN.S*kẐG5 U~$Q9UqPBYx2D?r3a'@uXM:⢆ts64iY-xd]Ԍ:PM@ԮMv؅d]OF9 aCBe\6Nju&V$b~`!؏OǍnYhn [k$^w\]ݙoi8̢Ҫ``ezj'e;-a^Nފ$eP: %4iz=O?"h 囐~H_ 6%l+ |yb9 Oӹ7xmbuPG bY HE2$0X?U\AWY@]@d\Y-; C#x}3q!^Sݙڤrr.BunG5Q!u֩h԰wLj{m1 I"F"~rF.,٩_1˲Tg/K=r"YOi9wGB$J$Ln z8/:;UsSՋSdp1-q:m-TiMn:8mZMJFg@?3 zzv^,H߰@F`ޢ90Q:F (;bIGFI’aDIfO+ҹ1B#<22FD{>P4shIq+Sшmΰ5! OwjU8>%pL݂c'#iu`M|fT7k-iSuLw˚>WR{'P14}IxdԳH¤k@>Z~Aְv\@MdB_[C )Dfj8 y ИHx0٭ KnZ#e9*ܭC. aV9y=w5\,ϜkKU=@BmB䈖ި(bYweVk7> UC\6jZYY.#&~G%um!sxN5R#gE A$SDք-+zBvVV9Ri~$1fr7/+O-)~dgmP7Plv>"´,g1/l*^ʙCV<ȅTk--T0'P,ےӛ*u~i4^#KZ%5wPhJ<Y-ہ(" uT-_!PJ'K_a8\]9t}uw:+X IVMkڀY…2]dI֌D4zܛoK/"O~(7.Smd[M+U(I~Qw&]VlɫݸڨF<.(ːTuR)@dI*%۸ynܛ VXTAk-Mo I?V֝$XgfAU2)\Gnkf C7 ] >=gbƔmn|Ix Z>B$ӔЕyv9MXY1Em:ԧUe{| a.sH0)mj]D1H)8մO0M GzP! +HLUkqNWoW6!#?^M sĊzqi9O@%ٯ}`tK+|UxCUV3Uzdb0lo -L{^1+|xO/NWPTwF AD)膾ܝxŽ@hi7@r c =kp!R `ʫW!ƽmEM*VO|ƯkuhmpjXYͽ/[ шW>biӚװKD24jf'HgQE]@v_.䚦=b;&ٵ^8_m7U@3n#{lts%Ч!c" 1҈<]u%yQ Ŵ2Q>}> R!דe|*>iprG6X@2Firiϙ#Yckڅi Y}SiEakܹq36͓ah(;7o*-nAz4lmGf{r!*98yOi495r}5H#2v$iy ,6n̴ Ei$&?]+ڑmVN EK֗sv$ #l u$BN۠yدMl%JgwNď&x_C"1 2n_FRȾQ3g]̏iON4#̧s{5˹MR|8Ļ} ʪa{z;JX{drQmB1q~Ñ7]Z_s1-5]n]y_j-!<4Y ]ݭ$Rpvo"l!TG0"AS-gakuXl :{M3t +S$뷳FsƳ!-_߈l_ƔmasGtU=Rpb$g o HycYDkQm0X>dqF>r}Uw"W_!Zͷ?\_Rzk@Mi`Sr绠 xMI7=F&jbG}k$УjjpDmsWS*`s2=1 !}@Ci\g Ϊ,=!AM!s\U`@V!:q(f&B[[E˕>ޑY iAh3DFGg#CVOMGu]W°V1k/,ᕠdem*,)je@. A eם*Lb[ 2hbRL (b v" #Z]KSdv#8U U]w솄Z^ Ey*:< 8k ~r^˥K8+¡_%$'TǙ(LTRoQzP@ԅ:%5|s D`--9Xlj `} /d+?ߡKeVmni4x06}6~tk"W)I>kr>uVRQj&d|hg XÐ-ylqzjkG-"d ֘,i!BBhxx<(BVҦ"q%:BuhCEMsS 8zJ9 3co|1a{]Q`wl2A@FʊQJ9Nf@3. <\$c?fBi]G;ŏkle_03%&P(-y[)"!eC8c!;T:Z;J i,6zSqux i.V!2WԾP9l$4!8HZm MÇ"̃9.%'E^;:`Sd Ȳ/e#GWmpȑ/yHUO4^{84I}#ut^VíG"ohjYFWڝս$Ѱ%ۡ+ ' CIi9ĐxEd$ P^"24"ܹf:&2͋jrָ? ^}t<FlWR&BCy2XUߓP@f/Q;qے` 4HF#&rG Β[kưoB9IJGwɣi`Ov,I\D~l)_t׼G' ~4"xsA#N8v{m#|.k:X#hi[n,bi^:@z NNѹx:*> .?K&g7h'I6ЀmSfYi<:MrM#S%p9iߖx.jany5"Do#'~bS5BIa"hO#|T tG%.j⣜?*3֠?JS3 ZxB?j$1߃uP!lb\5Anl^ƉD;Cj8 ܈$:w͍NE 꽤~V*~@2fJsfl \<Ljáukn BVSQ}te=R")֎}Xu?*bdbF2ld 3 LEܸ6(IJnb﷡:~G{mc.h?KoN1¬Ԗ1A@m 43G7Sm3}`ዊT]haeu\U HX jw#6Ag?/j0*{?OLͬeP͉R%FaJҙ14"yGӒ.5  HƷy[>INOi-#e6Rr: `Z:FK@)<#@#& RB=f%v T/R/j``=ebь70(Uc^Z/,"4yx\Ph)E dB)k='ؖPjA;x]ު SPeR-W\YˆK9小8'ר FM'RډR\~/}'cy)fܿZ~}zU)uc`}*$.Chଊl_3. O;`_CLk.R5"9(A(g$W;IxC"uH7)'92a+c٤}'1U*wHi !@tkrx΂1lw!ۛ墏/MG8j6MvՀVyɵC@TWQr!;QgT+oREWBrV/ +[.}$0,)FX)e~OdAh]&Th{åϕ!Ɔ [jW3CWZ/25| u-\[`??ǔTf>M4{? w[~H3YEnr&̅@ċRiµ:7UlmJEu+"&mnrBZoZЄivט*~=!0]V۔oA=LnR%> 6q/*niBM՚<6ze'oO.Э1hj?>\\F䝥UC:bb8z3d{xE+Nҽ* Φp 8Ƶ U 06lb*&&Xa_͛Hd[v1H-qaZ5tV)ʸa8Zs'EB$,~4ܿpgX_ HVsމÑ.Zx gRy'd13x&9x*[}I. Yz:ފF_:lڸFg،~9j+QvN-g Ïʭ:97.EL'ZH: 7ꉱ'eyTZcl=Ri؇ϻ`'Μ¨mO, wO\H_C=Nqu2HIWj~>7Ev=k랜gor6hZF\E@6)XX48cTK+c.^\~!uld;hWs/Ҹzd^qZ- S@JlU.@5b/!]Q[y9z(0y3F;*.CֵKVn^ >| ݄|ʐg٦Ӄg+yfsl3$.?YJrǽ{HRS%CcjAcYljݬnR4흄^Й7bB}(w(Ϊm>(vEl;:baxm:2$T4 .]"{ɯ+CY퇍;Y߽E/A?0Z%ۼvvJ0?"NTs !܄"UF4fиlR~;jߊvLD^ʘVp筽: $OBQ e|A:U.kԍ^I5hs֪9-N@e9rbW*dgć+Tg5r8ઋS+֖*"˯aE_5JZfzs1}T Ƞ嚵OghU킂P6[M-=W΄48cQv$QX`Ƿz6ǩ{;-OfZ{hNF#6 s^d98;`ͬa{~Ag]]a?" u"r9B-JQ|,=z?s4ۖ R6dF噀VJ_MN"Eu'%ŗvt?