%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf SKUMMET_JULETREKK_GAMMEL NISSE_1 2017-11-10T16:34:12+01:00 2017-11-10T16:34:12+01:00 2017-11-10T16:34:12+01:00 Adobe Illustrator CC 22.0 (Macintosh) 216 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAADYAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYqpm5twaGVKjqOQxZcJ7nfWrb/fqf8EMV4T3O+tW3+/U/4IYrwnud9atv9+p/wQxXhPc7 61bf79T/AIIYrwnud9atv9+p/wAEMV4T3O+s23+/U/4IYrwnuWNfWSmhnStK/aHTFPhy7mv0hY/7 /TpXqOmNr4cu536Rsd/36bU7jvja+HLuULnV4Ym+BRMo2Yo6Ag79mIwWzjhJ8lH/ABFZsrBVcSDb iTGKV6Ety4j78bZflpKukRTLGZJJRIWVQQsjSqSK1Yk9zXttiGOYi6A/QmGFpdirsVdirsVdirsV dirsVdirsVdirsVdiqnb/wByv0/rxZS5qmLF2KuxV2KuxV2KuxV2KuxV2KqUIH7zbq5riykoWWmp aSFleo48QOIWorWrEfaPvgpnPLxBGYWp2KuxVDW1tbm3iJiSvBf2R4Ys5SNndV+q23++k/4EYo4j 3u+q23++k/4EYrxHvd9Vtv8AfSf8CMV4j3u+q23++k/4EYrxHvd9Vtv99J/wIxXiPe76rbf76T/g RivEe931W2/30n/AjFeI97vqtt/vpP8AgRivEe931W2/30n/AAIxXiPe76rbf76T/gRivEe9TsKL Zp2AB/WcU5PqVIriGUVRqj5Ee3f5YoMSF/JfEYsaWvNEhAZgCTQD3qB/HFIiS6KaKUExsGCsVJHi uxGKkEc1+KHYq7FVC5vrW2IEz8SwJUUJJp8sWccZlyUoNXsZnCK5DsQFUg71+VRgtlLDIIqKWOVS 0bBlBKkjxU0I+/C1kEc1sP8Auz/XOKZKmLF2KuxV2Kqdr/vNF/qL+rFlLmVTFi7FXYq7FXYq7FXY q7FXYq7FUNZuEsVc9FDE/QTi2TFyS5ms5SSYpiVHEEhNmKPICKt1CuTgbhxDqPxQUkj0pOMMkchY sxUuqHdQCe57ChxZEzO7Zg0xZJLdpJeTyUdth+2CST4VP3YrxTq9kZHrliAqjnUcV+xTckjtt2xt qOCSsNVh9JpXjkRFCNUgE0kbiuyknrjbHwjdLRrNoYGnIdY135EDccgu1D4tjafBN0jGLmMlAOdK qD0rTatMLV1SG5S6uGiaVmliCxyIwop/esEIPFB0rU74HLiRG6/FIWJplkjmSKWKVeO7GoHqqxr8 SkdFH34Gw1VWCGRWTyssoduYSQojkAEgUrWm32qjJOFMDZUh/wB2f65xRJUxYuxV2KuxVTtf95ov 9Rf1Yspcywj8xPN+o6Xe2+n2DPEIraXU7+WJVeQwQHj6SByu7mp5Ly4lQGFGFULEWgPJ/wCZlt5o 0S/ivobqBVHow3YSZfV5Ka1ktQTGy/tMvHrtTDSiJPIIfRPzG8g6ZeC0hvvWukUJM8NtbWduxNSV UzenLQNv8UhNepPcUgC3oOjeYdI1lJTp9wsrQNwnjr8aNQHceFD1G2KkUmOKHYq7FXYq7FXYqh7A A2aA9N/1nFnk+pW9OOpbgKnqaCvSmLGy4xxnqo+4YrbvSi3+Bd9zsO+K2W/Tj/lH3fTittLHGooq gDwAA6Gv68VstCCAGojWvjQYrxFeAAKDYDoMUIc6fYkktAjVrXkoI367HFn4ku936OsB0to191RQ fvAxpfEl3lWjjSNAkahUHQDFiTa2H/dn+ucUyVMWLsVdirsVU7X/AHmi/wBRf1Yspcy8r8zWNxY+ ebuS9U+lqKeppeoSiBjHwRFli9eYv6a8m+CFIvFqmrUIbMRDzu4tPzIsPMbx6XNd3aWsyFomMgjF QCscqSCJinEj9kDuPHCgcV+ndmeu+TPK9/C2r67bCLUDFGb0QT8FVqfEQXKJ47nwxb5Y4nc804/K 7yuZtH0/UItSmZrC5mRWkjmBZUlKkRNK/pPFLGBR1jOx2PLfIuMZbU9RxYPPNQ/PLyjp93Pa3Nrq CywSvCwMCLUoaEjlIpp898x5aqMeduzw9k5souHDLbpIbe9LdS/5yF8sQqP0fYXV5IftCThCo28a yH8MrlrYDlu5OL2e1MudR95/VaL8t/nv5V1OUw6lFJpEnVHkPrRNuAF5IoYE17rTbrkserhLns16 vsTPhF1xj+i9KzKdO7FUPYf7yR/T/wASOLPJzRGLB2KuxV2KuxV2KuxV2KuxV2KqcP8Auz/XOLKS pixdirsVdiqna/7zRf6i/qxZS5liOratrWn+Y7hyzJHRRaRNbXM8E9uyRigktlk9OeKcSbFTyRh4 VVYskudK0/UUhk1CzhlnjFVYjk0ZP2gjlVcfhitrF8t+XVjljXS7RY51aOZVgjAdXFGVqLuCOuKp hHHHHGscahI0AVEUUAA2AAHQDFVszMsMjKyqwUkM/wBkEDqfbFXj3nry03mvR7WWPUkl1WFfrFm9 16cQntplT92JVCR8g4LAf5WYEoHNH+lEu67M1v5TJxEEwkN3mFn5B8yXPmg+WhAF1JF9SZeasqR8 Q/PmDxIKsKb9xmENPLj4er1cu18QweNvw3Q7yXpeleQvLOli706/sRccfTtpdVkBYrc3DBEgCjkI 5DzQoR15qBXqbvy0h0eWz9sZcpNy4R5bM38r+dLjVLiO3W0gFkGW3huoZGHqN6RlJWEr+7CIBVWc 7kj9n4tiMnqEa3p0xhtbMctYIew/3kj+n/iRxZ5OaIxYOxV2KuxV2KuxV2KuxV2KuxVTh/3Z/rnF lJUxYuxV2KuxVTtf95ov9Rf1YspcyqYsXYq7FUq8x+ZdN0CwF1eFnkkYRWlpEOU08zGixxJ3JJ+Q G5oMVYHo/m/zBq3mGA6hA0mjXyi1mtbcc7eIXSnhyf4WZgU4sx9yANsNItW/NfVdC8paVHew2/LU buVYo7eNwlRwZTKxPIqVTkFYA/EfpDHbk5GLUSh5j8fqY5pPnPS/0hoV5p0Jju7+VQ0IQB0tmmU3 TMUr+7jiSiDepDftYSBz6uVlyiWKust/l1P238Hr17pugxytq93Z23r2qmU3rxIZECDkW5kchQDx yLrkv8v+V4LSBZ7sGS7ZxKqFiFiAYsicVbhVS25Hf78SATbblymVe4D5MgxakPYf7yR/T/xI4s8n NZq2r6bpGnzahqVwttZwAGSV60FSAoAFSzMTQACpOwwE0xAJNBi8H5v+QZdLm1FtQMUUE3oPE0bm YuRyUrEgdmVh+0NuxoQciMkSLvZtnp8kZcJB4h0+37kJ+a3ni60PyPBq+iXRiutQlhTT5DAZOYlR paESCkXwKWqyE9uPIjDM0LY4o3ICr8hz/T9zzjQf+cgPNNkJI9Wto9WDR/uZKrbuswI+20a8THxr 0jrWnYmmFDWijxO+z+z2QGIhvxc+6Px/ZaIt/wDnInzIlwWuNNsp7fekSerC/t+8Lzjb/U39sA14 vcM5+zWUDaQJQ4/5yG85+tU2enGGo29KcNTvv69Pwwfn/JuHsua/vN/d+m/0PTvy9/NTSfN5e0MR sNXiT1Gs2fmrxggM8T0XkFLDkCoIr4b5l4s0ZjZ0Gt0OTTy4Zs3y5w3Yq7FVOH/dn+ucWUlTFi7F XYq7FVO1/wB5ov8AUX9WLKXMqmLF2KuxV5j56/LnzN5g82nULW5hWya0EMbXDuRFwYOY0iXZTK4B aTc027UYgoIRGoeXdf0Dy8JrNpdQ1G99JNVSNWnCSoB6dxAiqrco3QfFxqa8m6bIbsEYGVTNBgXn y31jXXm/S0bWt7cLHJEskboEVTReCP8AEF+Fh9+TAFO4hp8WTCceM2buyr+V9D0PRLMy26LJOyj6 xdShJHKghivFyqKtR9lWVu9Wxphi0scXP6vl8vwR30XqPlPzF/i7RYpo4ZFsVkaK4u5Aqrc+g1D6 IV2PB2HxlhTqu/UVl08wLNcmV4sXYqlekavp87NYLMq30PIvasQJOHMgSBa1KHsw/XhplM3IvKv+ cjr6/RdBskNLCX6zPKN/ilj9JEO3Tisrjfry9swtaSIfF3fs9jjLU2f4Ykj3vGrGGSe7hhitvrUj sEWELzaTkQPTAG55eGa7FKVgDvt6rtDBi4ZTmeG4cNvoaG30/wDNnyvLFrNjd6LeaVfPCY+RSSOd YFPMB1VqFLihDKCDWh75uq4huHz7iOKfplfmLH6iwfz9+SN/paQXXl4yX1kkTG/NzNCjRMhLep8X pJwKkLQfZ471qTmJn0tgcLuey+2PBkfEsxIHLpXLZ5TX948ZAqpBWRWV42UqG5JIhZGB5U+EnpmD kw8HUW9Lo+0fHldSjDkPSd/MmqHz776Oyl2qe+RNSl0/zroE8RId9RtbeoNNrqZbd/8AhJWGZOjJ GQebpPaDEJaYyP8ACQf0fpfWGpahbadp9zf3RK29rE80pUVbigLHiB1O2wzcvAvK/OfnnVNKtDea xfXmmz3EUsmnWenxI0EUqLWKGSZkf1Z3J6V4Gh+EAVOFHUSnL0Vwj5t5xiI35vTdB1a01XS4Lu2u 7e95IommtXWSP1APjAKk0o1dszWhGQ/7s/1ziykqYsXYq7FXYqp2v+80X+ov6sWUuZVMWLsVdiqV +Y9XfS9MlnhCNdU/0eOWoR2qKKSvxDlXiKA7noemTjAlhKYCQ3uo+cNW8sTLb2EmnXdzb0ExIjkj kZfiMSO6Scga8Q4X3piRGtuaAZXvVJNfpHd6XNps0OnhrVSBcFzaPFcOBR2X0ouBag+B1XmelQC2 JI6N2GcoSEr+TfkHQdTitm1CM2QeYRz23rqJJ40dWAdWFWRZV6D29zjYtydfqBllcSQGSabB5gtL eOysLSwtbSE8Y4YmeKNV5fFxUWwXuTQdfHJnhHT7XXDiPX7E6sH1hmlGoQ28SAj0WgleQsO/JWii 4/QTlRptFozAlimpeWdN1OCCS6T0mSWsVxyZZFkJPGSGSMrJE3aoYZkQlYoi2rPCp2DSQeYdNuba 1XT/ADVZy+afL8dHjuKV1GBxVDJH9XWJpR6bnlwIlpX7fKmVyxCQ23HcmGeUJb7HoWKaf+X8i+YL 7V/IOoWN1ZwR8V02aSVL+D1YfTkiIkXlFIQSyNIQSDxIH28xYYRGdgO0PaM5xiJ3Phle5936vtKZ 2npSah6+hG40zWY5fqUFgoWO6ZkUO7air81ZPiqoIK0JaMj7eZPNtIhmjxE7jeUu7uiAoec9U83+ YvLf6InNtPBJf2dtJqlkJ4YnlklCiMwfv3kRWo5ZWG4Hw0OV5IWKcaeI4JRkaPWj+kftQer+UNL/ AC/s50v9GXzHZTRxzR6jcqvp+oAsd1HMrCSOIBeUsYVfiFV3YVbDy6c7cB4QiWqlkJOQ8R8061Dy 15Gh8ty6pP5etreD6ss10llHHDKsIUMwEkHpFuC70Vt6UWuYAnMy4b+bdE8PqGx8tnnOn2dlZef/ AC9NpsMrWdxqNn/o9yPigl+sIssEjx8o2kgWRXADEjkvKhFTmYsZjIHv/FhyZ605sEoTJMoCwfiA Ynv7+/Z9M6hYWuoWM9jdoXtrmNopkDMhKsKGjKQynwINRmwdKlNh5J0K0ulu5Vlv7tFZIp76Rrgx qw4sI1b4E5KaMVWpHUnIQxxjyFMjInmlGpflJ5Vmujf6OZ/LupkAC70mQ21QOimIfu+PiAork6Ys j8vWmo2elx22pX36SvYiwmvfTWH1DyJB9NSQvw0GLKSZYsXYq7FXYqp2v+80X+ov6sWUuZVMWLsV diqWa3pUl4sM9vw+uWkiTW6y/wB2xRgSrUBK8lqoYA8a1oaZLi2pjw72o22s2Fzc0ZpLe/h3m0+d VWVQdiwB+Fk+GnqIxUno2GJsUiQo2wW18n3kl9em6LCG+vmvbqKKMSIUkYPNArmX7MpqGYUqKdhx w+GUeILX+SfJXmbRtfvbszKYLmSNZCFVQyLL6jvIhUUZ1LKAhYAn6VgdmY3elpbxg8ii86kg0Hia YTIoEQq5Fk7FUt0q4tdQ0+SIbmGWSCeOvxI6NUV7glSrr7EHDE1uyyiyQUTCi3Fr6VxEfh+Blk+I