%$_YEmꉴP;YfO3oH]+1Jd0FZ9>}ime *4J3"Lpifm%ilqo5Bv(vK3^]\fŠ}7/eĐCiA'J==t2|Az$|J6! X/-wm> S7u-՟ 6;(Ŭb⑼Д 14% euKs!V^zA܀0/1}t @|>OP IgPfP'bA~Ox%UP )="c$̆lϠNFfk.B'/ovg;;ZXE7U=LaEY%/*ZdCjU:"NJ_]~i+~uPDʢBj]6k*zkC[^tV0B*N"JٿTyh΋Eh%qݩ9Fn_3OlxӑM੓+ **7C- J 'ڞjҼKZD͕Av?+gc wrHhY'Lt~LeHNZws>fA*C;| 'O^:@ZߌUqq}  ^̀ڱ7P3q6笍&,1f8Z9?sA\g?Ziׅ y|(ەAkPQު/~?un+=^Mj_Ha2#? gb*̬֠ 3Vb{^E>LN6JakK<0P tBp 1 ;NꝕҘ9`!omApT-F 4Ѡ(9U 7i+l ʠueےX'տ)P! ZXJKbym~T|ءAړ5S=@/K A 2!G7._rl͏4{>RnOuoc%@£do/1˳uK@7"wRGZO8[aUІ]%q@w b O-!(z-z E`U%V lWͧ63Qg*;JI_P)ʷђB2KX;B&rD_I{:󑻒@U/ѣEF0#?l+X.%(v$8C2f $ &ľ/ܥP]1uܣgԪW$@iO?< ~Hcbtjr4$u]-=8@3#rbʪ}/Wv0 (H GkADwZTϕS"+Sr!D:bCEɊLAg!Y^TcX&;U?dIFuPto/t@}t2߂YbP-l8)]ba8/*+U:[")}p֙X4o Mhbq D";z_ZOɥԑao o YEǗ,2`dCcfbn}kƪ<0%& Om/^K\PFSwguAi1~3EHD/Ҭf.$L8$ӟpyP-h/ge9հPƧs ao'$fք j[Cу:t"fF-Q\, M#D*8Q3G9^ϪӽzE޵(-(W_n4GQ@aB[8 ?g#丛XjҸ ߰!+ n 5DHOq#T{s%]~5"~d-h^7\rz>̗ ͍Bs*csw9]^unc֭X@RsL҂5fAny!#!M&nX'ZXX6uf.MOAUjˣp;ƅПcl+mT=*ڻNH-Q.ijZNZ$ŢHs.X@7`*tGnwInU E_r Շ 6 nk@VN5cX2?o֝Cq|o7WB<;ܸ|n|WۛBq8lCSš} t2i=#J^fm19msp ɶu3[lde=3iCS}I6];UonZ{[>Z2sD!½jN{Cfh\1;BKh9*5PS5F1) NtX2C a^k̖ׄ)C8V7ǙM%'Ax|~(Vas\궺+o#98# "?6%rw٭͍9&u!*K%a'z^v B욯V`Lbb!j |0C{Ɍ}LbPI>koRu O"T0(U^ D*\!7}ӎg[,/Jdxis:C2,>G79tYL>%bNŶ- לeF?S)kI7=5⛶WPhXȦa7IZnYQ5#n$bM=t}B+/r֘vp_5cgB(v2/ bCW4v XA._+[P7B90w4T$ﳺFy$|@b:ʥ!KbWshr5u_ )6y8F,_ \N({KO+DؠoלrhP^r[J7t5f/oᝂF.J~'cƞK/i_ AXމ,Ǵ3#;5|P]Na˼THt4F/7Ѿt*}vGf1vas/ɠdK`9&BC:sN0fv+a^bzS7\y~?^Is>0*ra0<҇w@ek%b3jHi}9ТdNq u*j%5}bEլڤT+Q%uhL«[J|r>HKP?w9;9M'͖Mgy@k cAHx`kX>硈=g J br@k#c}?mq&+rdiymrek^ šv`ژCOyQX # չY+Z(@S)ՠy\K-S_lTghQA,RXd 8d{U XasCVtǜEU\v#|DX$#ßpݟr;6G&I:6!E(E hw!^"_q[!|< Q-^﹅9YbrJ) 8욡šB) QtQ@u*VưCrկi2Pzz%--Mda&y(ç1&pհSy l :6hFW@6I4ry_TB[V/"gpo_:P%zU6{hpC'8 Ÿ~u]FI$YvY`kf~/l /QvhDoLNHAg5vZI9a1뎌%ʨ3;nwV`a5"V* B9ȳ%!Td+ϼk xS;f8[Tj|,ެ ]j`W`R8نWЊ~;!B2T]Po4tqx7zejʲ8&vwBc}:6kUȶ,oZ9tX$b_l3)=@ MQ$剠-uoavQNh:uRu:/%2L+"4WِjϤbt\!'#/:4'vc7.>^z7.ZupBHݗ-h\&J1֡(C2u}A, ޻BV=s '.֝F=gHM!7U ǔjR-)11~Ε,W޴Cy/rO-ˍro1%P;3p/hIF ;_wh8*N:$3gB1u1ϘbG3 E"G֑Lun>@Q]eױ 4wlؓ@0E$UύS{MZK"d)36;^1iyeM^ݢF*br|8v/_ݽ!KYnm)ǂ!*j'jㄵ~g8Phd/৞d<`n>4gŅbFߟ,!=ц[5юmY_g}6R3.Zϑ[ %%@tѾun`w}٨u/g\Meޘkuu$`}JdDk$7K[X|XIǡ'6,1 5 N2($!VA,厺GSFօ&/x¶}jz(o_ÜSn1R7::gYgz+6؋H&c;O<>\Ew-tL4;}E~TҋAo-C#m'ʁHMv{k M!r9n -xp]3 kۭVyڗ/;<Z}1q_`4-*"-|[t#}V@#q̳6M{~Y;pIsYL6~rLĢXjg>U!Wb%z:XU@d_fe.Zr)#~)p?T~8b51O[s! i4V.@g\5QB*L_NHY!NEz.`P( [@!)! C^.>$!7R9$qY ׊Jr gkW{_ F(>B {^gO"q!dnE 3I3:nUy9f/\Z?YÇ* MXًuKڮANt'+B+Np>!>W)a.jשg[Ɂwy* EЯk4F):GɎH7Λs%zVC#_ :V|U]a֜u(o?WgmZn@WTC4rID!WB'÷YL:v ~2VpEc Q4c׵ LMv4/Ӻ<n*bIDgǡJpw(7Pt |+mұ}!#ya J"KvzL%_ ϛ5[U+x>َd$4"sQwT OP˺AMߩs,#Mx&ּ!nj@rx2^.ƭ5C#̖1:BIf*AUᲀM|>ZzGs3x.'lq81k=OmOiu ֳNl߁b#S8uZT5tNǁtn4?fjQHFg _Ćâ5i=DZdN( Q@h%gm[|6n=%tG0{"CjohUd_J.rwE^P çGg~_!Rw7!"=ּkvQ'Ax]B0 t";'-$rM+%U@^X"첛7: :R-wܧј[XVy, ecDp|w+hF82g\y%dsV qǢt4j;y5yVwT]d{qMS-D?dXҭ$ӟcIqSܞK{(iaWMa`n3֜S'JϏ mڽۇzaWDz+JD5v^};hvYt '2/zl~x**ɒ,a'z8"7eA sJT˙G,Y~n:`4 t&a˹rg fHtYVKLadP$Dv<,3{qz R|מfqۤ#}7) Ŗ ={ yS!Pyj$w9ń{hn٭QS?{H.eW8%V/3 -'y5.C1h֞ Ol'Y'RP04 Qt`T1^dA E}|)$8[:-1L/e?d<1 '#gHYG8_i!OէG#sJU8AX--1=!B)x_M (I36Ah~p(ne?=a 䇃)1Jxd,pߞ)iR.~L*q)鳴B3i9e=}GlK (-Oa@8e2gpsK8L܉6b4Bpisf9L꼖=g^nfd[V 8h]#N@=HngqME&K;r)]z۵G"/)Ybq[c< A6{G FHjgq@4s4H[kQk9FFG<,rTjYl7^zRϸp㑪30T2##"X`fxdbW|+/Mqz! ; aQRs53lA@rn]l64HEb=w^0@Mj4@T[?||)6Bj6%eun8l49F^?_UAor$ZoO`z*<ոvgoUb o_@-=m$k~rCQV~r9}m9N7&gu56Hџ֛S°FVDnr79[4zUܪUu7(wcT8npd46DdHl[gz6lH8pɞ%iY,Fa@#S*;ؙd, b"RΝnҟiCQ]T$iKgoQavEAuɼH,uVѴSa)(oR.gJ+ܫJlM h,jt?<lIM,Ub,hbl>y}bM:N %A ׇzZ[qUT]ÌaSHDA۩ŋf#wJ$9Z*iȫU׳ Yfa",Y ^ Aڬ<=w8W4fSngz&;ˢ g=9Q'm?>qm:4ڏx˅7 *`sfwIsΚZj֬a.NS HICi_sqBVDEHA=3BRg K¤M"ccnŌveL?DCrk099cUK1vrL>[Emn,ˡ=,Fѐ іہ-i DY5gZM_%DF(cA^\R,D0Q>T= }pʛF>oԿmC쳃c˨H`G9 W} 91th(S6 ߒL4p}Cjբ8y#n6cMs^DE{$?tm Fe8&c,!`]Dl'0W$sev8F'$ nnH ߉ڶ4꾹p/\1U(x5C"\Ոծl!J!ܔoS")_TM*ϳ G|W0ee&t5^b=wo۔HoI-KGsz{Ih,6}?O;W,_zIf7=$i+ GÌsFjPr2=✄|!/4?m[0_hNI>FηÑ[-J7ø~a [үGRX{%N s;-֯eUkUʠ3-zv!^gZ- ^8>yG.=M.!Wuإ1rgݡzR=ŴKKxMt"oKhBGcX]iELxo>p98q$㾘&sj-˛V6<9.EzIq+4t˵f+CÿS4Z~sk\&>~bd.cbZg=il5e Yc 8 T(JoJ+YqṼ@t;n#^:FxK׃Ϝ\/qr_IPY_;*c-0nWNO\H_'7&#XisLQ:-"PD ,6d?zwOF`gr&bqHx|ѕWNt,=S^-ft;5R fOe"Fa8u+CoX]~f&!${˰N] vԜ]%/R,ϧ5|ҕTO>Hg9>\}1 NGҽ4Gjd;.:4d4z8 Bʡf|鸑xy85sX5 Nl:Ⱦty.rp-aB6[L`wjR/ [>Z(2 \f鿬9|<1c7-+'ǯI#Z jʦM$mx-zrl(ctH3E tٚCB%oC, dv9歖'"$rޥjQo8*~/S,#ᛰT<y0(O``|EJE𓗢ÍDN5:(3c[,{h`jYJ95K}~~ W*K|t]^>שKw?z[3uꉻg) *"JLGm4ܢ'>$]lBnjn$qt=Yrg ?K=)XY!_B)W;d7>n9Rm$R bEBmu aj`)g,|DmsdWwqxCqb-IG8 6hQO 2|.X~鴮'T磨,nXOrtۚ6IK"(l`{n*s+.@ LS`I3 ?$FEBREN(KfLefNȅQS, _~>"㮅i݀q,-G]:eI!0<*F6| *]2ʖY(h% 3i3h!^Uh˳iL RCBqSFQ6/%20ÿD;]Ӹs6T1}L~4NSJHh7R7aOTN_joRt)8!jW4&s%b]iSRKCƩpsq8&C_At 1ݲ]}et~D>4 iO^[1iBBE H"-@шh xJFgE\[;*{†|&Sq>egh1 zJ"CǬC"iB(F]t-l1T{ $m0y6J$|Tjmzh:g:cGB<UG>@"ƨ(8#D{I\u p,5v X=x8 !dZ%8Sڇt;hkz=6Vƶ FZKډk"$#SOvkkh@'ٝ .Y^ 0ѐky&ƕwa[r(P8ow. tH6+R|z1hon_,9^P p&$wk>2P|\d&l(`Maz<ޛYyՏsq+"{Д8yZֲ:O"2sI/f ŹCޔ\뻠kG{xzrjy\ Z.o QPy~96%|ɿdghvRjhM]0 aͥx[¢iZ6O_+ΈĭdQ0u'y1IorN.L?mlҟAWu22|{(@Tp}k"PuH@w&60sV(s?Wn2B Q2fJ?H0nn;G#xF]zI m%k aoJ.SWW=Ѡ._@5_dN5`!qۓp JSi!F{@ A+8~|qXMPUSVd^Bex}-:yaUGOzpLɀ(!K+O t(KMk#QK[X!oCW96!7YT2/ 8(|8),E-"`}9v@ t8cQj0"`@~"#&y}V;1k1_}Tkp wtq)!TQ7SKWRؼ^%a삃0h[4ܒYWPw:VmhSM=\q)Z8PE= &|#6ڔD{X8/ 6NX6_4p+`Z#JC{ ~g<@#x><k O?1u^^=8H|8PLAA1ɤj^,({?@ ۘc84hr\/n|-G R=:O8L8Gw/:S|n}{ gr60O'̾^&n4sQKG$p|~ z \l1ɲS?f'^Tm8cR򹓺yp#K `~[7oQZrI~(=!]g§.'*( Y 6ReQ?ǕBwa%wP>}bZXMNi%@&RS--dx1 Nګz] WsH C# v6#4 ֫^>i%},W9 m;dC T%LSJ1EJRՐ҉,uHNؔKU$ 3]KiaGq XofAlAB@cN4$@TX>K ^Wc'ՑnD)J(j$pL0׈h,(^dO,!{ YP^bnẹ\c Kz(2:?UaǨfN6 Woݦ\ Y "%'F&VkF%cb7B[!_/J#׼RTW)$Hʙ&`ȶ-'۳LͲ[CL)[ZQX)1uWMWī.$;r{@uQGOH*{2* QQIezr({P>%Y_Z'lxz"S_Q+~v=$YA]`7 Tgq( siJ BF(^ {szryVMiG`dkYSt*w)`X0F  NRp[0Ey RHHcQDd#hb!S[sji C=C hj)1<]-]ܪopےesK8)~B7Bo}?%\=! =4LP !F o\K̬9e51.N7Qw4e"M+Ԏɂ1J7@t<cEZo"ir,i$%7ki95fBYza7P1jWuZt윽8_UsI |TIaRƒi[*rJxahTk );*8}-E)Ix 1*c/h 60&X^[֞*ADQNuƔS2IL}!D՝v  CFgkׂ3t)jS2TnM?у**H=O >O$ an=V[=S*{Y!$wQǡ.Wi FA?XoQpt.yNOC0G`a:8+΃TlU#"vS =WSͳ0lvZ:':s>A8mU nj6$Omxv#^{/x}T܌~ᩱ|euP}D<ӧio?g 2;M>b)*I^#qm4NK)#j 7T{3zfUbVpD!FVLČ ˬQeu`ffS$_ӴGi2O [N)y͝ $W :SH6PvX~Su[\Vjq{цhۈ _- WjzTK,m{*;WMDofXI6N"W̄Vs'j=m(S* [\ysvj 2'7mQGs9{QL$)@X_4pfSq8b;2)q(hI6|_U֋@)tHkaˠbiex;<@fa1S'qڿ~pL}1Oj~\\z=(I1@M,BI->2Gެ"Fsk`ֽXxυv˃03m?8 YA@Ճ]-5s@1WC$x0|0eֈ&`[tcy ^Xql$ 9fYBb{ ^%W,!qc= {sjJ=8nVtѝB Nˌ]3Dփлև>GGѦS ))%UXNA[(ߚx9G+}C@v1) z rgcw4ЛʪH̙ryiՖ`qF^ʹcPHa档jVpIJobU3 s"v-f$޶|=BQ1LJOĄAS#2"cSfud)oŠl[_E3 ;([^ AVs>s l!S 9 #=A)}Eq7’Zl{b SgEv&FE{"2:ti^H>@Z-[x}9f|(з~Ԥ ^rRcMjGb} =;m4'4cV w$>l*>^<oriE5Mx|C4NA-1ֺSՊ+gi:sbmp'FsSC8(h`Ԡ9gZͱ*fzf)¡S2O_I͵+wgzhCsfp4\!