mm3Ku3XxyZPCbBaYjiFEPl7/AJyY1DzF5b8+aVJpF/c2EL6Z+5uLdzDJzeaRZk9SPi5HER1FadMG TIZHdOPGIig8p8t/mN5t8v61NrVneGfUZ4WglnvK3DFH95CWqPnkGwSI5Mo8keePO+ved/L01/dX c+k6RewPJDaqUt7dJZPS5MEaJF5mTiXkbua1FQW2WTJKcuKXMvrLzJ5cvtQnh17y/qAtdct4Qlo8 rPLYzQE+o0M0KsFKTHjWRQWUAFcWDHYfIWt3WnmCfSdJ02ZpFIVLy/vrBAASWGmMtrbtxcLxTlx/ a6jiYcEbut08RqnfpHyrZea9J0/X7+0S68s2L1unjFnZ/Xbv02b0+kMbRxR1VCxIWQdTvk6TRq+i F86/nX5cTQLpfK2qibWPUEVvMsEjRAKwMjo8kfoyLwqFYErU7VynNmEYk9XL0OilnyxjR4T18uqp +X/50aJqmn6bYa5dGLzFcTNaSr6EiRtKZ2ig+LjwrKvA1Hw8jTbphhlBoWLY59HOFy4ZeHe0iCLH Q/F6dlriMI1q7u49VuVjmkRQ+yqxA6DwORLtcEAYCwgvr99/y0y/8G39cDb4ce4OGoX4NRcyg+Id v64r4ce4Jlp3me+gcLcsbiHvX7Y9wf64baMmlieWxZfBNFPCk0Tco3FVYZJ1sokGi1a/7zRf6i/q xTLmVTFi7FXYq7FUPfadYX8QivIEnRTyTmoJVqEckPVW32Yb4qhBorxrxtr+5jQbiORluRWndrhZ Zaf7PG1pU+q6uigQ3cAPcyW5av0JLHiSoCKtVu1hAu5Y5ZqmrxRtEtO3ws8p/wCGxVVxV2KsC8vX klprGpprkLxxa1d/V9OukWtsUhrHFHKyisc7GtGfZl4AHl8OEWN05KkSGTJMbacFl4NABHKla84e iyDYV498yDHiHv8AvcUS4T7vu72Cf85BeQNO82eUIbuSb6reaVMj290sfqkx3DLE8fEFfhZijVrt xzGpy4R4iB3vCNI/J/QrW6D6zdz3ltxbiYE9NVkFCnqopklaMjkD6Z5A02IrkuF2eTs046JuUetc 3sGg23lVtHl0vTbqLQ7O6i9C5sAonsJ148GZXBajMBuzEtX9rJU3eBHg9MRkh3jaXxZZ5M84Cwtb 3RvM2pQNPophWDVjIvp3dpcM62knMtvMwiKutPtDatdq3TSiQaIordV/MTWL8pp3lPRbuXUJ4XuD cXsQthFAkgiaRYJ2jkaSrco0kCK9DRtjRRTDrprLQkludStL2ytZ7pVvLme1nYhPVV2ea49NYXlu ZiPiDU5bbAjJ8QAdti1OOEBGPMD5yO32PMfN2tQ655iu9WgtBZQ3zerBbAAfu0VVDUX4SSoBcrVe RO5zS6sEyutnoOwMuOGLgMhx8XL5cu/4Jl+WGgXGteeNKhiiLx2VxDqFxIPsxJayCVWY/wCVJGEX xJ8AaOjxkzvuT7Q6uMcPhg+qX3c/vp9WZt3h2B67/wAde6/1/wCAyBdvp/oCAxbnYq7FWTeT71iJ rNjUL+8jHgOjD9WEOBrIcpMhtf8AeaL/AFF/VknDlzKpixdirsVdirsVdirsVdirsVdirx38wdV1 aLRNQmvIBZaPpl6lxaTQXDLeTTcBFayCMj0eMV7IsvxvTigJXbLJA8IKJSHGQzq2vEu7W21AXIuH eJJW4HnEHYAtx33ieuxGZEQaqnDkQTYP4/Uuv7SPW/L17ogm9F7yB1tJupikAqlR39NwGHiMrywP NuwZOjxmCSVg8dxGYLuB2hu7Zt2imjNHQ+ND0PQjcbHIg29rps4ywEh8VrQwCaqsYZn+I+mxQvw/ nUGkgXl0YEYKYZMGMy/myPdsVW2+uzXa6fp+n2Oo63fGsUr2caXNFAXnJNbG24QJtzLDwAq3EGJ2 dbqsQwS4xM8fnRL0O0/L+70NBdWEnHWVJkOqopcMxFDG8PIVgpt6ZO3UNz+PLoiEhXV5/NlymZlL dkOieb0uZzp2swix1AuUiahNtcKWCoYpDsGbkB6bnlXpyG+UzxmJ3bIZBIbJ3qWk6VqlubbU7KC+ tj1guYkmQ1/yXDDIM7U9I0HRNGhaDSbCCwikblIlvGsYZv5m4gcj7nAAklHYUMD13/jr3X+v/AZA u30/0BAYtzsVdiqceVf+OsP9RsIcbV/Qy+1/3mi/1F/VknWy5lUxYvLta8x+fOOvw6XqFsbue+gs fLfCSzlBmW5kW6jVFDuPSgCer63xK4egCgYqg013867qDVLbT7aH9M2+siVLa6l05hBpM1vI8UE6 28sjJLzRdyCaMCCwDUVaudU/ODT4rKTVLj6mXbS43nnm0iO2ed9PYXUbBwsn/HQA5+mxLJ/dAUNV UZqX/K9Rq+qnTOBsgS2lrc/UhEzDUkKpVP3ohbTxQl/j5F6b8MVRM0/5wxXWnH6rNcJ9VsDfGGXT Vi9UPb/XVaOVRK0rD190kWMLx41Y7KpXYt+fX1RGuo7j1fStvXjL6Rz5iaz9f0XVOAYp9crzXiF9 Pj8VcVeu4q7FXYq84uXs9U8w6f8AWbVrKx0q5nSXULxQIZrm44QwJau1QzvVgSv2SOJ+1Q2RnVFj lgCShvL8A02bWtHBBh0rUZ44p1oqGK5Vb1UVQaKIVuvSoNvh+gZWA3FwtRGpJfc+eWuJ3tvKsI1O 7ibjJflilhAw/mnAPqsP5Iq+DFcwdf2th049Rs934/sb9LocmQ2NggNSuUv9Qjh83RQQajMFSx8z aer2okPQW06M8qcgWPpCXkrV+Gj9cLsrtLFqrH0zHRz9RHNpzxQLD5p9P1SGaG2uZnspuKaZdj91 etIyEn00h3Liu3EBjUqUFPi2RIdng1JyYj4xAI5Ec/x7k913yjL5OOi3clwUm1JVAuVb0L63uRGh dXnUoZVY0TlsegZWFSIBxdNkhP0ZAN/4ur1/8vdS1fUvKdnd6q4lu2aVPX4hDLHHK0ccrKvw8nRQ x40B6gAbZFwskQJEDcWmt/o1leisi8X681p1G4J+RyyGUjbo488QO/Viy3eseUbkRXLS6j5cApyb 1Jru3/y1Zmd5ox+0n216jl0yRgCLigZCDUvmzCw1Cx1C1ju7G4jurWWvpzwsHRqGhoy1GxFDlLcr 4qwPXf8Ajr3X+v8AwGQLt9P9AQGLc7FXYqm/lX/jrL/qNhDjav6GYWv+80X+ov6sk62XMqmLFh2r /lD+Xer31xfahpRmu7pDHPKLm6jJVrj60aCOVQv7746j9WKqOtfkt+Wut3317U9Jee5pGAwvLyNR 6MaxpxSOZUUhEG4G/U74q6D8lfyyggSCHRhHEixooW5ugaRO8iVPq1JDStud96dMVau/yT/LK8sI dPuNG52VuFEMIubtQvBBGD8MoNeIoT1PfFWcKoVQoFABQD2GKuxV2KuxV2KvLfMS6z5iMvl6ewtY fKsV3DLPPKWNxcG2lW5ZFgKGP05J1Cs5apUN8PxBsvxYSdzyatRmESQOaD80+UobzyrNo2lRLaW7 OskltAqJ6ih+brRhwJY7nmKN0bYk5dnxkwIhzcTFkAncku8s67a3UK6fIiWt/bgo1sq+mrLHQM0S HdQKjkh+JDsexPmfaWgyYpmRsxPU8x5H9fV63TZ4zFDn+OTz+e7lm8zXl7ex2l5qAaeGO0v1aVbY JKFjIt1dFkAjXo9UJPKhztNBghDDEQ5Vfv8AN0+ecjM2nPlLzEtjdfXGuorjXtVmaK8srmBoh9Y5 cU9Ge3hIt4pePPiVZORqtN6xOvzYJzMsfFiG/ECLqt9ifx3IlpoZYipVLuR2sed9A8y2mpTazBxv NItmg8v24nd5Zbm7l4PPbiMxc1jECsCduJ7b5nnIJ0QKaMcTDrb0vy1+YPka70Sxi0zWrW1S1ghi jsTc24dVVQqxssj8wwApQnLKiO6iwuR77DKh5n8uemHbVLRBTkeVxEKbV3+LtlJbgjZoLa8gAcCS JqMjA/cQRkozMTYYygJCixPUtI1ry60moeWQktvLcG51LSpQAtw0gjjeRZftRSBIvhI+AmvJSTyF m0/6zXvD+r9ybeV/Ntlr0c0Yja01OzJW+06UMJIv3jxo4LKnOOT0mKOuzDKiCDRbYyBFhj+u/wDH Xuv9f+Aysu40/wBAQGLc7FXYqm/lX/jrL/qNhDjav6GYWv8AvNF/qL+rJOtlzKoSAKnpixebz+ct Zs9UWGbXtJawa5ku5Lh3qRp60+CMxx8QVLJzLAhVY/vCeiqhdeb/ADrHExuPMXlS2/0e4ijljmm9 MajH8HGVnMipFEZI+W4blQU+IDFW7/zl5wjvJNJg1fQIr+COEQ3V1KyW008jyl4HIJb1VtvRkVVU VYk/Z2xVD33n/wA124Nqdc8tIVke0lvnnaL0pCLoQu5naKOQl4I1dYgxr6lF2GKplfeZ/Okyyro2 qeXr6+j+si0063n5SXEgaQW0TB32+GF/Uow3VqGinFUygf8ANlJlaaPSZIxBbyXKL6wBm9JxcRWx 5Bv7xU4+r2bqegVZihYopZeLEAsta0PhXFW8VdirG/0PPJG8+wWpYUJqVqeVfcZl48wAAcfUYSZE oY6fLQMAaNUrGKNIFBpUrtl3iBxfDLFfNXke11SYXUbNY6pHulyFK86Ci+ooKNVQfhZWDL0B4lga M+lhmG/4/W2Ys8sZ8mA+Ybe+UQ2OvwtbX4mVrPV4FiYyuI2io5b0o5hxc/CCsjdoxSuc4dDl0k+K H0V9JJ4fhz4fiCPN28dTDNGjz7+v7VfyX5Y0eDVmvrjVl1TVoV/dW7xm3kh5Ajm9tIzSI5UkDZQB XbcnNR2r2jnyY+HgMIHmeYPukNqc3S6eEZXdn5fYoXXkLXNPt1Gn3Ed7bWqBUtSnp3EiiihQ5cRh lXeuwY7fDmfpvaPHIgTHD58x+toydnyG8TaH8seTddfX4rq9hlsdKtnkl+pmQenIzg9YlkdSSzcm PEDr9omoj2p2rg8MjGQckuo6fFdNpZ8Q4vpDKde0yC+uLPy9p9rCL3U5FVm9NSEiU8mZhTcfDVl6 lA9OmYHYscuXJxSlLhHmef7B9tORrDGMaAFvbNOsLfT9PtbC2BFvaRRwQhjU8IlCLU99hnZOoRGK sZ1Tyk9xq0Wrwztb3toGNvcQ0RypIYwyADi8bFRVT+B3y/jiQAebQISiSRyY9cTXc0xkvAguzT1/ TBVC4ABZVJYqG6gEmnSpzHmKNO90srxgqeRb3Yq7FU38q/8AHWX/AFGwhxtX9DMLX/eaL/UX9WSd bLmVQ9PDFiwB/J/meeztrWb9CXoR5I9REtonF4HjX92qCJlU/CFNRunvSiqE1fyP5o1DRIbKfSPL L+rdSnVLaOGZEks5pGklEL8Q6zyFY2Jqvxry5dMVRGneV/NstxZ6heaRoEUjCKa7t3hLzLOLMI8v qhZWMwnHAN6rD0vFt8VQEvlHzTdwiVNI8pXUgaRh6NqWiF4FV45pDIrMOFw9wSVq3xjYktiqLs/K Hnu2ljkS28tJMYbYy3sdqy3C3IflctEVjVeA5O0XIE8mNaDFU75/mnG9vJJHos8KrAbyGH6ysrt6 T/WVhZzwFZeHpl/2eXIVpVVleKuxV2Koew/3kj+n/iRxZ5OaUebfO/lzyrarcarPSeQH6vaRANcS 8evBSV+EEgFmIUEip3GRnMRFk7JxYZ5JcMBcnm3/AEMTYT3Rt7nQH/RrGjTLcq03AgUIiMaJyr29 WnvmPHXQEnbZPZ3UeHZAP9G9/wBX2vSLKx8s+YdFivLMCfT76PkhYEhlOxV45B1BqGVhUHY5sBqJ HzDz508R5Fhutfln5OSW20+41C30u4uTw06y+sKFdh0EFpcepAWH+TFXKp4sEiTw0T1Gx+aYnKNr sKVx+Umuw0NnqzMqjiFke5rQDsIbi1iG/wDxXmFk7KwTld1/mxP2mJLkR1WWI5X8SvTyH5wVuHqh kPUmd1rX5h2H0PmNPsPF0Mf9L+B9jZHXT6g/NMvL3lrQvKutTavrWu2v1yaP0YI55uAjp9s8p5WZ jQbAUC1ag+I5l6bSxxCh9wH3fjvYZMplzZT/AI08ncef6d07iDQt9bgpU9q88ymtMbHUdP1C3FzY XMV3bklRNA6yoSOo5ISNsVRGKsE8wCmsXP8ArD/iIyBdvp/oCCiglmYrGvIgVI26Vp39zi2mQHNH W1hp8pYi6c+mvN19EnYEA9Gr3xapZJDp9qjqNvFE0TRfYlTmBQjoxWtCSRXjXriWWORN30RnlX/j rL/qNhDVq/oZha/7zRf6i/qyTrZcyqGtNuuLF5DrHka+ks47mbyNaX19LJePfQ2t89qp9e2KMwIm