{6כYMcSU=ӹMsKPWvRf$||2+5a2TA,]V#~Q%O]QETNwhGg٭=pS3$MZӑ"3D8 Ge[ ra};Mbbz0poK K?͌WʆNa k8I f˓VFb1dWI$) J}@lM"OiJ W&"`{9$ʿ/R\Yfl2:/.Sˠ]gYHҐ^ [O"Ut$S("z?U 5bRAA XJ' dAF:g[zeȼ|U(C-*LQՖO>%kr8F\M1^??uuђ ڱo/O!e}/?bQpF\"p˴6Q+RQ"Am,C4E,s{e) l> ˹ta#HEs, +CZԎ +9g85 4Be8:YnZqq̉4~Jd;'" P`Q@8ݪEG,\OGG [!'ްsG-Ӽfw+:=Y%倁T[9x*$+oޖ}kKwyH$9 6RoVn` ]*J S("h][C΃BI3Ģǣ1)W! mU zLb0tY`wK>mZNA]yo ┩ŇDJ.!R/.ƚlmFhJR@lMAu_ؓGس+h׼(ax݋q8o蘷(ڂD%S8k^)آ)_sێ):+-Q\GHT2*2ۻN{ɢ!Su>mBB/U<{ҎBCX$[^1OQw:roB.\]_d%Y~U6鿢-:ج} q*h mTJk#g]h]U5 7U+bRkl=YBNL9칼%zp#*Wy0qa[U*vК$PJW{IԋNeJQCSEf^vdsRl#ϒH7* w!tniŭ9XOnI :f 1[ G>*)S\O7fB\uhEA%~ڼQLEqWToKf; ÂTL/ fOC 7h;Qҡ[!,ov,shØ~ą j -\N|/؉y9i4g?Ǩ=5)bO^ ïKɻWb3Y!޳.C~p6_Q8\E[tn]Q3HiYy~j; 0Л/8F鷁'>DB)q0Ay}y:<m <AjWFXz0-qoH *:< X'׳FO=+jW-O!׃f:fo@Y4t(z|Q8@pHʪ.@gl'/fwil=Au*=0fajxy$NCq7[͒0kjCUb4%f*]:6!Atzٺ'!k?vRUMǩ~,|$o6GܢI~I]l~ub{׆tĽs?Py1I\חc<>'}H[!!E\Ok3s;pA5nAKoew(9F O]d #ҨM\֞LBץS hC@ELy R&GwXl4=,atf@HK-FFmdciJ3_&%ƕ&2MttH#L`s5@Y܁i 9=qFfkv($F @WBК&"ÕλDcyNjUC$FC3 b-v2v>BGpSyRWtjPݜSc5Eq&%?Y1U'r "1|w1:$0&@L@@"$O 2N (lh㓈,Gp@.YI5YqIHa1WHSi`'\xB(F,k(JpU#ޫͺnj3 RH Y4 \K%Gsi޻Q;Ė&2B(u%gkiaR Zǥ)(B IChX1Bb# -S=6Wq&9Đ#nJjy<D]TF)V Y5uV|pn . $m]m_jqep<=9R⹬k\:NyE*Ĉ W|qgXC;,W~4k:_'XsK*hɬʪTOT~OJftM̊9h\hB~}kA}٦&}j@JQgg1n%}wȯ'%O;)eM]԰X>–N~R fŁ9J*y99Q!zN}YWeͮ i j,}4dlj[N4LVWی$ - ^ybȃ}nȍA&*G볿b;MrN'C;XN~&‭5N-4OI; W(ߵh-1)?Ͷ3R넥/N0_M;I),1'́Mԩ&_E'i,3J  l*S-=12:]1h;(XUsWm&5AJ>YVf< ].I8)UH4}uGd* 2!@tuJx HϱClR2'÷Tpmm[,Cwu3g 5|x-tp5W5vDXNr'e3%ex0_Z-,d×Ρbuz>F@]@~(cd4 @]Ϭ6vExq`k}%>, plJ1+ꛗA+:0'cWE P] ;0Oഉm'{!)'.Y!aOD'!Q~7ʧrfdj$dA &5qpjo@FbJIVi'+Uk|G'h_M7G'kRGG`DXqP[9v!pX 9fbb VJlO, ?|]|&Pa{YsbKDzY;?9?Gߒ\Dƨ d90Hmbbfx00Q|s֡M'ԭIqϧ +'AO u,ȥD*~FlL J%DG/l:71٘KQ5% WtSt>WZo>oW$^͹UveпvYCg b“^-Q܎4 ;Ku=XQvXý&FʡřeûvY.jM`M]x\e#"~/I4&`w[)#7«o7gS-c!4~;*lc\]DG5aiM*H_ՙ \c]zܧoLϞD9ڪ4!zHD}% +k|deMрk#܆Z=~Jz =T3TƦ:T~e'+݋.iR t?0I`[&CAZ{}6?xBNz^$*GŜNKg£K6rC&t>"ODg1@1 r#]t<j9 :<b\'\+zڭ-K`1f%QXvk#I7W󸓱y^Z3rEfz0m+㪝AL?4pN-VLOytU}Fd$\Qi u7wG''nR(#J/NTOO^y/ 0MdA;gM- ݠ4nT z[7&vxl6?28a 981R!ڹW¸oM$!f%y}]bꉶ+k>Q 웝uv~txopy}uC0aDi)o0&a]*I5Ă%!IdpK=t?\^}X:81pu0q/ֆ++sdJXI<(Tp D,j,|q3GFfo3x̶[2vWHtZ9ΏI&|lҀ>>vb"mU΁'Ptk vo1E7Iz/̢ v;XAq<x6 IbGz4g4k y]zxі1SjeT,|RCMt7d<&Ej*p65nle?{[iH%j۲.EddpԪ(@JF;\X9q~j#V[ 01yiGy1Zv ;e& 3dWc|BYEm_si81[CH~"b.= =N!ZO}U5v1U* jq8%N9G %\@o)ݮU GGQ^O)sr̮k<<"C 7O0oʰ|].9 Uqi @=R*PWʈ!Q$5 f5@=4-"9?2N~ f|oo\K RC2I&wP*qQmC|xB> ; ζ}=1|ߧ[xÊ~n(}{{Kιpqt P G͚3\y<8~%s4V1>U|'i]խ_όWMag:Ou+-l?He kӠpꚢzpO *7cn|4f\ ̎=S#e˪*[ dqndjX -G6[u*rkOw[K(ՆΌ{=Qrc{L*1'(@ elwyj q4(&KQÃ,6!{1bY4 Q›!:FmNSDk8'9Qn{]ű iǥ۫cǜ^fk/Zn}S)SxMB&p)j5ڎron65Pꛣ"D߿]q+ア/__,qq9 s$Š$ZzoQUI:g@I*,1hk-Ioݶۊo3 0@!yZi)Tg(8g#'x@]2ON> fn'lAn+HP9wZ¾c{DtWZ]9љ7 3.(B*gM{Y͒(m*MO{d0ftjG8Fқ+lז!x'U)jFQqr0+©_i |\ތbdL'ˣuUg Yhi яo*px̛Dp#+Bp1!^Ex$+ipwB嵍PkW5فP`cQ5.~QHw#'yCЦ@{y@Jq*9 tMxo`?kq}jx^J9n;_IJR4ժψӒ۷&2a0*k>B6<}T}n -(B9[Vy=>:-֩) `A8q&? [ݨ(٨s;\o,1i֯؜jCQo=cPtbF/  7;Mat?L 'Gs.!fa\ #O}͗Ӻp*=ˬ+_Nބ}cSr`M1I=ؘ0WPAM'`5]W 5SR={1ew?*A@^ۓ۱EOm hۺfDD1q$3H{Fz>BC+Ǹvx/]KӮ&hqȦnʄ!/*rB|'a|hex29ʉNBk!uJ4!d%g#tՒ-d&^2g;tnV%2lQJa}2X^ #A??Jl᧳!^W ! bM 0S@iܷ?YyL~> B{tϻU[i ?:6"K{1)E[=N&\l6΢6(SçmjNXSkr2<AN;5 y+-O1NY/o[ /ţ ^Mp;B>]=UʱugvY*~F1 曮j(PM`2N :DM (f]<@uԠD-fk:Duť"Ɠ֖g޼WJQѵn=SVСmzE<՘GHSz[>>sk<Bn~h3yC-D1}1Y!֋HDrx\#&hT1s:ĩxKԶ8LJ0 cg /*w6`OSX3pu_+/1? " pUуE©FgW`9J/"jJw#.ɑ#q !A4 m˞3$ 0N2y-&{\~bߟ NϾ$9~.Da% b}.)W ʺ>R{<%zi ۱AV.l-J tMA: M. ̶a^˺e+؈ջ u}ډt!]z M炶 #72xUK渓1-Bj.ȁ'x$ZKkaQz[Y [Ijc'kv,RoK?Hlq8Hv:H\(-K\ȸ4bRs"b<4ΨY3n*cX%^ęTH^af؄@,*':2 g #_[c⹒̗L} fIu|ƌ4?U OU̩J0<'3v6pRsJ /'3u\yxe[>/5|,Φ>X5 2}.fU;@BuYRl֚~_*Ԗ02bOK?-A[ۏA(E;0u,WtU:!Lfi!VbSwtu;kqX;m!#GuyR!m 5 >ڌϬ=m3t"ZY1Yp%*S\UNUϹk Ng: r_*UsIWйU;r(`^6hxo8ת UDSC!vݼd\LJv̪ ,ùQ=TDP\wP\)vt>۽j'zܫe&9559>+:J -y{MX~9 ׭ W)XL ,2a+DrZr(#@3A@n:~HC9sNPF%=}32}Gq/QH[׼*6F:\7]+ܜbmۦp֢3ȰQ\cVN޿cV[ӗGY8@)yW q*ؿ!h=?f}c=ǡ#geRV>G0x=j鎅nu,t\Х{eu+`=Ј\}? S\_4O^Ժax̅0_S}CⰡrV(soQjK7Rmwޮ=*u(Dֿsr\LZYs;N&?* kHEk n/ErVĻ6Pk_6M?HeU~z9 8ǠHN^1ᯆt430QPԕ%듹Zx(HK7~ou6{ C% #mI+Fsrei}* AoqeTD)J:X(Bru? t4" *U&ϴ\Ц,8OTNY_ $/LU"xE%$[QhTEcYӝ:i+6eNw,sRXz16Y@$Ej@!t׆sӁt-<@ۀ\}\9kkG;ۤacӬ]l8 }mS׈"3U`b3)+zIRJާp6ryGv{9*dJ@ ʍ>VӨ,n2W^1Xw%IUl^XȳG h"AIrKS\:6ߒQ%/z@&^N)bBٌ Q3H(Ner{>ܕ5TxZsluA Up,غGx{u!˟*҈$2mI)ج/_` )aբ=-s# 1}:Wz9l[RgIS _ ubZ3V&PUI`_jgdU2Mi#qN1!QvG)T c䈴rrn,1mtpwuxw?UD_fR3c#>S}pL;Ic <; dq3|CIAʈ{b۶rG߬YEy^_ϴ0.3Apیgyl`VdYmw@KudY۰}%DnT @EWAгG0Q5g:^a, <9ҪX9xvUvs+g {s2Ol]Fzц>aDC؃g֦UgFŒ3Xw:}y@‹k^萐C+~(TVSf,rfo*E7Wߗ7F=Shu6R%8O{RD.GVH/c6yXc,q&vI:R $LS۲g;ga `+hK X:rI JKH4"&H(cL?%9`1sV!i]:(]#R]P&O5qpl$YOu}"7]]EKMwԮ*]"`evKN|tݒƥ{Rl֦T%x479)TYUgrj\2E_;{=@i`ȰO4L6.A 849Mb3\bѓ0Tyl4>*͖]LgG^C ѹ]8! Eu Ee GLa`j$YΊ紡]xn弤)}Ú񶜭c"mבI=o&4A㤃Vs^kwy\36UÂ2LeͲ\Y0W cSX4}^C4JjpP.UB g902q'(Ķ͔tU P %  w@E,XE 2sV!!.ZC֩NR_OMUDfv7o#m=hsleKeC +N}s@_0C~ܽċcGJBo9.M5"Lzm)I]b)n$*"r>!d dU 4KW(JSH2N#܊!̭HP0NUŖt(n8$I"gM9d Y. CaM t ڢv=ڥzQ1@B79ޮ<5b}f ȡĂʼnơ1>C3\3m` Hp~v(9xlISUu+^ݬ+6CtyRNCUb+wa~V uUвn/f74-}钭HxצoS!eLq7,' 0KU[壬Nv^+] hn?ʴ(TT1UkA OX G,q.ﮇH8Q2S5e$PZ@-n"duX0 D,!7An){v9hqGyB!},Q-_⟒!ѠC2"YH"bj׍9 !t*Ej5n%=:Ytl28&,2!>,WxF!|rNpA_x^9{!FmG+MlMI5޺,ē7UPv*6+s_jH;.RZ[9j6;] #x|39[ܴgvi })6- <@I8iz^E"GՊYVw!>աû|5oI@PFhݞ87#Sm$' hL`T"0U+܅Ggx i$ tD|e Yw[\jh₮DL`X4kmz9sO*Һ[eI| ^·BtX1@0O[n&YHq {Vm=$}|lHX@&2 o>c?#C}zLet:x@ S {0[@? GG &\>cDKR~Cw4{;겇w7/C 9Tbu; 5flEdd^Ac$0I{8@ket9<M+Rr,ޖWg{C--Yפ4)!{PKGa)K, #c+T(̀Nݵ:kd 9ňI+ߩK'n'zZ]rA,tK¡QuBc "٫T,[sV|nz.vBиI.Dێ\_V|TE4.XN ץ: 4Ƒ}j M_$`@s<7wFqM yj5=S5`? G^+#ve0k?|wmyE3GhgBEʹ"O-.i0?^ ~''kT ?dB7TxCgw~g%P|i̻C-WПur3թy@s°>;Cq:-tܜL>ːD|G9UTR]K#v_А1ll! 2Ӷ=@G5f5m]tw&sH?f MS+2=W%*B1u}h .ֳ"3S3VđeY˝?Z6#-}4rv#oI &g7[-Y8]S)sdK0!a_ #Ae(GHSD>S6> FV$˽=&Dy/ ^ ` b\rdMU~M\M^h8-r9m7lޥeCȓb&P>_~i1Q$oܿ%pueS <Hg{a|{Fh [v<$- {]0GWrF S?( Qa{S d۠/.1~o>K_Eļ Zơ6< L,#t4.7SճS"lIx6&4OIXRݶ)u~LkTzT^X@K덃%SDaQǰG`^""ɜF^F.ϊ:"#wF0+D^\y}F(4RR\!A>kճNRap DVN>,˜e,=+$T5ÕdCr%mq\ܝMvт|6R!nA]TCٮ"M j)=L{xHڧ@ohC#EajVVg?S@́rOn-zCwf!y]@sN#A5JI@&V!_r4F#[6(ݺЇ~WM_6WEhV zބ=r4EPRZ!#zMDBAK12iPc<~xaߏ,Wq%fRj0++3Nek((,Zy q rKiGip%.77񗯑v>tG:7]WH -:_%B!O,(ɛAGv>9ȥf2x}G,z)w !PPٯ=č+ "ϊH` lwՐ=KOMUCˆe߲E[ "" &`tº =8 Lgӎ2:m5/{pJE98.7AstNEJey9| Fc/@ZodClk22ue %eeɫw[Fq}j8V3R䯠&ogN5u`-<^sy'}+sCŕ ZAKN³G^vq1?N]6|)iGJR,)f6簭ZA[C9i6:SH BQX੒t+;N6d-xF:8nFUЅcG/,DB $IDDVG6 ;0SP >ԑz, A~s}h>cpqm*R]CJ\9Jg6Olj W[d1Qh(^Y<*?K$ƷW=G96y~渞DR?4dVs&n?D~Qdk;qI:G[sW #= q?G1Q@?