Xk8iVgrQleXIbDdVD2/kZNaNutz5ClsdOeCX6zay6ofRMvo2ZRHiISZqSWixrxZVohJHxUxV1h5R 1/SoLu8g8gi91mO4lFvLNq0ZEkL3BmHprVViX/SptmPJeI3fbFUZYeQtOHrI3kI21zaXES2Qk1SW eJ7a3iZLecMX4qy14mLrU8qnYlVVtLW68s3lpc+Xfy+meSV7u1WRdQkUoYYfSh5LKGVY7j6pGvN6 KPhb4q4qyp/M/nBNTSxPlZ6SQmWO6W7RoeSCDmhcR0U8ppAvIjl6Zp1xVGaFq/mae9ltdZ0b6igZ /q13HKksciKsbAsqF+B5Oy/Ed+NQKHZVP8VdirEPOvnSDyj5ROoFRJezMbfT4G6PO3IgtuPgRVLN v0FBuRkJzEY2XJx4JZsohHnJ8x6prN9rGpz3mo3D3WoTcWmlcCvE8gnTiAtVIVVFB2FOmoySMxxE 7Pa6WGPSzGCEeKRAMpeV9f0D9pX2+j6pLZR6lFbPJp7SiIXMbRAFxQlU5ugLDY0YqrbgNy2xhhI5 8+78X9xpxe0e28dGEBxedkD7CCfmB70106bzH5bjb0r2/sorxmSNLSK4s43PFpW9Uwpen1Qyn7JH H4vtA5lRlKI2+O9/pj+15fNkGSVkAe4UP0oT/nIhxNrujTQLfS6/pOl2i61fV5wx8qvbt6iqhErM 5LNstacRWuZsL4RfNxDz2YH5K0b8yPMGutd+VVv7jVFdWuNRhkdSjMahprgkAVIr8Tb5ND7LtvI1 9cadb2+t6kt1OlusFxKlukpkJPOTm1/9d5K0lSPhWg2AA2xVMk8m6Z6jTTT3ktw7c3nW5ktnZj1J +qG3Br32xVU/wlo5JLteSj+WW/vZVHyDzMBiqleeTdMktnS1MlvOacJmmuZANwT8HqrWo264qlR8 i6yNo9VgjA/bSPUo5D83i1KP6e2Kpbe2stpdPbSyerJFRWk5Sty2FDWZ5pP+Cc/PIF2+n+gL9Oed bpRDxLNUMslOBXqQ1e22LPIBW6Z3k/CMyxyw2k5/eBYDzMlD3kBNBv0wuPCNmiCR5pPcXE9xKZZ3 Mkh6sfbA5UYiIoJn5V/46y/6jYQ4+r+hmFr/ALzRf6i/qyTrZcyqHp44sXkWp6JPJcgxP5rjXU7+ 51K5oA7ITbCOOESKQLdImkUwjjJQp4jFV3l3UNNvNPv7yyi848EWSS4gkK8/Xju7lpY0CMVafkOD IDunp18Qq68sb/VTpt1DH5ltJbm1trGUPD6ccUPJLuQSW3L4HlFsLeRjLxHI1r3Vbto4Z762h+re d7V9QpqElwQsaRII3iS1meM/Aq8uaxDoSK9xiqdaH56it7G5W30jXL9kuxG0MlsrTQPMtu/pzcZH YcfrXJiwqAr+A5Ko+T8zLGOC0lfR9Uj+tvFDSW3SP0Z5nhjSGctJ8D1uBVdzRWpWm6qFt/zRvZLt IZvJ+vQxH6qjzfU5GAkul5ECgoUh/wB2vy+HwrirN7ab17eObg8XqKH9OQcXXkK8WXsR3xVUxV8v /ml5l1jVtcm0mVkNtpE1zHZbEMRMYyfWoaNwaOicVFFO9Tmu1OXiPCAaB3ep7N0vgDx5SiJSieAH 7/x0LzWznv7jQje3tusK3RrbTOWhinj5ujRI8n2ipiKUjqfir15MLjhiJRHd+LdRLtHLKM7O+Q+o +Q6PftEmm8jwLpE62ktuIRdSot1DBclyeM0iRXDonorRRyaQMzcmO5zCnEZdxfyJaokw2QFxcTXU Ml7cNTUNQvbb9E3DO8iLMZxEpiiP7s28UBjErU4SyVp1WuRih6hEchz/AG+d8vJgd/iyO604Pb/4 fsH+tarr8kkN3fXQEjN+7/0m6noFD+nFQKgoteCDivTYspkQjQZp+XnkbTvJHla20Cwle4SFnkmu ZAA0kshqzEDYeAHgO+Bw2SYq7FXYq0VXkHNarWm5A38R0w2ikG97a26eorvP6zURVPMk9wu+WCBl typrMxHfnbDdZ5fpOcsSSxDbihHIA0oelOmUz5u60v8AdhCICXUBuJqKMTSnvXIuQWQyul2/1S4u I5GNOC+mysOIr8LcKmoG2/34XCA4fUB9rHSKEgGtO47/AH4HNTfyr/x1l/1GwhxtX9DMLX/eaL/U X9WSdbLmVTFiwu+/N3yZp99NaalLcWZhTm0z28kkZ/viVHoiVqhbZ2O1AKb1NMVRV1+ZvlG2na3m uJFnDRKkfoyHms8iRRurU48S0o6kGgJpTFV0X5m+SZNVsdLGoFbzUi62KPDOqyGIVkHJkCpxFPt0 r2riq4fmN5TDtFNcyQzpbPeSQvbzlhDGELsCiOrU9VdlJO+Kod/zZ8go4R9TKN9ZhsyGtroUnuFD xIx9KgqrDc7CoBoTirelfmt5D1W+t7Gx1F5bq6ne1hja1u4/30aq7K5kiUJ8Mi0LUDdq4qy3FXYq 7FXzj528jPq3mDUI4NPn9XUZ5Ixczu5h4Hh6rQpCLhUZlb4Wn4hSOSoTvlscW2w5scuX1EE8ky1W ylvtFtNN0TSVd/L9pJZQmF0aC3NQJBBPJGklxdUSnGoj5V5muQzYoHvseeycAyS36Jn5S1bVfNXn G90ldQW3+oQfWDcRWKI5USosIlE5lZGdWYlPhZCPmMwxo4AVv8285pWyPzR5M0jTRpV2ZJprmbUI k1G7lZTLdBeU9usvFQOENzFE8arxC0Pi1ciEBEUOSMZuYJVfIcUEWteZtWvGAkgvE0+1FeRSI20F 05AFSDI068h4IuWiJkaDHUTESbZ/6iceXIUpyJr28chTC20dXUOhDIwBVgagg9CDiqUeYfOHlry7 EH1nUI7VmUskO7zOo2LJDGGkYDuQuRlIDmzhjlM1EWWHP+fnkgSugjvCqiom9OPgfkBIX/4XKhqc ZNW5suytSI3wS/HknWn+a7DVLI3Wn6g93DICAVCAKw2KuOoPiKAjNnCEZURVOjyTlEkG7SnUteME kenwJLqGpSCtrplv8Tmu3N/2YY9t5HIX3rtlk5xj72qEJT26KcsGoQOYtRMRvRQz+hyMYZhXipaj MFBpyIFetB0zXTlZt6bSRrGA0rcWDUBoa0O4NPHIuQU4kvNRijS79MCBuo4RHiSNjVRUeIqMLiiE SeHr8UmJqST3322/VgcpN/Kv/HWX/UbCHG1f0Mwtf95ov9Rf1ZJ1suZVD08MWLy6HzZLdC7hi83X drewz/V5IpdKVnV7N+U5HwtFxuIgOBqAFPLrWiqld+a5rTW4rnUPOU1lbwy3Xr2qaests6JAWNuG 4+ryiaB5RJwHIVUdsVQp80RPNp1q3n57uVvTF+7aVG0U8lrdG1ZfTYAQGW5njX4RtwrUfaxV0nmy 0e807UE8+3NvpJgtYrjSv0bLNNJK9s18p9ZC7I7QyI7UDbLxqdxiqhH5i1GzvtF0zTPPXqWz3MSX KnShSQRPcpNBF+7ahuJbZxuyrGqEhqcQVXo/l7z55Z1+ZbbTrl5Lsp6jwPDNGyUjikKvzUKGCzpt Xx8DRVkGKuxV2KvKfPPnwaZb2+j3V/Ho36UuHtXupXSN0tE5GWWNw1VLqAiN+yzA9stIjwjvRucp B+lDXOpXSaS58rrbJoulC3hkvqepCzSOkcdraqhAZuLjk9eK1AoxrxrtzJ5a2im0XmrQ9D80zS6p dpbpDpvLgatI3rXCqCqKCxCmP4m6LWrUGJY6k7pbP+YB8667ZWei2hfy9YSvc3epPyo0kar9XEZF F+L1OXGpPHc8aUKGGGJMkXpmqW8Gu+YLbb6vGtte3Fyg58JmiMckR8HWK2ieg34sPEZkYOrja+uI ebyXzb+ZGt+aLi4szKkGiNI8Ygt0aNbiMSlQLn1AWZlMYbYjc0K+Oq1WqN8IP7OTv+yuy+IHIRfC Lrv+rb5jl3M31D81JfLPk3RdE0Jopr36hbcbwryWKL0lo/GvFpJOqr9lepFOKtk6rLHFEV9Rdf2V ocmryEcojmXkd5e3l9dSXd7O9zdTHlNPKxZ3PizH8PAbDbNHkyGZsvoek0WPBGoD49SoZBymX/lZ eakPOFlpdrdm1g1VjDdExiUUiRpVYKWWj/AUB3+1Ug0FNn2dqJRJi8h7UaCBEctb3R8+77vufT1p pun2bzPa28cMlyyvcOihWkZUCKzsN2IRQN+2bAkk2XlAABQYb5h/47Fz8x/xEZWXcaf6Ah7JbRpC Lg8QR8JJYD71DH5bYs53WyZXclomli3W5EoJJVl5Asyn4QwK9hTvhaICXHdUkuByk38q/wDHWX/U bCHG1f0Mwtf95ov9Rf1ZJ1suZVDsMWLy66/MPzNLHcva6hoVrZzequl6lctcJG5C3NAeVWVov9Ga TlGF4+owqBsqmFv5w8wzGwh/TPlySRrYT3clvcl/VkVY5GW3UF3aP0mLk8PsstPHFUst/OWr2KTX FvrXlCDSfrjNOFkmikUGaQT841IKzEy23Pn9lmcttxxVG6J/jKS5v9S0q58s3t2JVt9VuLTk0spg mk2uZIgh9aO34KqswUMW7UxVkfkHXdV1jy/DPrU+myayAGvYdJm9aGISj1IVJ5y/EYmUn4iD1Xam KskxV2KuxV2KvjH8z9D1nzx+dmp6R5es2nvV9OFgXAWkESiSVmchUVen9pwM582beR7Xzj5X8m65 5V8wWEFtY6BfWeqXF3LehEeISmcRxFmaP4pbZaKvGtSGHI5KqYxkLtifmL85/JOoXz6mnlV77UZE EbNf3LegqrSlIFLxn7h333ONtssoJumO6p+ePn27tvq1nNBo9p8QEWnQiIfFuaMxdlO/7JGC0HLL 3PVfyW89aLd+Uk0dbe7uNTsllm1NI4nu5ZBLKxafjGGlkDFwGopI2B7ZlYssRGi4GXDIysKUv5c6 Xfam8GlaqYmYGSGwvoZoJ1jB34+qqvIq1A5cdv2iTucDJ2dDJK4yd9pPaPPp8YgYggdf7GO6j5E8 2aZBqFxc2cUUGnQy3El560Ygl9JC/wC748pizcejRj59zVLs6fFcj6Q5UPaPGMBhCHDOV3WwF9R+ NkjNafIUJG1c1EiL25PaYIyjEcZuZ3/YPINU/HYbEkmlaACpJoOg3wwgZGgjU6vHgjxTNfjoyu9/ LHzjaWK3sttEQhjJjVnkdRIwX7MMczVQbyUWgoaFsyMdXQnTy2btWErMsPET/Olde7bb4V730V5K 1jTbrRrXT4NRbUL7Tba3hvpJo5IZ3YJw9Z4pVRwJWRiDSh38M24IPJ5ghJPMP/HYufmP+IjIl22n +gIGJkWVGkXmgILJWlR3FcW08tk9lt7ZYVea1t0idQyEOyMKitG+Juo8K4XEEjexKUX0VvHKPQbk jLUryD8TU7cgBXA5OMkjdH+Vf+Osv+o2ENOr+hmFr/vNF/qL+rJOtlzKpixSKXTPI2pwTRyWumXk Npz9dSkEiwkq8MhbY8DxV0PTYEYq3pXlHyZZxI+naXZBUDxJMsccjBTxjdBIQzU/dKpWv7IHbFW5 PKPkmUzWkmi6bIZiJ7i3a1gbmSQBI6Fd94x8R/l9sVRFpoflmJriK00+yRjJzu0ihiB9V0XeQKPt FOPXelMVdY23lnTA/wBQisrIEN6noLFFtbqqNy4cf7tUVT/KABiqY+pHRTyFH2Q1HxVFdvHbFVGP UtOkjaWO6heJCqu6yKVDPQqCQaAtyFPmMVRGKuxV5hYflNd6b5+vPPegaosVzqkLwXum3MRZDzKc mjnVqp8UStQxt3+gg0yyjcsG/N38lvOfmLWdKkTVY559WmmS6iPKG0heGEyQBEq5c8Flq7bkk0oC FBlKy1xjQTv8m/y8/KjUPK9tb3Wk6ff+ZLAFdZSQSTOsvNkDFZ/2W4fsrwrWmRZPRfNek+UNO8mX kFzollcaXaxM9tpHoRCKSYKfSjij48Q7tRVoK1xV43/zjx+T2u6R5v1PzF5hi+o3OlO9na2cUiMj SzRhpGYxl1KJHKvEV6nxXFXv+raFoms2622r6fbalbq3NYbuGOdAw/aCyBhXFWKedPL/AOVVj5dm tddttK021kjlFs8ot7eVZHQKXgkdSwl+BPiUE7DwxKjm+dvJnlvUfMkmnojNa2l+/px6rdxSxWrS VVSsbsqI7VPFI1NWO1ftNmt/KylKvpg9SO2MeLHxRPiZ5DckcvL3eQ58y9u8ueQNU8pxzKmlWuoy hTx1aGZY55RUDg8dwFEP+qkjKep3OWZdGTtE0O50UtXKcjKfqkeqv5d0Lz9pUF2k+mxXUVxd3FzG