$"x5H^启D{jǼY&DWa~w?"Y)2=eJ:CmZՙc [vɆ_L;($spZނY1 bd+s^U p* îdmIj.gޑ+0Osל}J1rwQHj6M W3^N$UP+.2a L%(g葫~Hopnmh Q.~eHA<ۿUsjGŤ0^u0(,r+̄`.6k~!<4HN"J{8*2Y.k]5mF`)2-Η޾lK;eđJR%>3YS3>ܗڟ"pУjΣ NH_/+3S4R{`VGͭ&@Wij= vj$K:QH)8MAsK/C 4e^UTN=myg=.K0-spgl'x_z|&2f&ի '5"yF!GGK8̷$!+ZTRu:uFc̥ 措in徫=Jx7Tt/)w-?Eם<q-I~wѣ*\(P%eaku2ʘ6q~8˦ܫ j8d=2 axsAi,pjvTR>r5V: ! ,&#Mj/Egl OJESDXj׆~ڤ4y_M IQN1 -,*5N MtCb@faZb<4Wq[8GGgZ;s ScBW,D""mY:i8[wQ"aFzkNϽ< 1<;!~ngYY^>.@h 6 ey0|΃zr௳^-pkOxBUӹpnki`mcϱ+)Nx6Y#%Y]!sTJ^apfHZj Py2,q1܌TʪS%۸PqfO7[#?RhƮF{̨񽻔%+1}!rAL諨DYtu篦y:(õOlFں߇]mHHd}\)WR]%ٕ0p_wq=bQoێA|;?Y>jsmGS&#[v:PQ_~pEݗ^;=1?6;KuNDPdq+,@쳗q:lذ_'uFzJ虸)dâĆ݉];YS߇ 1*! iw g̔V٢xxOM]/ٌ>jM`y5) Tw5c8ZhFc# Z6fX~kGϔј]%vuØ[%*D[DM~7*Q v , _6Ldui&q|̓g/A-3}oV/]r1Rzm5/f6b+31AΰOhҶ8[K޹~D@M''m?Sb(/95wRw_,YbdV|X3GT٨֠K`Idj(Wڐ@(δCeT-Q()TL- ]CD/ `$xw oӰ2p+$ }N42QOu1FK>PHQhDv+b9d42 1]ÀFfU%<+H#ERIY*_pVrGÅ.\9)+̚%,pԱO 4aZ>d&9.$Cn&|:eS\i3vu;pw]Pʗ5 P2_4 f?1mTm%\,{$ z.wN_/LFrCnFhaO@ەge-*%*['KACub-LXR\ų-|^)~vO7a{RTV;˂ 44Q0 <ZN?Ӛ eiif(K(+pő rܭ_%u|KPh,wV$Bl |ڍө3# z;λq^:eζ/a\Ec&].=]<֟A2=)w<[KqEBHL&X@DzmRUB2{|i(ݴ5r}zgYPՑZj,Wo$eg{qfYf39YŶ<޷GV~4f ^30$RCJM* XoYm1$XXbE$<.+iYxnN^&m0& @K+sWptʋ֞΁??cwM)(IM]d&рWB%2,u3($ZEu}ǹUZ yR-`0nTigtZv}^W.<^"E{Zקxvdj1;Lw `˒6]ЉN-Q~drb LOZQ¹tMCo\/Ø.I}Lq3llƦ2=K撹O ٪{e8UT^s]H BJa*r?xqE= j{F b Q$,kIK\ zQfSAev:h0g"[ ?N}_4IO]`#}m/̳2{łnѡŮd,utY)~LkXOqK!S{w7Ѫg&MuQ'Ek;ϒLdF=cs5c&f1ҫ >1on-ģg06/j'蟊Ti7o4C M)3+CJ \ۈfH 21mH %Kdf \_ڲeifKT>LDzOB m/t`CB6<_9H˼jmT! YUVxqCR*3-qL>(?$ (U_>5[3cnYֳ|+]8rI nUVXJ4l%|^%!S;\ ի>BǕDtq 8;sM#aVeB4$ڮHC3zNW_V, <"csbmb.ؖ2*F]# u+K{MCST>Y`m]ȩ)q~`vD b@%ng=GC(vyFrld8FkH8 (ɀ"r'`mlĞl=Kݵ#eȘ^*[/;]>jԠ! R A$oYR,u:SO nOfA NjCfUQAMNUD/YKvώ׮BCf-mV^4w>]n*̨4d%bjR*HR|$ƀߪ7TGLc& Dꮃѹt,ݥ`Jʨ̪ i+Iʪ}rUo[/aqy(C<V1[* Iӟ\?/RTɠB,|ƘF+3:f( й5FCCe9l=LLH%lW(ؗl}OV+m=kʃ@@)GBoW! C ) 2 2DX P0C8IS}` k& > n2c\p'q]]W8,NP._UIT\ q? o woA 9K RbAe!̢d vaaCle F |Ʒ,7m#@η<2o6iˀ9=D X>6w:6t޵=H2DdBI6) "ғCiJ[ږ|#/\_1Chb-}EZFVV}X=@=H!LGm Z~ĈG gZJ|zZ uXUXcAwU5WE+fgF XFe{4FF%!/كgf e,j2^i eALO<yG"aMw2՞cHcln“w' !)LCqmScm {屓B\bykCm^A5uq:g(g|| k;_ ~0 CҐiG4 '\Ss ~0D@Vg6 FIXyc9y0rNtyA80τ7'uFL=gB^ڼ' @ƐeYkIl TS$;kC Q"U?N Ha  ?g$ҞBBJˉlAtWE-T?X>5__(j1+tӌ ihù¸zd|v\%j Sp%ю{1B{^XIthP@[?p!G8.q!Isф骈#:4gugG:PiБiml3X.tAeL՜d=~8O.2\ϗw.ZbC^"ܮ':D{9.ib; |pb9~@_nI!0`N%w#)?*tp335FP b=դ(X*qO( >f!08Ն͊4 _[;hyĚv hW;46B~ \&nq}12 93\?$GPH$t .hA/gN .D`Hx QwsY9[=#=Y'XNF2!]B'HP]>9Lcn}&Xz6NDˏc i=܀2,>$wo'#i,zKK^kkH3Stb#w`q1@ ewtQql@!Aq顠OnɲdwX/9`h}M 8N:XJ2q9!Cq>!)GW3ե9Qq)DܟGcS ޟF#>lA'ޓtz7MJ$m'w {IˁQ[ 5 hu';zƒ}KV30ywܽ@5uIUZ}~'vhhi!v{ҠnGkAv uUt0R%X69)]KytS$_ VHy;fŒo,91MA4D +DL \I:QʏY tE&%/WΣo5f _ C-'HY+6! >CiNpkhFR7qgK&Q3D̊[:$ۜ\VHÈYf] X3͘bZeOZ"wVSH\h-@]]5)=:*Epkr7֨`U꽓~Ӳ]XjBdE ޶aίAw9ccTn~0bHeiDZZ _OQ^ޜT%*<4=%'@>c~3!v7iD `hEdZʷ,=U[@i+d*džnaȠ&@F8?r.9'At2|{F Y}Ky._\>Ŵ_`X,?r̵dye .Ukq}^<`0`ho,ɪʁ œ%0A %nÍ.51fcdj)Kg-gD#p 677kfaL!sU"m^W Mmo|6]~ 4x i._ӧJ\ xK)Ǯ%R%OE"H8Fbh N(>B9Z9Xt m:8(tol p ^g[BtUQrnj㪙ӱt8KrBeVym 68䢥\9lM ?EU]p#CzX" O &?]qRЮ䢇6hK/5`ml.?8v-ppp:r u?j;/1:8i<WYjU:!VsetAAdcpqV)zO, v`vr-godDnX,^vP5J|33rcII zujH/okqz$  :bJܭ=ߤ?WkZJ&6\S9g)vH,j?