XvwbhfXlMnEqYvTVF5UULIT7b7DLouKt62a4Z6TXyfZ6pd2knnCQQJealp0a6dYxsXSOOjTJ60zB OblnANFAWm1euZGDD4ca5teSfEbYp5Su9RvPLlheajLJPeXUfryzy0Lv6jF1fYkUZSCKbU6bZMX1 dti4eEcPKv7ftTmKN5ZFjTdnIVR03OFkTQtkMwuW0Z4VJf0k3eKfmnFftVHXp2O2Fw41x3+hjmBz U38q/wDHWX/UbCHG1f0Mwtf95ov9Rf1ZJ1suZVMWLyCGxsL3zC9nd+UILm0uLgzX2qW2riWQXFvf XL24Fokjy8qu0jbgKCynZOOKoS18lXS6S1lZ/l8baR2h0y8ik1RuC2Eo+sSAO7u0yxSXJDGNlZ2U 0YUC4qh28ql7iaBvKE9zc2j3Gr2OqQanHR7i0vZbm3tJSqvBH6kd0WrKoqrkdVriqtY6Vp+s2VzH Y+QDMbm1h1a4tptTnhVrzUY5IJ4zK4HExxIykhdyei9Sqtn8sPdXb3J8iMJyrxXGk3OqiCMmROdx JFLRDJvq1yHdS6UjotGK0VTCTy7aS34uIfJNu1gs8SW+qvrCv6gaV72Qqok+FlvG4r8RPLenFQMV T/R/y58jX+l21xJpI0zU9QCanLbxXrzyRTs0MjPHIsjxuokhj+JRxag23xVn+KuxV5d53/MvU/Lu jajCLW2ik9C4Wwna8VLgsqmkqW7R/HwJ5FQ9fpoMmYbWieS5kPGZNbunmsNTvNeuLia1iMWlXqTz /WgryzyuxlWRnditz6ZO3wKoPSuRpbZN+XWo+cdE8xTTaP5YkurW7hETajqEklogPN5pH+NHllMj 0+LufY1yyOMno1yyAdVXz4fzM1zXtPn1fS4zFpP73S9Q0gF+NwZY5UZoJmmoymBRUqV8djicMh0U ZonqxD/FmrW9vqFtpV/dPJr6m41Ti3pSSyRmRyzyUQwszOfWK8aIPiKqtDXTZaI1P/nKvzb/AIfj 0zTLOC21FIkifVmczt8MYBdUdFXnyrUtyHzxJCi0q/LLyhd+dL6585ecZZ9XtYZhbWltM7vJfXpH JYia8hDEGBYCnZRiBbk6bB4kq5Acz5Pf9S0qIQDTL8zalrd3CY4dNs3EEFmhSiFOPwxmP7St2IB7 VyTncInAiNQxDqeZTHSbLSfPGjWx10vLq+hzNbXgtbqaGNL6DifXQQSKp5rxliJrRXp3IyDqpRIN FZqX5faZE19qmva9quo6VGnqtpl1eMloEjjowcRhOYam4Joe4NTVQi9BXUrT8prX696Md9Do3KRJ fhhjYW9Qj8anggopp2GKpBa28VtYWNtFy9OG0to05v6jUWBB8T/tHbc5Au30/wBAVAabjri3L5J5 ZKF25MP2j9o/M98UCICzFKb+Vf8AjrL/AKjYQ42r+hmFr/vNF/qL+rJOtlzKpixeR6zaeQ7y71a1 /wAKatPehiuotCsjXFLqW8gWaKJpHDoxlmf4lC8HU70ChVM3svKKIdWTyXqZlt0voHj9CQTsjRmK YpEJCJGmSBFRjuQRQ9RiqRXY8sGW6nuPy+1y5ZR9Ya0jgnaNzFWwlZCxj5ySQuSIyaSIvLZjuqrT 6d5M0nVdUvx5I8xahepMt6rpbs6NJFbxwJHAVlXmES5anKvxepQkjFU98v8AkTyHquky6ZJ5Xu9N trIG1FveNcIGWSL42gk9Xk6kTsvPZq174qmkH5UeSo767vGtJJpLqVZgrzScYmX6v/d8SpHxWUTf ESajrQkYqmHlnyF5T8rknQrAWZMQtyRJLJ+7V2kp+8d/23Yk9T3xVP8AFXYq8vhs/MVq/mrVNMst OvZ76YxW93cyss6LHEIhbtEqS0iWRWcEyLyLH4QKNk4Ak7IzkC7Y7c6X5M8k6V5f8waRdXEf6WSL lE5dmvYpY2lCJbV9ONlqOCxKtNgdsnjnw7tWSHFs9C03TtSvYBLJaSWL1I9G54h6Dv8AuzIu/wDr ZkfmIuN+Wku1q1t9F0qfVdUvIbSxtV53M8hbigJAHRSTUmnTB+Zin8tJ4v541fyN5xs9S8u6TMLS 9mtv0oms/VXS2mFualGYKs7lug/dmpI48jQGvJOEhs24scwd3hWueS/Meix+te2p+r7f6RGRIgr/ ADEfZ60+LMYgh2GXTZMe8hTMvyl88+foNT0PQfL1nHqH1G9e5it3+Csc4CTxvIx4Ip6qxFVbx6Ys IylRAe922pfW7a4thLJb37g3Hmq4mXhcW9WoLUpXv+zxJV6jieGWAu4w5YTojptGP6T+tZa6t/hW +TXUBjs3g/3JaQhHIWESvIl3I7lU9dS1RWnJGI/kAEg0a3DxXMdOZ7z3D3N+XfzP8t/mZcyi4uLb SvLWkzrLc6fqEkPrXzo4kt3dXNI4Y3QORvyagrQHlB1T1eKfTdUsS0MkN9Y3CshZCs0UiH4WXbkr A9DirzXT7KWwsbfTpY4430+NbMrEVKEWw9EMOOw5BOXHtWmQLttN9ARGLe7FXYqm/lX/AI6y/wCo 2EONq/oZha/7zRf6i/qyTrZcyqEAih6YsWGXP5W6VJp8Fla6pqdits0rwyW9wFcNLHwqWKE/C9JF 8HAPbFV2l/l3NaiI3nmXWb9oonhKSXR9Jw8UcQd4yH5Ooi5VLfaZmpviqhN+VFnLp9xYDzHr8VvP KZUEd8B6NXjfhDWMhUVofhFPhq1KVxVPNI8ryaYl2ia1qd19cne4Ju5kuDHzAHpwl4zwjFKqo6V+ WKqvl/y7+hllX9KX+o+qIwTqE/rlfTiSL4DxXjy4cm8WJPyVTfFXYq7FXYqxG28lyst80GqTQW2q MZJ4lSMvG9WqYXIov2juVJ9+lDGRHJOWIJ3R/ljyR5Z8sQiHRrARNHEIkuZXaaYxg1EXqys8gRey /ZHbGmNqXn3z9oPknRP0pq0n944htLdSA8szAkKCdlFFJZjsB70GBL5l1/zV54/OO8fR9Ls5rxnk DejGxSwsY1f4WLkKGbiN5JPiNSFG/HFWXzfkbc+StHstX1PXZtUuY7i3t3tVBjtI0ZWRBRizScZe HAniK9q0wjm5GkrxY33qzokiMjqHRgVZWFQQdiCDlr1kogijyS7y7o1n5ZNyum2yzWV7IJLy0chZ aqW4Nbz0rG0YchVaqt0ND8Qjw1ydYdDLEeLEd+493cye982+Wr2BI/MNsdTjhX0ormaOay1OAMR+ 7S5j+3UsNopWDHvgNOFlhj+rfFP3bfBg/wCZXkf8277TdRaa6gOkIh1WXS2uEbUTEqh1juFRFaVo F/2NQSN6ZAl188spAAnYPBoYnmmSFKc5GCLyIUVY0FSdhga3vPle41jyJ+XfmDTdT1e4tJLKSW6W ws24epJN6MNvWYKJvRmoSGidaENXcMMq0+ohmhxwNhyThEQTLmDy/SzX8rJZJfIGjSysXkkiZndj UljIxJJ98mXN0392GV4t7sVdiqb+Vf8AjrL/AKjYQ42r+hmFr/vNF/qL+rJOtlzKpixdirsVdirs VdirsVdirsVdiqHsP95I/p/4kcWeTmgtY81eX9EhWXWb6HTUYMVa5dUB4CpUNXiW478Qa0wkNYLw nzT+Y3lnzPqdu975Ot9Z1axju/0de3U8g0+W2hdhJII+Jb4ig4rJHsa0barGkWsh85edbjTbq006 W20O3024uobS00O0W3SR7WN+JKl5qq/GvBadB1ph4WPEl3mLzj54fTNR0+91mW/sYbma3lhuLe2M rG31iO2gmR0SIiRQQ3deSj4euGUdymEyKI5taX5jgmtIX1Ax2c8oPBi37iYAmjwSNQOrAcgPtU6j vhBeq0+ujKIM/ST38j7kzleFo6mUIp6OGp+OFuyThIfVXuKBtb+404Sa3FNBq8dnEzWZmkWJIZYQ 3KcvGGjd1dabqoWm1DWqDW/N1eu0uTLDiGS4D8dEPDqrR6u0iqG+qz6k2q6j9aP1uRbKG6W6lEcM 44vNBBJ++lhZlMnGMqqx1pdMwzzJ+VutS3LandaXd6Qszosttb6bMtrG8jBESFwfTClmCgs+571O Ksq1fQdI1TQdP8ualqST3Rt4/qWpq4uGsLv4Vaxu7iGsLB3pw+Kv7J+JVLanUYZaeZzYxcT9cf8A fDz7+9zMf7yPDLpyP6C9B8g6XdaT5Q0zTbtAlzaRmKZRUjkrtUgnqD1BzYY8sckRKJsFzMMTGIB5 sgyba7FXYqm/lX/jrL/qNhDjav6GYWv+80X+ov6sk62XMqmLF2KuxV2KuxV2KuxV2KuxV2KsVuvP Wg6Fzi1ky6fEkUksN3OAIJxEGd0iYM3xqoPwsFLUPGtDkuE0mchxF4prOoa/5+1a9vGSaaNYJzpO ksp4Qxy2mpRxsyK0iNJJ9XQ8yGbfiNskAK/Hm0km/wAeTP8ASfybhN+uo6k5UqupRSIgJf8AeXjt bsu7gqYXY02IqB7CJluzEdkg82+etJs7YWPlDTJdO1mVEmvtQeCJZIoWjMsZhcF4jNdLNy5pWgY8 qNTBuU1THta0CHTdEiurbznb65qV/Keemi9bmVuJYpwUcNJePwmiElFCnka7UwNmOr3/AB8mV/lv +Xd7eejdahZvZ6bp6iOxtriJ4PWmZSJJ/Qm5SrHHXjGr9SSeiqxtjIAt2tzccRjhtEe/+1k+ueT9 D0tBLFpdhJdSnjZj0YUaS4OyICR1ZiBl4yQIJoOqljmCBZYQv5dzw39r5c1KjJFZpc6rIkgZJeUk qxhEHDjzdOT/AAANxYdCAKcUOIufm1hjj4R1r7P1l57Ywmz1HW7J+T3506/e6b0o1iJn0yea5ZXd +bt6qyoahQoFN67UlrCG0a202LTZpNNs1s7cOzLdOqT3rmEmkiSOohh3FVMMSuP9+N1wgLbJLXyX 59isb7Vb21+vwzWzzpZW/wBTuzIhiV2VliubZnc8abQOafZ67oLfizGFgdXoPlX1v8O2AmmM7iID 1mbmzAEhSXIUt8NNz1ymOMQFRFB2eK+EWbTbJNjsVdiqceVFJ1Wo6LGxP4D+OEONqz6GX2v+80X+ ov6sk62XMqmLF2KuxV2KuxV2KuxV2KuxV2KvIvzQuYdT0/TNHgmjui2pRG6iB5embeVXWB0Rg1X5 ep8W1EywHYBGQeol6B5Q8n6T5Y0uOzsowZfTjjuLkgc5DGDSvgoLMQvapyBKgJ7gS8M84aLb2Osw 20Oh3GqXk0s9p+6uDDEEtwktr8Kxs7H6tOiFjIqgRmp2xVBaB5l8seUfMUGr3sMTolvPb3j2HrXa WokKP6n1iaXjIf3XBhBG3X7Z6YUPfwykAg7EVHywJeF/nfbzr+YGj3chcItgsumSAkejc2l16kjx /wArH1Ia+PEdsIQUm0KW9vfMx8zXF2Z9SSS00z15SD6sl/cJbw27cQKRqpeU8ehSvfeUZcJsMZR4 hRY7Gl95i81q37qwbU7DUEECpLc+jBco63BrGEZ5CL6U1ICj4dtqlNE3ytRYFc6RfmDyxfaTf3K6 RcrNp1wfVt1vI6D1pPVlnjV4xGBxMbfBwqtaZOcKO3JhCdjfmifJXlaC2vE03V9Nsbpb3UJBco9p EY1UWLFUi9QFl4tADUdeVe+SxR3osMstrDOfKNmtl5csbNWLLbxmNSaVorEAVAUGg2rTfMWXN3+m N4wnGBvdiraqzsFUFmY0CjcknFSaZr5f0g2FuXl/3plpzH8o7L/XJAOq1GbjO3IJja/7zRf6i/qw tMuZVMWLsVdirsVdirsVdirsVdirsVea2Ebx/mbYLdyR+lcW9/JbExxrWSNoFEAanJnaMmSrEn4D xoOWWSjQBYmVzkO56VlbJ2KvK/zU/R95rf6Bvb39HrqlnDJbXLuIovrNvJNSJmYcf3sLyfb+GqrX wJQw/TdK8v8AlzUYNW1mc6kbRxcWmmvNZySk29vPPMxit5DBVfTR4TJJ9oH4QBzyRF8mINDd7dHI 0skTNXdnIqewuUp92XEUD+P4WkGyPx/EHmv5kavpWq6j+gtcsriaGFYZLW5shD6yPKYo3IaV4uNT coCK7rU9RlJjvs3CewtjWn3XlfTV0y2soNTENldJq8Ua21tSW4JjRGmP11S7rxIp4s3foKKeIIGz ufIietZx6BdXl/MOay3yQR/3KicR+qLm+9FOMtD9XhB9xTYUU8QZn5a0+/162027lgSZoL+7bUCO h+siZnkCHorSuPh3p79cyYkUL6W4sgbNdaZwfIenvq0Oou1JIpFnYDqziBrcgnw4uemQObr1bBh2 roiY/KWltyAaVFViqqrCgA/1gx/HKDubc/HqJQiIhf8A4P0z/fs3/BJ/zTgpn+cn3BseUNMBqZJj 