~ 0z@l[> L UmMFtJ+j_ =H]bF&/ВP&*2!7'MOSrg D}n%9M3(d7c?DԹտ&UB!1xW.,&zޥx8)J,׮Bږ$].&tl)5iLj;2*/iǔu=BV~Js uJoX˞Cj<=>ketc*a\pE =/p-AXf(GC<[[mif;If]\)^p\*:lA8jxݜL xq #Cw((F[$ism~*,&KnBҕ+tW}Aix{Tr׈\6)`Zx/_^:7 msM ̝n}7Q % η}3X>z6idn,dhZ HH܇Y\䓰:S=rmT9coe2s] CĴ\{w|rYJ>=K^3jzA-ސy)B^cM4"?dk~X xUGoʟb&VZJª*w.0pŜSh"=f0uȗ9MnKR8NTvq( 1^H5ƼU7sM9J*5A4`ѵ~K^t.ɹ (IIJY1.z !hwwszJb dګWTTY?B)mR|N=dZh>Ԯgx ?ܕfO6) 2ЌQAjvkLMB5~ݒ!wDBO2۳ ZʥsIO"^Ґ&VH3UWJ6SmIw[pV(H^P}bOqǓu{ I}&nlMjtub*sWsS[2Q/7olPB/]ΥZ(.&)OMT'IAb0H4ZcyzkZ&!Y9ݼQ6h4P-Lx)4q"m *U'.#t0uzM ZJGc6MEp-z'n*z?ٷANJx rn`C!cqD;?1Hvtn0iws⮲ٽ}r L 0X ± rl7a C,tZchѻ߸V@,Np^/ K|)|[s/tLWl>`{zfoE=b?ٗ3)Κ! )8ap\k8G{.ÎsJ:P-v..NtƐ'BpP츊D؆ A{Ne?8rl0Ɵ:z 2LG19R2d)RF#8z#̓3ʱ(&nµ :'sU# < A(`Xo N {oL6{CWSV45 &5H|vN9f q~~QN?VXt<3CfV}fڸT/%NA'ӜN5'~=^)x4pQpl3%[Ș2±ڸF>un$|b=spX&"V\睕?$Dz6:Àq _%o"1{nF4W4]@Kkvԣ,W9 1Փ_$ئ8?Y*1'K]?jSuL, Hn|ob(67`ٟpbYZ]RSy@ Cgu#mchYR];N2~жxƳ_"G,xLdj^%doYJhنH5ݝ d<,yõ緗#M3e08 =1Xq6D7OU9pDR8$JYH*m[Ϡ*&I#.WW-uMqyꭈa"kvDҰ\$秜l:XK 8B3' au8?2AQz%G5-6JN5JGae|5ȣ}/q5Q<Նڒo^v|ܙ~J0^GBN >ItJ;kk~qx![J4ZŠء(0*ͤEcjPZ\6[7~ےՀ Mxe(3ʤeˁ]˕\ 8Lx9<.4çP ruU54ޕڔ*kJ! cCP6L'Lprڮ7948Mq4$tXV)(mX0=0on8bqŎqT2O"܌nCR>:PݣjYK6Ϣ,߼͏.l_XYݹ?>dK6l CKX0"W @ Yrc0d( GhB6˸0Рv կBT״rx\IqbFIտ=4ƅ?~??E7?(}Dj8M%yJ><6^Xw2Ƃ^;%6\-MPLoqHC I,cKqrLWu;heqfB+mt@]$?+s!av6-P ˌfX9xT -+u+dC#0qxb!0!Wל zh$HɮZvȲurZGgd]%X^W ͉)e@^rz(g#P fϱ+r"{Yf%W|qx% TR /]bgeא*Mߋ,<^< 9a{gݼ_y)>d=׹m#*g@s rׂO:d;9|Sg9, <\z6vۣx h?uuY'-w&|wǠ\g|3uʛI')r YHYeNbJ}GI8Vo1 轘  'UN}sz2VD>sUOGԨ# $ fنۤ\ܚ,K{m,u9[XZ8is9jřib걿_n`Ʌ6Ě&;^?oS`7mtڑ;dMSV6u^WRMU{? O ~&4,}SYmJk+ gj!Q6,G\Gn~kJuc}yKE e]9N{U9.+5>PC운u:beߪGSݭΘӑdSz|DTT)wOzYowF?(.0lMwV?t-}c~4QNƱjvr `+bcМI(צO}Z$<ۛ ,#ddr7!M7b<*/gZL02J=;"G Hk;hXVh3[aq1p|sJJ\TeQcEMlFRīkk b)ޥkv?bH Vhl~_dvl@ҮS)"P5Eq*EsLc|ߤYKoCyB./uyhwz`%"_,W~<zÖJ%pmɫjW q#i<Ա&/p(L {vQCRC:n[%vY#;MyNg1*%.,(x`U_Hн߹*d-&STxXvQt_q0(;3=1 FG$ۂgynQ'O|Dbѧ܆@5jsՅ/tK_#cbt8ZܖKkܫgܨzSVםzFSh7&˷U|*1M.UD)m&jgjgWfĈ ʜp,dI%pbV(ʄ,[ 4Eo<`CX~J9u *u^@˞"7/`?YZQs@ ^[9\Tc8"__QWͪ5[/ED~DjPc&ZR9|2wcP&9wEOB ʫ~Q/8<<>Ý% vglSD&p;wض);=bia"rR 哲VYPnP \<*N4ȑM>U{4θvsC5\h` Mf)(5ߝB>e^Nk\Iv ,9^ і?2&2IWvSOF8/ݗY @LZU&7-seI³Z2\MuPѪ Kҵ-U AxM*!`}ݙ9671ʼn)Egf8R:l{]9>h3X;) V49+GlːY;T7m)1㮣d%3YaKT[J'531sFKh7i[!Ŕ?-*ZKT2膳˨Zo ZsȒ;jrtfm}۶lBp ?ho;w0%`vqnШNBHLl|!'eLȭ=oq U@emW,nU"'2mXy֐+<Ÿb,myu⬴nNN'DSLǽ9涪C^m>ß1|޷+{h<V˦Yo?|ozO돜ǯ#=~rJ .LJՋ|IX}y |)b!.קۖxӜRS^nGr0(H0 XR_tp^R@ho@Y_R°&P_|܉E e` 2 EJq {e%VK_rgb_QgȲ5ҩ140W))!А엨_{SK<@h_)h陜2-"We˥YF$ RQm_Sȕ,mH٦}1%cdbBW]\^B2jjٌ/k$#&w9BRlc=gwg;5&EHj璯_~efwQQhs N{R&^g+&4fK"\gkf`vvI3*sɞD j L3}›nJָX=T5Otstuub;#)Q9'C؏q63C7%FP u 5tpHT~+4NK>OKBi"Gr)OeMM3si榚eχW).%;}T 28[lMTw>%k.b[WK+zČImGA*7Q @v\ Q!G'򃚷Ӥ<32QśaCSz讐JmN:T$ƤdB6RQ}0JWѴ(4Q~uk!͓"ƣۯѺ.fZ|giw LϹܭ߳a$aꬻu83+jS/ĆBz 87򺥒\?i9*66+8ꭥ2Dҏ2κ&`I&|4{PK*{k$A>d!Z?xEw7O m'Gۇc iq8GsfgV["^*Lְϣ5D)3k8|[1qerήjӭOגtGlꚐީh][c(gGUxiiw,UY;}\*|K̏E_ɟ}S k(O&?׮>] endstream endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <>stream HV]l\G>3s]ۻxN!Mr"Um zKl'NlL4H$HRTR)oP+ğ@{ol'E;s3g|߹sƋk;$sg&g(~GY^ۣD|j7񰸊jƥkIeټtd%rA4ʅo^/1x~Ϩ_y+n-C?z}uek+6WQU+ֺ?ISc㟦 Aax[^8M:H4Eӈ,?fa#I&C.yS eI9cE*Qc|?