7Fl/guNL+cn5JhZaTp9mawQgP/vw/E33nGmieaUuZReFrUhbQAABKAdBU4suIt/V4f5fxOK8Rd9X h/l/E4rxF31eH+X8TivEXfV4f5fxOK8Rd9Xh/l/E4rxF31eH+X8TivEXfV4f5fxOK8Rd9Xh/l/E4 rxF31eH+X8TivEXfV4f5fxOK8RQ7aLpLFC1nExjcSoSgPGQHkHHg1d642i97RH1eH+X8TiniLvq8 P8v4nFeIoW60LRruRZLuyhuJFHFXlRXIHgCwO2+KLUl8seXEi9JNMtViqW9MQoFqY/SJpSn938H+ rt0xtbRwtLYdIwOvT3NTitoaTQ9GlkMktlC8hoC7IpNAQRuR2KL9ww2trf8ADug7f7j7fYcR+6Xo O3TptgtbWjy15eD8xptsHoRyESVoQAd6eCjFbRNvpenWyFLa3jgQmpWNQgJO9aLTFbVfq8P8v4nF PEV6IiCiig64oJtvFDsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVd irsVdirsVdirsVdir//Z uuid:6a50a775-7eb7-d748-bfa6-1511dc11f939 xmp.did:0259261c-b337-4a7e-9ce6-e1a2af748d90 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 xmp.iid:3c9305ad-67bb-4541-81f4-ac22866e412f xmp.did:3c9305ad-67bb-4541-81f4-ac22866e412f uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:9eeb8828-6dcd-4786-a099-ab23f428b955 2017-11-10T16:19:46+01:00 Adobe Illustrator CC 22.0 (Macintosh) / saved xmp.iid:0259261c-b337-4a7e-9ce6-e1a2af748d90 2017-11-10T16:34:05+01:00 Adobe Illustrator CC 22.0 (Macintosh) / Print False False 1 210.000000 297.000000 Millimeters TINESari TINE Sari Regular Type 1 001.000 False TINESar; TINE Sari.fam TINESari-Bold TINESari Bold Type 1 001.000 False TINESarBol; TINE Sari.fam bromello bromello Regular TrueType Version 1.000 False bromello.ttf Cyan Magenta Yellow Black PANTONE 707 C PANTONE 707 C 2 Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 PANTONE 707 C 2 SPOT 100.000000 LAB 80.784317 27 3 LETT SPOT 100.000000 CMYK 0.000000 89.999998 0.000000 0.000000 PANTONE 707 C SPOT 100.000000 LAB 80.784317 27 3 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 6 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 7 0 obj <>stream HWn#}W,}1b'F`%yWK)j-J9נN.g3wf7o.-Pl1Ř܏z(C5ٌףy1_ܹ!l^vO+C1,}3t2f7>,'6ُIwPVQ&=ٌ[8w7Ce`=wv47}r{t`LyZo_qy䝁ӻRKW0bi3F, Z3߼_u_x~o =zu;.U8O?Te{7V譣OEC} wvv۷I݃?<=(YnZÉ7 "Z0pHaU&:+"\-<7vySI@V;HH[^'FRۛP ])yjb5?xصyʫB[~mN8q7# xH7²ztUgLLq{VN?|x)z,3tyf̙ߛϻ~i"VI5r9r+\ Ԑ%$?W3j/Tj^հb3 ;X B! z숣NbI\,B @7PCc2)$lc;X0AߙQ:gC= !}' 4 L:ʐkK}N%9aNF1 uv2撶!`.SE|$J|pXP-Xj48+DzQf\p7`oXYdv`16)!vΠ\5ȱ Ӏ21 zH"_a"iS@04%q˼AuΡ{8'rs@{ey&`qmH8xRkOhM<;E=DRf4ǐL,d`Ӝb(*˃P T:lQ &GmX!\ MƱ|yXk05] , +}cj,GBN \.BZ F#ֳk@fF[f LMα]Z"<+[, MqJdXb+̣T'L2uPl93HE*ZC=.GM%}-6C(M"#щJeذuzGOt8bc˫I8gJՑDs_Y|'Z021^$\P'*xsNrKO]-a6xE6p"۷VY`'66X ZV(B}N1$s$-iM {SbIl!N'%26kaFKL_‘4=rX'9;κlP4a&Y)`﨩1J T>uCB$ ')AHAh4%k*ǡ,6 JMs,WvX-^+j'-sSШ)z4 )@T 2Sac ٰr*32`=+M}7U-K+C܀Y[˫x^PJSh|E"UejLWe|O*hXI?u+xBKEyjTڋqvo2&y9:cw+3o(}KV'ƴWva7];*Wχ6lݟz~7iSIuO}~9e1#+'&EN[#i`Z@b~trnj01E1&Es~%Mg<(7pkg}:OJպs~~W6u7XO5x8M^YNPrcS37Ur]7 H㙫P"b 4k5b%5.SHӛ!?cgEٟ$%5& ?Lkho#[G-3qoBM=>;j83$|CPFJ_#dbMMU aP^N凂vjE^mPgnyJ' :ɄFx=X1ڝ޾ɘ48]lRF|qX(LvMJ5i?"([MD Š/e鵒r+r[ʐt'47yKNs1 jT_dgWGӢ#x|%2dpdxRFuo$ х'a0AұΦx@x   ~pTc\\~C:6G ,MSs^dl陮#bgś6|Dc*NGe"D$m?w-%F'~ /]qG/!(窭k629謸#o%ec2k嫶 ]]R RɓQԙK5o3 M̴zD5qe4^Ǚͳ>YibޒT)>^h}}T2M;Ν]qذ Br °;/ms㹽G\{{=Vq5*69=rY%ul{<҈Q͝ee>\ܱ亀1 W254kBSp-&&r7 Gʼnn wwvgͫE(%8{\|$Sg 65T)Yr_S/G?S?V!Lœz:N]wr͖($ģ ߙzsH/<) 1[1NҌNP"g 1p1+0<ɀQBl,ڣZ4)x!qeJJ(ХGJiEld/UnvЬeUT՚--TX.>w+oRCWt6XO]j#mP_v XymFr4\LjWHGF}+a.=eq42)N{1jb`\j$p%MOu'"~J5X}k@A `ZMe-;dga"QC  '4}fhĘGh1IerD -|zSHI+g!=_ˢFi92R'uҿq. #Ϸa8K '1l:O&uQS}iH[R^xqGVaw鈵)>, lD?,K;{=Q|4Mp1qRY_[NE8*xR Y)d)Ts" MCC  7ͱsg+zLC:f`G,pB?ޖ˅zOʖ!oLmTjm# '!aƀ qZ1H9-UvK ƶ~Gǹkؐ$\FWWqqS%&Y~e]ZE:0\Us|gT./AeBsߐ ?.[[2&~䦔~C zBkļ#oeδr2"ũ{fw*smHnVz - 1+eU.OZŮ'mPm#\츕:*QT?nY'3:S-hZ۪Ii)o&0k*@7[W5|;DC _Z,aqiOތ;*7ֈ3_efO9!T#kr00JjAw bljIz v3Fyziߖ\Rni/&R d$DзqWp{Zլ;e8݂d=8[*;O^M o\mj, @T46+vhGZb M6oqh0oZ6ܛڤܺyNJ԰`7.)v{0K[]~xYak8qY]w١#FPG~(G |dN^氽h\M1VS諞N?PŦ9r(m0}ࡥ?P8|'?Ѭ&lTz$]}u]GBvO+^ Z{8EU6mnbQ Ra#;ML9V_xvctyZ<Q#nNĵsoB3rk%5ͦ?եtSr>$m{'ŅVbYc1 AqLYUøj:) 2UxR@=^S?oΓPA{{0Tt_ϧV⯟gĩSRVh*d*]| EDDޑتx:&hDj1~q[ݶSx]@ؑO8z{ 7GB {OO[FwagzG\?^Ώ{ʔ͛NJv˽K3r^5݀"ckў>pz5lLDeP@IF:V P_ӻ#M颁]R\/ 08jسs1}L4qX=3U<0B?] T_K?JB95ٟ PQ_wXwҰ݊2)\>mnX7}6uݬٜȠ5Vopy \7xD &%k_+_3|87LIī0 /1Jⲉk^h1ddN(r]bjThjf$w V՘ç\k:^N]=rR)vIxl>MTCPf~*>ib )1Mնxxmsl3bJop3Y+{o)5r#՛>*z 7Վ#Ͽ 7z:BSe|F`3a7 Iܘ$R23 n%4Nq}yFiXk꼽6 )^;^i8~>V |?_x|ay1[O_Tc]V{ӚT+Kobg Ϟq/H쨠Fܵ(ns%~1A֢{gF;˯'G (H#˩Rw:ȟ%]q?4d &tֱrAC2s(2MG8xR%2c4r*#ѳ'=UAfgܷIaش7 >\HX.=|$ _;Tֺ宸ccb;r}vSA$`'˪20W3lZ2bkS[ ח\N|FZr'J.VTlf_K UbL'VjbKq(޸4}wȰ#`G\aX'6Z#)ڷ kIk3>͔Ȇ*ut"g ef(:Nݫ|^uƙQ6a5(a=mi>>(͝S5vp+fTI)C}<p׭/YիxFI&ٯg_jA>A%ex'k3d3HȌkq=N5e=k9 *CL爪Ȉz!f8?6_`Pm*VďK5Y^l '80'1- >N"f^\'NF!Azv@nt[ߵ7.K(MR| :6[|Aiv5$ga3%,+LEmhd$nRyC#n++bBAFS g}=CI~hpscM{>:vG%k|Zlm蝧gtjuTHpEnU?{ԦNF%KewSVA6?"~r= ͟XU&-5֕aVysƼҵg^w, -ig Kĕ'0] s[D*ñBIl7+%`=h+fp?l;T7{ `U FYsN'[U!,R(&L%#AT9Pk  H*@?Yb@V]WzƷ@''V\8U3KfVԐhÙuBAigi }% ՜⇪s365o@)p)]=jj|T ԣgy,_-1c'X@g$l7ha-0+5Nc ӂ>vJKVW(B9JQ"jf݉S3ZA*zo"Ou BzhITO} dL.Q }E3Jl<@",U # 4W\:YI7seZ0}?C" N8JM.PŊ&AUG u /$*1T;pIy4` TS7, dV%#UլsF=QyUHwmEV#BNqJ:q2GԌX-JJlO, Dzu)a*|5jҟ7Cwa>-eUURՀ^#16="Z#\jl}JawtGl#_Yx<.3{wA?nV! CX՜f L+M}T"9qz!@]UڬEQQW n(NmYs&_këo{J^LGbX~,@/ 0 7O 7ۚbԳw)^5/J?.uFheqN^FTB5yElDzNr>O+2G[qXDP@$]}q =4?.!-[Z bOqbm1gW3ѽx\{MAŐD F}Q铮Io}CTij?Y/h%lK/B-YY`E#nK34(sGbeo{h5)gސmռkӺLkiqѪQ|u>I5)DOOҵ$3Yv%iY8JkfNnhpE_ꂅI 7j"Svٳ‘+<#O`Ge;cjXVJ/W6sqL*ɰHWSS[ a5먇@G`<5.6&=520bͨtZXḊi7k <pϋKe`2SHTle7gxݡ#7ׄ_WbV뢋z,yr⑛ ce`cb,[zoluGsEPTrw͡gMalUzyGy]^&'¾މ~e% O=HՕbmH74qۨ[{g1F.;7LճzU瓬ix/-a4z_վk$9Ehq?L$6W3,+W>#{]p9np;C>kL/ V9Si3L R:MpW! 2|}qX~n*@Wdܼ,A Ujj|m9)][j{$KdNa{+~cDK`oi2nUn\+%kf9Q6#~j ;;oSɽb` kT+ C`󋡦ee̒TO`;!&&uy9fFg7/27iFiV'y*fت> /]V\PyQ|/\2(݃"dַQΗ U55EW'3Rwh;LjyK*eSL7Č6ÙB#芽׎g+<1kGau! u}0ҫM9к=m(v@%ylHqâ1pȻ`N#_4j||LjTZȀ~c.8" ٕ:)dRd5# 傿0b ^v芮;{UEfNlN7skq<]Y&1z3bAݬki/a4ٯnQ?Z7Qjʊf&J-8^tt05BlfZ%XUF՟ ݆5"2P~=85 cz 58ξ2Upt>vi&3suUiid εl5B:\^a<*>kPfG`*Te]y`2&ˊ~ͣTOfT`ݝϦrOJ"u2ܕ> (#g'H-f56JW>HUD@V@V=eUXfW{`iPGRga]8zOU]óga;C8V-w.RɭQg`- U<"Jwlr> .-N#A5Z0#(:MZb d*}6 Xi,v +i{4F.j32QH$C*^,h>R~ۇՋSm0ӳpNH+N a]].wޠ$ѭǵ&ʌ7wݜ50VX?=%}?}3SX_1S%Hhߺ|='$Ս0C՟7Xnqqy6{R67әZ5#-oηyMgx("DB=9g(Q }gR&|L,k-zRu7 ,f{D%^52*ޢi֯cGAWOM7{)ҩ`34HIT#ګV=5]An;zpY!=R@KyvWpLKETbq 8kqogviAd7;c7 ع‘ 7<8IxGBڗSyϢzsh:Ѳ>OKi8B 2X=u.%o<_V2+s:w/a 4.n=51"Gms 1FQ!LА*TH^`j#Y?aW0p8@9.kkO_a\Z'uݼ85\6>}Bi)fBlh^ +~t#jx8 ;^pCdޢF5.>i[BD>2#h`-tc''>S-L="!Zb}V7B=i`fSRԿ4Ukk{"5| ]GvѳOzƆK̟YfG/LGg鶰ߜd |QRW3Ϗno~_z Ņn W$Ƿ{ȫ߂o!;s:i7!,O#ca5?g0t ,v=J4H|F=iЀܬzq̴|g`r}v`Eq1M7ut!6IDz)|t{}]zYmB[_ ,[Gvr=T8| :KOM H4U #"$\H֞Q_ ^m!Q6.1Sar6Q?jNCCDK=:,ruIJJKz6+u1J^ mBDG^d)a;#txa0(RofB]K[헱^# xWa=mWN%]UAj(wFBuNɅJpF2QAez9Sz桧88 *--uK:ٯc#w2h] G-<ԙ⮖t[ND`;bDW(ƅ96(YDaJ|҇=:AMvWxUlh( (-{Ħr0WEB܎L\:D80; Bޡ7x2 K"E㘅:}̭'szJ-Lc3Q4g?DXl ܏HͳkNi^Otz %4]zhE74”zq[^snQQfY0s#LjVf&X2Aۦgpaѓl|"zq< U0Evꁃ,m%;ͳJbN5D!DFf ȋFPcXϙ~ݲtAt#hSo5 uuҢ AҺRZ4*QZom"M3U#SII˼45i=K?g͊G,û=?.Y忔HI)eu]{ţB9)mYM_Q&FC],Q X鵷Vnw|{ DSyPgub߲4ޤRѸ ̦su_{T#uμ`A|uGӶEci;//jj'=qG[y)́ʬPwӎ< W\oU-uOBaou6VuB5@7Q3z62Aco6Wy(RӪlaj=4 Q FHy{HPY%DQtu;!z˿i|YvTa|1H v Wyfq/z`]ghoE&{ ؟F3 Y>is鞀~oDyM\xmZUƬg0+hʁ,6I(K+ު([pc.:D yKc- 2n< g6Tq= +0AO=Ӏ@!5J,i x`P(2aE/$'BDmA6J9\\6`h9//br[mpyt<{)_~q8iخ+XJU[OVC֖.7˔(UMOjB iTSG煹-DlbϬB^a< J\Vqh]pKe#e@R[ Ltjfgww,lbW6w`9t'c9٫Iy' &zI%XFgsI+up~hkiu8uyG\2 j6hO?71\n%5ȖDZcC6.B/GAgAȵf25f 0B]oZєꪑG*Y" GUsQ[SzY{>,сö1DK)!( z2U>װL"8(0I[0ԍzG TAP()$7JlΠYχ,4Ο%ۈz+Mʝ5ˢ*@F(zsz%],h %z3̲RmyuRbmYbb>ۭhZ44x>?V" b;RSuDN2 x r+^"E-o;ζ A59E߅>dȠn eB*]^bQLTdeFC,&ѼFѴ/֜lIxetk0 5?^vϧe'Zǀ;QT [uFM'Mrxʃ3fx-OdM#FF92',}! ݝ#S!Ҕx:kzY«F[]}n7|m@7*|'tmE\d$OD%ӽ =H;]ST,# pf@O:8-}/\J(]˖ExʼmUS?":\?^U$x|M^$٪ ugGDP_B;{1cY榺a?gd@?1{퓏=xNEY//}l=6qrVtji#?5\|(! $TBY+jj$j\g6#0?F'4wӊb3(aQFm\Lh?CAnfam.v~'V>#yj@PTL<=J aވM~}T1_ Y{W CخP>'M ^qKקiA*[ڗVPS8j+ Q8.na˩D|)PEB_T%m9ٴUI W7 AF4Chp$ kH0- EEzfMbc+ 』 S0[1Ý2ovx=p$M+gII(#V\^;̟/T nIq;4 ԣG ?ıV{}m3 IC,x&wOU.7 ԜR3s8=gExL eߚ#o_ nwߛ͖%R'xHWd՛=11K}\i0R#-+|UQzFmHIMJ23_H9qaK ioZ4PBsCÆhBC'}1^ZVJ0Q$4 4~Vðw||{+:I2 U=u;lv!n3G,%IUU/VoY\Fn DĊ@;) > 3YHoZ@c7 R{ 5 &;;άS= cO7'=iXmЈ=]&-rZqcQØ @X9@N>M f*wPZRn_z#] ƻAf؁FͰ.#+cĪI{]Ѯ o3/ {?+ܻ9x#@67R^&S۵FRU6 O Ѯ~'̎);-&Yo,* ]T*[Ow$^uFn7H7Q]EĮZbY>>W޼dc xcSXt1S="޸ UlMt5 ;Uu+Uk Zt P\Md(=N@q+$a%ѧOoJ{u fZYINqB(:xk_36?K Q_`Qӷ| X4tE'vm9h1(tbQg}ވWT ZK{X2~Gy¨XF›X{m`|-\f)|.m}*㤈'X֥dۓidžEEuZTxD:\,j>Ddju+ v:2[/zO @BMvKkr˴S$Ӑ]ںSm;0C>*sQzsDLׂS@m0?o! zRlҐg>먲@M+֜IɃkbH"]Y3f\"]̊2z7P,XBė| ` .A${0-/ MFbFrepa5AmSjmU _ 6V,Iz3۲9|f/FitbQ|h|t)7H}deBnbWWe Cߘ!ADUQ.JmzSMKЍ+|{!ޭ:4O3t/ y;]*Qw;n*nXxHqyxqZ,H>HQ;uD7v*َvwU}X}ۨ'Ų7 ϖ6XO\һ&LmĀ (m*WMIQ= *'bU[^$#PaʸNݛb^ͦ섦 ] )Ci"Ӛ]YN!gt!fɏG:҉r?*U2u^V{1F]T{? frz02GzGR/ ))ȳzÆzJp qn)6:in0 3&8-b [ XNeȰVֶ3\p-߯G>ۿ;6r2tӘbi#ŏ=d5az@ZM 7 }sD!PR6 Fg pu%NWi ٔjTOUva 3\e(ҹ:M M}9H Xel* &2LN~ξ 9&Cp3qhCV/[ /[GRr Ł]1LQ614yKAӀcɅh$Vx A:&?w<~tV@,H>ۀXV{E0ck ' V0X&7s:zIln˛2a[C+FL8#z DapnPH`UᏑɕ_-g?%j_IZ??q9J_>-C>,W"Vxtf6܊3ljΩȚP\ڣƱTl50[\X(>Eb:FrxVƼ90h'Ʋ4pH1Z/4$D`r G얺S0X6{ qkU\ݽ[jrٍt=^U[ޑheR@b#eB_q{fO{U~*YG6R+u*X:.B% fSCd^t(?AjxAbX2-'K*{6VZU;xFpF;r#ښ1CP)\/H Sԫl+ҎNotQ[T; 'X {aw0fԓ~n7=v ؼe42^f*Bb5Z*,G=[!Ej@VNNf$蹲6.8\' o:P$R25OHH&(c(]7@LqT?#9CE>sz~8REf.w7'ݎ)ʒu2H4G:6`ƣyI\ƨ? +d)4a)C+bZJiiq\ਔz5/F v6\9g3s/"e_sPAs5~:)P$i+^_eb YYyWQEԸtɆYh|*qI!ĉ2=ejMxssL_XE#Ϭi憥ѐCgKVi"%8U[R;;a ּ‘1WBܖ3a`m,_"(&Rc<] %iU*Ty8'׮q_~lEw tt510ūV Ї,WlFޓ, Ng(m0'Rg74CE2FR ?t(EHl{鷼P){zj^pB˵ 'B܊8Q~(Su0UDqT-z(z"Z&kX/ryQډY|:Kê;R粞Ȫ! hO۰JհkW+FkAP<6#\yfWQ6z|5=ґv\{xꓕVVZr&CCm9?͸Y/ڍT+Aİv+ 5)E'D3]'  \yMQP vq`A$h1Kx$#AtS!yz ln?/@ٔd&;I"l\t3܅ΓVD>*yR0INh)d0Gn-'%<3qjTūm3ozI}ש+$bb&76oZ zf:MJˣ'? P-]sFoO4~ʌnf!*%Xi}w Y ۫hUxAGueeRˬi.aP|hkiY}]NmM`ӓEx ;SZtfQ]E҈γH"ܛU;x]iG%ݡ=(UbuD'ҠS.iwSaBJw<~`{>Ci*9+hx̗[K6BeJnuyyz5պ,zm/NxJݝt *V46O3O\7A}A핫 jQ'<~fo`a8r4vϥ$kG}LCp?̥Dkf[{-P:R5{5c9=fW{E  h/L]wm'7[n[nD )oZ=ETcD_H8vҼ!ξg wlr:* ]%DQuS:)o0 K 2v ʟ@Lh}(&Gi;0>{EM 7Nopfc#g}N=/;n?~K~P1k֞jVD( RW IV*5d"Z&2r =-B*^zC$=XGkzPܸame_gAw O;ey=V!` L f'5DZդA3usz<8ٛ*`/sp"c˃Lb*Kg6(jP9mDGBaUSd3Yi5;w1I{)rU}?\X+MQRմbZ fEi1|Myt.|î_A݁0Q^옙*.O BKnc^ʏo:ԙ1eIOVtNX_H-чG/Zڕh zLcQ\&f= |ʔAX:p"=ROij*fr_X6Xݥ1ĕ!&# :Vk"`vW}hqK)/1fv WiA3/VJd0&iK%cecWˍ}C)[P 5H]i`NǗXv>܎IN?{+ʂy6mjxۊ/ˏ~ƇMnAQIdQ|`咊U;dJke"6a` #o6ߨ;Ҍy\1b1O ;aQ_s q qrZIuk!øq̝Br70r5YREVgv&G5CR۠5 {5߻3$A۴tʏl.lݰurr`z3_?fg)VGd=@@b-zC_6&3LUkl G+‡i:Ǎu]?+je9g#UMDwq́FwEXwm=@;W'{5c7f$ YYtd0+=#IVրT3D򐂳x*90qoe1qc@;psrL(|% -SY#⮒6X?zw {m/ ;lr;|;ʞ[۵,9>&-OXF"?a oӹmܳ|ْ hn2F*W-A'9eӷ Df7RDtoC1-X26qh;1@m܍&|.+P骍=Շ7{^pgH9ͷi,ܖB=Hg7#qi: ѽO O870:eTlLPQ pΚiF~7ve۽IfToH >WWG5=t>lh7dn$WGLM;#}{Ӥ~vbnrv7.S3k*%Juobk\F;a2]Lg/fVbX.s߈*,6\>;ݙ4zdr/N?ۧ[SmypKlyhg6Lg?ѰM+-[sŎSשv/['wtlmJ9my9ĺ;=mv'PQ=zZ:+ Ο (Pn'Ua3{΢Ce/jPi5^)BgxZw65hAt4j^yjcg"* Qӣgyb-a.Ew(CȗVwni(ynYcVŐJ0< -p~3EӖf$GoIvj(t"f;ȼ 2d2I{]+%n~JʘO 6-ͧ0a d,ǔmSi޳9))arS:fjSmoj-{Z[s6V?&gsvɰ,ƨ\J{Xwl LXWhcKԵārzᩢu{䬞#9s-\}wcRdj$EPx֤P}oe=gwwPNCR)6f usD3yV>,fxD!|tZB;bƨcP"wOeᤙvh B ݕ%=2jY :X)`)s&_kݰIkHZ˘ͦQݻP1­P3PGx(4EGf-[npUI:r)1LUZiʽıħStej'vsX{p W؋czruቁ˥e,3k㩫t CCO}/⁊MXvax1Je.ѾB[Y>.ʙPT >͵X*F  y}K2gli NX@P6oLh[cCT v|]5~Cj6Hƣwbal/ւ;`oԎQ-y4Vg^֔4slWkTT- I#O\rQMӄ+\4W s(Mص1pqRhc>?S-(2\c'ZGl6zl߬ y5mvA4zy׵gqnTˀ% 50oF Nlf3}GAtbl&1+bԥj3A$y'}vz3Oa+v0sUUn^7!nMK U6B;&aƭy=-Wi{iac[6C1z))k#_jZ->ex;.«sHi OxxHQom,j-CC#P\jn4fնϥq}D!t13U~sB,LM`G \x\Зldׯ>&Q鍏<ʘyֿy tǓn%TL>5eN29Voc,cLErY^a곂9Ê{/> Gf5\D U\ ::.'&aaUR Ïe_U8BնWQohBP}z [A]ıҘ)QMڐT軺֛;+ c21^Q!K"g4x+[1JB8aeVxB7&^K&-흀agY8S?5[85ng4jjRQpϼvf[3(\ 3R46: Gu3A'Em9޷բFFʤmxEtȧaTn231*u{FRQ:/V)A9V}B*j~S*a$P~z=6#m 5ӠԪ@/8n y _`@os{ˆ#FhG $?J01:NqKư 74H9C;j.b$3g`,"Νh7lΑO}qni˴(Yűt޶qI+^&2m'pf'8A 96ɱdIvMA"͖ ' w3~6oZ2>bnn~1~:GdK <{ZtD 2zM{ ii,m  iv ҶGs z ;Zڢm9Q-$%3VOP}]j4=D''^L] QLf/B;e#;s/UӋ{ɹzsu?k\exH+.ww6]VLj}kAPϴԽDu괝ԭĪ«`;t};f6bầ kΣAqtj)i ? NVCc~ 2Ɔ]3l6XӴ͉2ŷO/ёrlov q{%LKŶۨa/HQ{IÚ2q9oj~,ydHkhО`mԩ- ِ\4}[pI藅Cli9^m46ޤL}re2YI:65H횶}b]-_h~lj;!0c2N^װҡ+d V@OdtOh],RSu4SpM{۽lH~ q:'F&Z":kMk[05nӖ'.N1V릘*~_<Pqzs>fI ڢ/sup54ND/ci'7k}3@B.EV#QptE};#GI ӣ-cƑ]V dr_B' M?l'xȘ\A\8o`a8 k"ĚuFLLD , j]7t.[V{FA7+ l8lSx8 m"u+P5,ˁb2Spyr!b^Ҧdu1nb#ީu)ilPLl%*uGaȞ*d&̄xmjaJ G6?]<&omvᡅUϛ>amͭnAȰ8Ӡd9N|mKO;#3J4}o oUL$D kSo#[O:KZ,*I͈<.bHth呮~銞OTw[AȰR)EPqZnҾ>sG}ÁQN~a>BgL<>RqTyuUVCǢ$3uB%fTS">޶r 2H.ƚa$/Z&EP#ag48ඞ int=>i+ k&Tk: &z4;zPj9%l&V@N|iPx6+턝26E?}A[fb#'M{\&p6)\ֺ_XMnPCponxk\ -3F79{-l߱Q^=da ocUxݫCŗOL%)ءeBd*79q!v!I7x mo$!R> XKJHee6y Ş&'/^׃`seK~ce |9CUFUm-iaaisHk" َ!in\!LvQ'80jyA! ']$L[7[21ǔ(Ve%[50XA։7op, -IH)-{?|x]L.ch{nJM7#wƫl %~0\ʄs(WRo=@W̃̑- ~DkJKj#ccw> ~]!.N!o[Yz?gz4"pHD3"vgBt,w-+ XR/_AǑ+\L~BL3/i+ħMi`Z `9CVbyoYBk{ruӣ*N`}Ԟ(?_y /CR`(N!;A6 ҨQxϏG$KZ$qh=s&PZ>ɠkCj!-tH(>BpN,_` Ƙ_!0ancI"$W(3OCz 7sx_Cq#Lja%Ps%&GGa+V)2>v r1=V!d̃&}E)gGZaU\H>Ljj.{V`RPE-A 1J@C1IB$qFh'F 5R1K[Gn&γB^hUb(e rlTe{vus?_Y}eZ|^aJŐE4+9⒙Έ5]C\Jb0%&*pe 硰E˿T|IVl'b/̯ ln*/w=7hwT_aB"sHyk9 s5zoH\g4v%{BKXa|[bH٘xJXM2wR܃/`QE*OIe=|Ch4zjW)A]*/?HTMtL&c+U@Zf"X#$s4uoƑ4:Yi}U2E> 8'`fy9y9m"'~ʀm9 W.;t|xV Oc d;T3N?r昿8}?N=oCulk,{ͫ>/YV 469(-k=+OJvXKd1~'W(VYEk~~y`vJ8*sMl;!6k]/%0=!t|8w|3h/\KaKT%(gH|7rqDc"k2h*]6[*bGlb2L]*9 doJ -^BbLDc@,ReFoQ0ZyvQop6R?iL+rZ;յAs<[qm S|]g%kjxcѦ/*! u*h~,n;iθ-=#CrYtK*N\>jVA,̠,%0<>:G Mwcd>7P?yxP+Q0_¿ߣ'z2LtegywK-H 8͟54_zmL10u+ CYNoPϷ| y?حAeG8)\l.l}Dz)ZQ#E ZTF}N {FVBc* FB/ڦO!FqqOeԣ)Iݹ96d<4^=1)oHn9]6{ܠy¾y%n[vJm*nLY H'L1oa=J<._:Dmm~0B1Z:0ٞIL.4g6ޞFҺss @u;:]y㭅X N<(٧]"k'J 8sfq3t4dh-yBKs׏ 3 `<բ"Z7Wq8KĞn :kiZjp^ aaР0YhX1fVv1QY,z8{a~BjX_gA;PAs#Lc,7nqUb[8`2y-[Lu` j.r+ {Pn}6uؘ:L WdGj¬p\l\ FQt삃P~L ӊ_B>Mv.{DYʇ9ߍ8'mD.5"RTI`Q"?sPQkɴ1#T[uY:VK#+i\.r/Lx _VKMUv`;^{%;+}֦0A[K]x W)5)|Y$y' $ J".A 1oZ2!5(tV/̨ ԮwG?!. Ԍ&- .@{?4$*#yÈ%4"xαɢ]_6BccpJ*q8)^8)׷NYbN!G'-Gtw=al[ hJ`=@oQbG/ޣb\NNSMxl𸄛t98u : ,^6Xrz6yh#9v kGBâ݊ b/][i8EV0p;pS#|DTzpJ['23 cFxmu kKJ^F&bao_5R!6\GJfAv$gQiCFW} k[ ՞!