}^`GTj J_t׋ڑ(/ ]&FXﯽYo]: J_,SODL/;o3i.ĩ.^g컭.}K@ŗVO\^e4: Ɏ=zUzVdu}BXjMV;tf2/: ʶj= ;DvZp%p%$9qK]Yt[ZzsRbja_K|Y`b+g: VֹU>v?Ɏ.s:SUlGV"v'NY:Ok{0C2G9Oui$ӥ(<y|x 4XЗAe2D:w\QiV*+_tt(;Ʀlk4cz?לGg3!fV2ah¶Z=;$R|9%q3:;bIəpRa/+).-ݬ ")XУ\ 9L0Y?'f>EXX yݔ *O-Jza+2ipIhY8c]$ űGԁ'FJba5DPͦ7z19%%nzpEl]dW=gU@6 ?ȸQFyuYl훌3 ߄f" D~;L>@Id$rr6^|~Y<rtBb/’jL6$k7|iAݜ;4P љ]hiΖf!fUďD?ŠW&KHs F6gr0\,D b :Pnw܆]J\^\*-Tq{;\J?i!jY_xcksݡ;e5='2a/hXuJ*s@,/ ] XJy6^0 /riGqL d륽BJFOr'n`b|,7 s ڕ<q@(y* mE(. N:uÍMOnK%1دu@;j)\ :`B N Sv krПeyDw ""ީ gش(ݴ0x0rbMKSQ0 &mh2wfft>}1dwDtybmOYIjaO0 .!H`ԙ@h46FH7JWb .7 ˞󋾛sSq ?}~Bgq{;GBV!?D> l"C^O6v"oBDɗ;OH4>(q<4ؕmd$j+-5:;7y16D95G_r%EFEPH0S˻׀5Ƥ1x4 /N5 ,ghA|+ sF~hɄqr8Ck!AVwB%, A)_)q 촇}i?Y$JKϰ?i)f tx0fp0):t|H-'W^eK9z޲w6nԍW `LW6ڸqj~tjghր$ OfYμÎw?wL`7#I.H2OuWGWwtg<{kzcD)!![HpAAQcΜsHrBD9qAW/D!Q=x,׸U]{o3[ȍxoa_VM핑Ǚ2uIGqSC].ǧsIa<7P(Ԫ8K*B]2*.`|'-K Ppxaeځlى:{La Pɠb\NW neii nMNrPn]a"Uz_s/g}žu̇3F{ !2_:Y?ߙc%w5[BB\1 58 eE`b)nDUWpn.ܑU/(G\1fU&8(~]BeVuITîD+;*s\H-ޥ$9d1kBlP77fA$6E)69CX(BQPs!rZ9ĨΡNJe*Di 78'{F;5P">@8XnD"+1ÆXh֔iMN(a+|2@PH._3"> RWH1"LƩS@L+/é^4(8p:B lH$8*EȓIW`lո߁#ւ[zDVĠ҃PlIoI I6t©p(ayP !3lIN^.䣷TƤ4)φ ӭB섿uɴ4L:jHGciX0T(3Jڀ$֤. PYZ̋V\L'Ӹҧ{U,vjMK}C^ z?%ҕjN0\VPG0ܧK7$)h=5Q8,3_zFwfhq|7lޒ3p NUhP>6O8~1#VMld=Q bϕIHCQA#5Ң lc / ciBa@(|%M:!Du!H4KkPsOX!Ԉ 8/,|Js2?ΆWXQ"œ\W5k$9T(r`u""F%3f3+M١m, Mim!B;0""x$JrEpIo5WbOz?s\)x)( D{[?Dî}~~_WFEgst}rs}l#|} hFzOǽi_x]x[x_xFherlTP`dfd$$%gצ*D29ufmF"ʹ\"EQ3TB`ޘUZꋔz)V*@X3x |VJ,O_ Ci ~5jN&xD·iDh7aI$.CUh @!#C`;T%BFL3h Uy0w@sȘ5 q)R}h5hNnmPa05AWz%f$oEcL-ZhW$&h &S@j4d!seЮ@$4#ib?¾wR)x2zj/L f.-2ȶ(Jj1Za,1CNJ' -D.\;O%;U5.YmP"5]{Wy1e,^뇻pvY[Aumzd//,.W58_{*%w_ؙ0{;8 3$R>Y@穄UEW3CEu6یaa98.h]z.Sd cxBFR`7>X8ԔܥϦi_!;n TW|h[Ar4D ÷6Tixj^jrA\IfSdG

nr./r !QnEIlb6+ vӒ|j7Rg 6P`ڃ.L(/z 3us]7 gflIrg54jHK*B_ql%lM )/h<裂җ"QiA(4!X ͽ7?j@͜{̙93s;: !F4zSXIچ LUVj5gױmA}9p QPm˪m:.u{,uB7E&D E6z7٤ yrn&#X(54X8rD֭5cqii+!2#~f·NA1l JNhP ܄33no6 34#EF l@7F[zS*#=13$r w&0vABUӎ;z$ 4\F<U{i9քӺنᥐ&bt齦x.7x3& Dn{#ibT_-=7ٻǍn5Z-=vHh/|]|Ë4+5g/\[s#<+yA\qA&/cqR|G!'ٌ+wU~ ۼ(Gìo\;U|<^xF^9:.oA~K |aO5Y|L-^*) -4sKdK ?GƅiVjژjvN9g6^CV]\E<1Dhzju/^Q[(Fy mMqz9HL&ŮH6 D96&ʅ{Д+&xX_Wᎁ3CXX,mZ'˹X> endobj 8 0 obj [/Separation/PANTONE#20707#20C 14 0 R<>] endobj 9 0 obj [/Separation/PANTONE#20707#20C#202 14 0 R<>] endobj 14 0 obj [/ICCBased 15 0 R] endobj 15 0 obj <>stream Hb``$P\쓘 11 Ke߮10: 0䂢 }RR N*/)3F"FN@v#]Z_PYQ`hii\Y\[_T_XT 8@~u15 ɄADdܴC"YX98yxED%$edUT54ut ML-,ml]\=<}|CBnOHLJNIMK/(,*.)-+ohljnimk0q)SM1s9s_p%K-_r5k׭߰q-[m߱s={?p#G?q3gϝp+W]q;w'O=7o߽/_}??BY!x˨G ,< endstream endobj 16 0 obj [/Lab<>] endobj 5 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 18 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000076645 00000 n 0000000000 00000 f 0000348275 00000 n 0000076696 00000 n 0000076997 00000 n 0000347185 00000 n 0000347358 00000 n 0000347072 00000 n 0000340406 00000 n 0000340750 00000 n 0000341000 00000 n 0000347535 00000 n 0000347570 00000 n 0000348157 00000 n 0001002683 00000 n trailer <<6B0289DDB2454B709B4735E672A4B918>]>> startxref 1002937 %%EOF