ٷj8ak:AQ" ڏzjH|WY@pZHc(g.t](fMoCʲM 8(b%NH1gX_?1Z_ӓ0wд?\ {̟U`??[B[5X[onj!m'ʖ- kǵi¢)+kKSY+)|c"i{2D#dϔ.]s㔲=KCXXgA2 2( F xFHsY٧,Xt"啊#^rv)a4cԤx_ &;]Apj7Ob2{?i3~BdC=8l=Ũ]җ"lBzŝKF /jѕ^w)mxĥrԉ񾆠 J7&a)C˻GCQ쒧ABc+dR6-s A(/v0DD7  0; @DMkhX "pH7iG4}DHfr3WK-ގow.@ PHnTQ,$9$ 聆n25T޽:6RѧSaPukeġw#QB==8G1sk:^"8{ jT-^LU]\ JK.f%h_|bjIl}Pꪬ^Mھsa}MNZ.eoDMI&<緖WtlxvxojN$ d%% !g!,T_+Bdl!& Oo?d>ȝxTEA=HNfc|Qآ0W k2ǢЙ U. }i89 s/Rz9~q&  X@0NҸk#`@#PlP4:njwZgD+? A!e7y1F5cP(֐6_,bA ;' gś@h,P@hQ)zKܿ80M!_O08jۇDL)%$;8TЦfqڊB(и4y d-w =V[h(!_̀ӧ!½Jێ]w\[Z+ =ӦX;D3PBb-;'pq77둋Ҝqc9{},?[g fVԲo6e@J~tz‡T̺4\ _!2WuhBo~8<<;;FWLʺWex1a*H4O5Α -QLFkZX^h! 5bwSF`yYXFwsv<\JOAKo iUQI]d<'i:³׏Ѣ?[, ߗX+@Hj{9:fхX#Z\Opr/λ~AȖuA7Zk,RLl_a8ċ. HG0 lM{ W\(LfԿT^h<%EWu$z\l:?c߭h\/м>vjZfX+zN1>J海SU\I  xE<{{~C^T.͓đlZWn2&_ƨBfW݁2w4%2[;-:އl/= իb?)}Wںr}q.|@ߦ^ޖZ,O *؇:,w$E؝`PZzXReRr!@$peJccsqGQ /{ N]B5>X6?w˻n_Mi+dh>gf8۬JɮMDg%P_~$5}iU%eizclpt6ꋩ]-*4tEx*жB&fW֑+[іuN!&#0kJ5\K"GircSfX+GǽbjUrzid’hJQFǍ^bWI|>x2?B/RjWúYUAtKfy`ie'ם.!({xU@ݎ|d`KC9: ^/Qr!Mڰ6ddXr|gko2W>*Bv:3}0 [2;5:{-4_c&mI.og+bPK縉t|8g~ $b _M m^_vC S n%IM?( _rqM؜T S,%cYm_H^ˤO'^Z ɈZGZ2j_%3 /&.#sר2b{2^AC? YjK6@<9= "rmlz hPtC0iU &zR;3zX#:1'n)iʆIq{t^6we2]!Si3^KM_}Drw?_oS=;0hy6[+ov1Mˉ`;z;XUv[I7:W-ͫetYS[Q[yiQ٫G(KАUPLU;\&H<_%WCzFit{0!142k/hS8@#~ 1rYf OӉ&E.J`BOWz ,4X-Jl1 46Yr-M׎()>9 dM(P<]% 0A8cRd1|6 ,]tAz',AL]U a02hoř,C%-e:bUϡ1~J"VkGQEZʶ_IXf.fRo66+9oۭ=S9$G gcs L^PM) #kbktp@,c˸fÝק$eZRoS*+nʥ?ݵ2t`he\=ԖY?%Š4L6"o&볋ޛf J]޿=bZ&֏;$tk.nݷ#zQSǭFZswNQZ tYl'p]w8>SWѶ&|XMBxLɁPZo[{շÔ!vOd=d(2ń0g"ZփXUcï9S1DH`A3΄:\!: ;<nQ)# S'0^yK(5(TƗ~/8fUM3dSEޘt͙yH'-]t٨mO-b&PCԺ"})VW̎WїpQqǎkup`Zك1]@!%D-6hpuJ:}iP"SFyiJ7CcG î0vsoU%Gإ;3礸%0۴vn6eܦ.ue! bqwSN$=F_@!4FGhr# ?x1\M`18 Q&2&b+FYA8Vo,G{pAtӔRS*Iǁ_DA{86ߏ/`eu2(p"_&>޵+ h亾p?PO]2t& }'283? <>7=^Oa)iRD)koQ4EdJE([eɏeяZ)l~Ʈe;٣+f -uʱ${e|NFLut9.jl{ G%oa) oъD@ ע`f||y9Q$%^˼D}]#k &ʠx8v9 15i#c:0="e^]^\ԭ܏Sjtٗt_A<0}qS՜/:!DU#tl`; >DHVVX+Tyu+&bs߇b%Bp4!ƑVK⩄ʝKR0EEъ)sN(oߺ]QgwQz^1p8z6Y^J0 8I!5iX( JԴ*[y Pdٌɷ=0n\Uda,DZ^/;n*å )@pz&z$eױvw)$PGa{e*4wlF4J9kr"$~SfD)Ns$cK3N ,><_Uz)Y!Sd 1͔X(bĕԵ9rYAwmpq8z=%I.i:( -Kj qj/˴Ϗ jM12BVo7϶ z3V032idۢD;qZEte$pq1%]I:UywЁ4d" E6k3KV~2Bh~H^) [2L=eigGOBܑQ'AkI~\y$k6.A3H/4Tܶ#g-EJFU6_8-y\*f3cvb%9g8-eע0B99V[Ze=)Ij3^d`ԙO&@:LasۍwWR B9Tn6XE-;:[ib-K1)3*:p}U@h]/}Ƅ5S.hQ.i&tƴ|?Ժ4ݞ7oFa50uCm^[gcJ# 0e}8:^TN?7l)to; /qdoOGMۖ LM[]ѱ:SssJz|B`6S vRz#K$X'E!i/ Ww i+4:y֡t\N=4&$N}\m~W[]:GOeD:&A$+f~:`7jK1fhomC+e78ܕ}йeh|%?^QRZ}_kD'՞ҁ5-݇nu w8գI>M&0kCɦrf$KNW9& dE)Z;KKE rVL^¯*ٴ8AYlhѰ煙zg-0BHl3 .OL>ʁ_/aֳ'j!/ux߄]ϳp~IGf<`K'w:.g9-58$kw'Wۗ>֑)-CwMM˷=)݆4Gs=G N?y<#1R?s8we1>9@ uu{Qleآ.PWB] % ]滑@lQ-ѮAE~eO{nXzP#9 J0ή4ikyB"BpUmD0 'Kρ~e$(PnNy4x@5腟r`?qv<w9D k֌ Ê<\w`{FDnbDOLW5Ƹh;2auX@'WRxi~tԺ6WE|IxB?_zj`2)i~YCIg\)N5Ps;ԏb毜tϘ-C˝5GVXGGNw 6/8+ +_rϸ{zSux9NF>S@AEd+ -k}jo:(v*0] =P%Q-#pX9n`2sc>xs'Y @|^+Kq2v1hIvp٪ͪZT{ )un牞*UZ.>HAVLJvue* u*샧ymaJ H1D BY2"H1|VPMr!GAD1{zSatM  h#MEe-ɧK>ټs "Tz.K8˚χXZ9Z^FJ=ĄM\4T4 P*YC񼭯N\J@.|yD3vuXo "㡵耧-*o$Lj d$BO5Ԃ=~t`;(KWuoL8ExFox.TOdtUѭMNLp-h;B(>w~Z\ %Av P aZG(<̞^1h8rKj9?JkJ- $K+ TzV5#jn )RPOG  6pL AkU^(b.\Npb.V$ Ԋ?(ENMITl7'/b,A}x1>#w@0+RNa{f]ψ%CM{ũtB"ŠbHug f{MYn$U =YG wLkUţeLjU+v݀X?t&_MeP* zrדbU&+a"%cұFNaSL(D1x/TCws,?$׎܈sBcY`5/BIvԩÂj܃Q\6@s<#iuơ+?ul"1i&tEN?2-S TFՈhm`x5Y^])z]u *SwnP t߶:j2;] r^a!+4޻MkJD $ ym4@UҬ/'p=sX-ZkcVgj.u^5Bשՙus}Hn(Pt}0TY7RqZhV@*77C^-3$pbTc%+gh D'u[܆~Ocե gmEWY1ΙbA47ޱ{4G=j p 'kfQYHq87ht%IJegIގH'~XX_;JW_:Tڹdkd&=yyJ-'w~Ą-Һ/v$9eV̲h{ϛ\2XW6|%N\&QѐNG6<{ i`99%fT,S"ƍ`Ң:\EeN$hŲYL}w1OP)JU~T7cVf=b[Ra6V1t9X%\p*prhjAYFsk=f11ս,o=OwYgxXc+fm;J9iXuF攨|GhIcMJQ-jcyu.SoVX6]%Tlܒ^(މjj1{-p"S": QGɵXDi=~X4M9h0aiˏ`-(S+,?x;A ~P y1"yhߕCUYLWE 3^Nyg_mY*A#Sn1}5Fa䖧Qme맛x䄲ݢ P&Я껁rW0yaǞks>,kЙM?'.lmnJF拇k.?VQ5S˲r{ -ʳ=VWG|*jNO;\|k|yƅ]tZأZ,]!Q( Ą%1@"&u)4M 3G >}Ax"ׄn_ٿb~chyZhRs]=\@T>M[3op֭1YnERrGtvY6.w$wf}c4WW }D]V{$iuKLǥ{dqmHu;JǩG|TFюu\v; XG\ͶJäXO?]|/N9/zTZM.18]hܳ iRCzLua,UC̮io59Ώ+αn!zNw2rxLkS"[vCnt~Bu01Ayꁪvpψk6ՒR5}UU01lVŞ<ό)x!;R~aJWPLD$57̎ }'8L8o+G{E\j`#buf3'?[TYZ:sW`nƯNA6^c4lqhgD˩^ ׶gB | ڞ[PJܙIm ; 'KR̬!FXML/ {<\!Ylu5(Ղ㈠OO\%9!ABBvM}%Q-I{DWqq*}`ջXe,6bnfļ3mtw26:y_6]`Ϭ[Pmٽc+)Fݚ]|/8udgǭͲࠩKİWg8Wte676Ĵ|^^oSMېrّ^ 6' 8m%32H[w+*L@;2g),޸vceAFnL礋c>|%  >/%チ_ӎ-!ߢ48O2'wE +Ck{_ˊ `LؕR.VP6HOOr]oƒ2p#xC>%BtgnHmPXf~#a-_McN}Rgt!+IX]{@i%dI#Kr#iݖmstos*W+Vl??g8ho%!}qtBDzaNk9nWRž lߢ9ƩlM7[->#n_~~w Y/$t|ʱʘo{MwcfBpJ+ ^jV,/uRfYfMT9NX*á4ۇ2Q]w*:%{GX_[~;0s1F"KIL<̢,y՞OQw4Fvӎ[ay {ap[ʚh+!;2w~҉p 853٫t|Xe&IeW  ʣ퀢 d% ,De6`2̄?rr**aw8 O ]/ }k9qsNY\S2b%FZ1IqOfܙ%`[qw%KJI?A7B7QfaBjHRԹ0r-KQs#=0NIftϖ @ǔY e|7IX\E3kM1q;[ v0sݑ˜Δ]rJJt$]}Xbv_r2goA+]+k˞6DD;q3YWAb/@4 ck%]T7Ĕ5sڇ` hQA M_eiɍ5$Nǯ8X'>Q1rl a;{?NS鋶=V\)b"Z#]ȕsʬ!>2!r]>V'0HܧS,peM8CheNaqغF1kmd {[n) Ǒ.J;8^BlZ¯X_/Y;dE2:?8@3YKl&m*Edzm9^ner_e{L켂L7^%]NZ+ ݹn-t/mzG -lIKs`&]m:AY&;@$=&cĝ1 G mdz hozb[vG&},1 өɲ:p$Bv%rq(J~__%(tl~/m 5Kvjo3qR ,.tgůo:SMB-Q9%>Nb 9WI9~Pޭ`{lCly3+0!18-E a# a;>ֹ 'HTwxt|Gj6cK&ZbॻT)b]-̐M[ k0G4>Ӓ!ܕ#W< oqflSxF\dTŤRRc6 ³[nnA|L8=<8v`w>UurR"y@&FHT<=TRNXl l-ڶe[j׾OnDk O戀ܲ.Oף@^B)}OXM$!7o;o)Q a͉zا* Q<m :XI;F{4O|!%zAJR4IE};*9K91hA)":WvV$cFo;~2Z|*pC X=XAuz2o8mg*I'iQ`6}q˸5B2px nO 魏1βF9T_k>O^ 7bf?٪nNy(X54GWA:;YnKcѾ@ F@ ѯQW%h=16$BӷI\>z_P N 2gZB)|wduv\$ [TI#gw@@8$z3U_@f|!5*05NVO-ꘉ)qT!#ЁT.xWS~cQ`ͤejybG#nQJgz$K$DPjř^s+6q ePSl>9ݧ _ ]Z4ҕMo hDD`i5xH(UR,<2H@y1.F`e ÝSH}"nߢGD=ܴ2ڿіW5Z߿,SO+[Ygb.+yiY+}mJca^z0 Ο0%C ܊~RƯqemaաGg|m !ܟXL}Kąn6wWkX\Y2ew?옚pͅe/ݷQآ*;ɛ5**#&.Q;DP NWR2%yJJ=Jb^h;8hQ0_{uKL3fmMFV㍮'(OJmF%j] ^& &dz*TϕF+x+.2 7C[:-0c:pl&wK~ i0v' 4$8~7.ʬ**gD Ε.6sz^\-fե7t|e`ťsYݸ6@+& IP̂& oog61`7N%Ue'p' `>ݟ[7Sfa^sݱ뾦6]xZ8p]^Mx<\+ 1+KC31JGi;:9|91xؕ e,'vvTR&[L+Z!xt\QaԕyLlnhH9Nxhk*:Iv1aov"8, X<xuCny*q]E̅W,/_xey}9y|୻mOl9ʢn-Zg?;]ZtuUZΕSNmYop,a.oĂZ:b5|tI.5TXnR++$9X +K|xh f&@W]Ikup/d)lT+i~'`3cV`J~G :Y.] !8co>WeYE`\~ĕIlK@~=Qt>!0&E`$ӫχvݎ;گVUk>?ªq`xD'XF`;j.E &LhҞWa~"""&_Z"]^\ռ~7gf}K+N^pKm_*iz+mgCťPbzMϧ6 Ud7©[g9?>ϧG !lnK6MJO"F#榄pmOm FS7{rҡR WU6 ³*\~[(6A-4\jTC泟NK£>*Df>E wo@צ\o^>!KY=)k L3 #~Jlj6#\ٸ{kC@FMۮϘBKrWL,dѣXޭU2/r "& S8ZͪR[#,#LRdqacU:^[8"~}^[HXoN˧>vppWU$rS |JobP G)1eT˩m[5́Z[&Z_Gq"V+b$,Dg6X~c֯n0޸JQC*-\.2-֋ikX~WHHp(&#SCYF\r;jOj-_P /wkzq3Qi_ovY.LVRǖQn8=g%NMqPr9fi?W3]zYݙv~nPn.] ֚U%t(獫,adb>l;ee>TwK,*ӗ_(}kKZ^}8әpGeiADf)H*&o_*ro֦Ji0Dɫ~}׷~AS%X6)6l?~; W{V̞٪Z,ʏnXv}ɾb>#v?i 3%s*+=]R<{.};mzN: ͦȱ=3F[gY~dKp>1(Uh;m 2)wܰ>* Pkx=vK%J(VYU$0~ ^l~mwݯ&nr}*pQKYCv]1[9Z׺q\plc;ŭ {SIIv \)$1:OOP>1ܽ&(jPiU6=% ocß\%ePF{<:F۪C aK(7ݢ?Sy>z<Xp/V.JniyIS|¿dfbrae~ JZ56fbXPB'\k})wfnpGk4s5A{^~oF b=qR(iCZƙu?JTZW)3:oA|e͇i+񮃧DLyFnM t,9r8p]E'<9pP5/jɲ:F1-S'|6+pP *>[.Yw=Q)():qsRto0mGI"iP#W# 5Î9qI%Θ`ҪCV-Оf8vB; (-O׬'ƍHԛ}7Ƿv #KvH#;;ҽT:ehvpac޸,F4qHrGqB@U;)Ra+p N|A,({ng?Hʈk>vD({*d:rh dg{sgďrg_"4[(;s\ԭBj 7=^h8`^=)jy[QTpO92X:pQQ?aV,|>Q~6jISbxH';kPB c WM8<ފ{fڙ9F:`NjQ8ڑ {[D/NaGq=X7f/Bn7JTWB8IrP,j񵑢#W:Ok5^jvݭ.#:M;F:sF TbGUQA'?ʯ* .j5ZQ'[#0 Έm+$ߌ?W$9v ͬ FiOSCPpL7҆QɑA̱#5xd PE6>(`Fchj-u`@fˁجQb;dqs>lV| s0ݣ\]9yYoƩ8/77׃@ Cm޶[h,wY!?V,y;uw}mcx A }#^-1 Y"\c!I f Z8ed^ԛ6oND#cɹm!Ue2W+ͨl2"KJp[,i  HOsZ MTMVS~uvmv3W 6nbMQ%V\LJQ iT)ۨ?4e,!An(2'gqO:~`LUX1$tM(vٚ gOVE }D^r0̞ϖVR߈s{0U;|8TeB `(ny>/Uv$n]YZA=瀼W_3`Wx$Z4TZ*ԶTb7M6EIyQYzQX_Z]'5p]< ŏ]j`zRؐӤݱ|d]?xUg4c `B}Kz6a{|)))aRe*'D}8A.&>_u {`uIҪUbWyP<جwWܗO]Q˾<yQ2_oՁ;[/`2+`:>z./2?!nM>3_}`'0 &sgbz2!0°ؙ`xUn\^TW;@t]Jpf gzʐ, ?ζMU :6Q,иyv 2t!OPGZԬWe<0a|t zImoCU[к2jcVEevtN aίK`eF7Z[)=n@yvʩPb%% OY7-mO*c\ 0w[6?W\ך*nQ_;˓]k6Yp)}i)C8 ]L H%"7q5l-7-DsxWi#}"Nk(W[T\xY3UupOntY p^o=?%bgJWG2?cͩ.2A#gAq<9I]yK63&hJQ^Ӵ2.4 /g_3ym˦jsW3LN=Ԃ~"ƶgF@g5jMqdo |:i*xGqd;m|81\ ܖn)~) ZJ!Cbl BLI]VɁ>;v& ̒TrXs/ko#$ Lu Fp^K5skd(S&9cw[ :xk'0{R:? ^rrA=+'`5N]dߩqUMءCUkBJP Q{vb+P Sc F>o;}L< "8,=nQnFS(K:t8@%Nu֪Kz*C;cVS6 x42zrS>r0\rM~6fGrZPK:|Ӌ1ǑUm96JJ`Ws.%,ʢa«HOKD9l] nNoL-M-ZQ9DE;vBU8+bSz16&HwO2!0srF&#[S %/.Ŧzz,i ,+E*]YqQj˳:~,ylO1љl/hP5Y52.UgSe G֑eےE=G;"෡j=%l^F`SI7<EU;Lf]CrǴiH16sF%>)'cJ m7{/OkW:E]npkɁN7ì] &y[jQĦB7{ lh=nVUSGCpEDbDdUۂ0,vۨk9 b)HhCnŌ.S]R<]qװK; Sp\XDC|LDX<sCI UK8!'.vh͒і]MzjY.{S@a{@Ga)WhV֗i% )CL7>#r/,4 <طk7ׂ/%AcGǺ+{`IͽCe>_"f4 % 1ofCy :]#VN{Xl,TiViCX!DrQq2NPɟ191#)Y%gxTB݈DM,֒O+r">ylFx7E ?h>I69OiiCa&iejh4mm]$MLg`CN;, Yݾt85Š)8h Y DD\Ope9iE=g3cF.ε~em Q6!a)e 얶so֝_ s2L)쥩(Ad lYc/gV)w%)gn"G;6^+PJc05^{n1:όCOl$zޡ̊yBy^A/KBDZrs =TjC9v{y ~^X䌋OO :ȧE/=r(NZ)[":Z>RrPUR{<J ϊɱճ@ >,vDQ~$A+ZPΘL+[̌D-rsZbә;.3-`^h۽`$xZ^Y!go$bio9X+s _ pCG)A$r\-a' ;T_߭'vD]}vcŃX#\:XqTqSSE҆zުc1jh+78R9rLuű͵D)rE 23梿DrJܧ1 xC[}$¼Gq0I@rz55sCxBF)m;7?iF>Ȁ&GYŝ <W#3pt<$"MX"M7m8hJ8ΦC504(,HE ~%zD r4k,`:`&ZT4+!{p F﮴*T҈K +YqpD3+!I]㻣$KtwAxd$TNcf3 lhJ-oW iMA#4 NTmm>s}D+84F(j[K΄8[pwM vű}yh{aUs+0y#AbV_E+!ƘuvQ FQTm^6U[5q qSY :o&" Н^P5u̴gmhbvJ̮ƪlat1_d#k Uqʳ{8+nUϯ *yJRd3T%U4[(%abEH4϶}5U)+겒@0*r^mrV Zni\QX~Z2+r.nG )ݕ R,Mh=%DAݰy_/N>gg3鎤2_M^ -8~J4{LtE5k 2~|?s:PK re W.~_ g^TS% =ӕo& :N^n&r|`BP-WCZщECPRpT֗且f3xf¦;vX9!*b1ang24qG,/ؙ)*-I~?ݤ=\\Ŝ"V^2jCQ.(9ho)Sҏo{iyz+uXEqt^RmGW(Gt6\PQ)ԗ^2 ^# $o+sl]ј?- |>;zd Ue˩B=D#KڦpX='~?E[m2I7Y- l~KL *"\XL1,T EERfx V vESՋ ~}ȱxajUNlRL|XQ)M(072ԌV[Fn܍5AqaL< e "'\5jVWPLX2:b||<Bp8^Dg@:Gko7OFF<.t&vg:5? {[ Q6nXw:oN@{7]oH@zfD/s^&s~fډEn-69Mꎽw l+(bw " ahy# ȝbqL?&%RC 1ꂓE_f~i"(Hܶ Iox+طv{e%uxuuy.ڦ=?׊@6rh !+¶*맀Psi T>0<4R~`lu]_^.j($tT#m}[?cZ> T@P}(⇚~et{۝a<ܫDvVLR emGKy߅ХK`wtSuw(Ζ:SoH7>WBu3|y'ˑ-#G 4fF_m+W-s];d׏-J0x`֣ñ_5NtuX@x_xkHKǘ34`p›|{^|J #,#&yfU?&*[6M$;Uլ^BOp6!lK Xߟow*!ѶOA1٠G)@ۊ:C)Vvh^b>ЫRF iNUM!(-Ca~u8 r#v72*6$$yj(!o+BLś? T ])"H#3V֦Bd,bĺyDHjſgkHŶrŸ'vk,#Jbݛ/XQUߘh}߾j0he>;p0u:$hv8Px+c{k6[OػIj s5w+PL-6/"FUpoGY*%j(H4+j}j{X~5>Q=>YxZ)m;O PD{'Kw!Y1xr;pKN$q8jnc%PO$tI$J7 ja+Whe9㹾K&%p73׸=ʆ|: p&3, &dHZigu/\IA`}LH?LT=+ LDn>%rYti |Ci#0h}.vL?% GvHIe$7|;GNh .>fjג=m#q4TM΄1~j6$P/$ HIxxf$%l )f R%1= Im% aEqょvygqhp6?>+:h Qmqm1uEd s,ēG- D^EԢkH<4dj(2Ԑ 4$z(«%MK/2$Ȕځ sX -<&!H3 O Tuc,FBJiRbv7΀N&S#<2P#<39 ʡ>h?hƕd643uh+}1H/FL!~FӐ/J\;1,H<-{1&ʱYc[kF,w!v]Cߨy>͛Ƥ:qPJޮ@UނQ'8ѲX2*Rz||OA)CܤC!+:}d\zz9V#(W 4B̸,"֐ܵ8(!> ~ J.]J}%ISR#P\T}*/ _vS+a_:cвbp.9rʕݵnr FOAS80$i%A|!6En̑藿$h&Ӎj4=㏮Pkcxeo!̅ gQgm:OvD<ژ1x&YQ  1&erV{w@ ?}kt)+~]14WpǤDY0L!Ϻ}(#p)M)3M߮]QڢYDiA9y65bZS4;45L]]iRDžgK !ef΀u#ؓ<D<9{ઞ5$b}|v G'QLRbƔ~2ؠz"WGudI umU&!0 #hۤoEc"~+[f ]g\FUxO0tX҂y2 ־ [@)L`mEK^[+M:ZI+uEXPK:w)˗:,y"qVTJeBZP:/`Xԩf b;> n/^5 dz NI ߶3^_m@# QGeYp<ʋU-CӴKvs"['4 ê+&*{ܲvU^R^'!^֨u2߶d|C/ d_!>C ?3FJ֊qK yjY@r{WԱq+l2mF1tܬC)R4vK#35J1?ds̕W6,@c÷p^GAֆoڔnfs9bF/nZ}f-8̓WUƼs5)>t^hgk <8 T ]4"d]@0Yr$ȾQaBW'<aNb^b0 y>"Q 'a^!x;ԔF]^sr9Y!XС#W|h5jGF`?Bh ]u<ס Oc7"JDt:VC.v'`(LO)a(jaFA7iRpX vg6kO (Q 6Yj@MH`>U cM8Gn|yWYD=~gʢퟭY+m c)3uRA-|Kȱaj˙Qӱf.SVGOmdNN@VP,J|gVMX k{D7=e¾[N-3ܒ\syQ+nӖkz>W +sXl]Z-e`}NϾL'6ky) |#(V;Mb~´ '8rbˉmzrrZӇRumUۣbǓ(O*n:○{jGx+ 49|OQ2,O W(Op 8d7:ȡe"i(4lc"d:m#l8fu*攥#S0x<s}<#uC6!oelWqס1nu gBaZ4̩@b8U%t^ zNf;0@@AkyHL_CEМTuh,Ql?U[:$<g0`H7|6(.sUTyfkbkLDP$=pW-t.zB ,KN(phrA%w%l*DU-47b;&n(jq|:{FW J@'$7 '  YwYwbc4}A88VN6 i'T$ 6ڭr_en[ J~Oo [Ygk4SPInc. ACke#OȥRPG;Q}uUߔ@ 6Za}s[(RF?o;Wo+_wV5*6N?~zQP_J<9 ؎ ,MVCna\Zd$]̀]4bM N:!MtS tlJoCtJhjz[^tSD~HףP~4喛A'_F.{ Pv]0Pqru339vL$,YVeAF|ss(t{ pL@ [nk#eFUc`u"liB+qf]r*wx qU|+N4چ=#[v3M 7EC˴iY/drUMp輾<Fջ"ggsN}by'oMMd5h:FМ E@Ԗ-YɛX&/dz' zDpLwSu) \3zkjEOLQ #ZrǮ)e{Ae`<r#bE*֢%\&ۇܙǺJR6=Xiy!~ߣ= SiG6e d>quKW3` 3|/hbGKx%:'Ӕr -^ɫ9)9 9lc;MsGЛڄ^#p6 '3O-q p.3tz˃^xlY@BpF龰pPE0ku%WR VnƐ 6VX8bYfNw30ľ6i2њ`HX+Bͻ9'˷@#s̖CSYfƿЧ.36m<ًve!(gw ]k񭡸=W,zS'(hB/E ?fTفg5(|Qu-l n *lMg eh;+Q(Bp@ϮCip96~ PVk)N3`MK9;̖] 'Uti(RM#ZCL[3 *SJ&Uzht裄-˄F{𡳕mXc=au7[@8e(JV/9AΧjr2Vh%G=mWzoԏɌ4irVLՕ/exlϷ}{^ CeL]I/a΅j[ 3:wC;4`FbmCC H vl`fog𦧜r@Ww8PjQ,1aP~rkz\Yv~lɶ_vX9HSbLw#K<\,B_ӱӄU;6v9{ޖT4J5)}/|_dXŒii\5honφy4gQE7kK{-ⶅd^ak2'Q4b!ơ=M(n\gכ&".g-:#ɔ,gl^Ccpwgy]+U_7r\&g[v+m;٪EjC}*}Z4x{D[T)QE6 gSoVdzd\)xWL29nhhAptS)¥+{jre鈎$9:E^ ;4voxM da_+3BP ܪ'3yļrk`GzFd(Ĝ̡w7g XbU;S뱋n7uI>F2eOq`SȦ1B6Ax8UJK]$~HF,4*suEj5(&id"HefoRR ulcTɧݵsrFfR!@|~-Ԫ}^ekmxzf #sZX¬!z7(b3D,|=m?ǞҨ/*ޖo7/Qy ,sN*}כ&Wlxx4F>r81c`%R+1 Q2b WYomW!GPQ!6%YtߒDMX+Z1',7# |9l~>Rf+QuGĦ 8N2Xj]T ',WAŠ;fG YrppN83GcY,c#_Tɩ ;+^zU`hz}ܼ)淥~ μ }I f\zYډA/P/7/֕âK4B,EzFEHtɸWX~zhP/ʲu釶:y~"BȪZae8 ՎI5惌G %[KmXHK V?ˢRBQ&U(mufIux!23`P5+SM Ӵs ɛ. Q@G6ONjI%=NLid ^tG&n\3L7\*2RY"7=̩elC~;03J,t%{+w*[4_􇉵$]O ՜b4P=9l{h^Be^hzK Xa:w :aR3Muz]"fSW\nV͈5-ia>gɿcȆsL^:z+9~="Uģbn ߿W[~Pv9 Z黛>cրFa E!(Y'A9ڪL%5I=FGK1E^X9\ G0,.ft]1{~ f>j^~)|0=9ܷ]R`g(*>FO֫*Xǎ+oGc^`N=4X8G_/~?4ٲANlZW!.rzI:D˻[D"<qRL'/CWry.'c?2 `k 4 u_QeP_bٹbBwTg2OD8j MrCg}޶ '&cs~[ڍ8BR) 5GWMd%7Q;+g/?˪%NE:@/GTAQaG@5)˂ N}Y'ѣ62Q:[ e`5дQ©@ zَCZy-PѪ)(\9\Y1#)аQ+f?5:c j8hN;VHə͢P04hP?68^8U~x(ٍ%aǮӱ+тr>j*m; T8G K+-0Rרf;ȘO: 1NARt'aGԦ\<% ':iWfk{t3uuJ2aա/DXTqtvƈ13e耜4HM#R5SIwŎ'&!*XQWg_jG/hI}qѻ[ {uPlTBF$cWVH+A\R[e ;Ul1*|À"SXݛC=~[9-4J-XU5e8|e0-,39GA$_=##22@8$CK5$4Ał'Y}o>/`s}>œTmȗ S?(ޚQ{$)M*7XSc\ku )DYft+1Q|)4YuUg{.WPLPBPf~:P_A>iLk֝U梪 ؍}oHRc-XIKpdbh*rZۭ[S2IJ D#s]܃ZNul; ZazDf,1ӰdX 5WuOZQBUqm" ZkbhiRS*2`VL^/ƃ8pA/U,Ц*%% koQHMAY%UTg~(^w&\K>CqE"* )5ݾ=LDU1OlF235Ě֮N]%rUԤ ThJuMRsT\ Ul=nDӠJҡABiri/vn,U xz?5eƂT.0?J_Y†~vW|DvP+?zpD`XYd!ڍb1v.Na߿= O9-K+iwZCg7GC?hi}UusCX oOJBc;=tYap#r%?e1b요jh<9#"oY?Do s' 0': ` 'di0,d|Z`U(Jꐾ&jPG;'Y۾.,Fe9&`LƆCDj[ 2y~H0bǰgN4硲 T0,gnCBc a "!&K7hQ0׌ gG0D"sÿ $TԬZx zyOA~snÉipM`FT $`{b}=E(SnQ%GzEaG֊(g]V&)e_4;]Oi$])8Ċ!0XHPg?ItZ Ñ/prE7_rk:/RjOOFُÄ '*o >Ӽ}](=Ngun@,OkEwpw+2!*{Sγ%Jl/3ҜۭYbeP^#bY)>Ar>kaX0M|bWZyNâjn-wГD!r_kqy܌2%wYF̑*ƈ|sܞ i褉eڢKMhE+ċp jDl 'C*])ye1Q6w&JT}xWT5r$Ϗ7hN_1e\V]iL -2Op@L[~ggzA;5HxpT7='-:k~,U\:_%M@|ޱ"G`n(X=iKlr=R F^~]ƃ騥eO~>'y{G?u{7`<;oytT")e7F&~"T# %d6a3]2@[j[y\|E0(p=m֣! Tѐ6EUmͩ{vrFf7@09 o Yj^ŗߥ4%ThlfUqg_A%()L?dx-TAQezU2졞AܧT@W|C9e0/ =A@(qʹ:)F#PK1ŬW5Xm0y䶡E%MEpjhU|mŧJQS$r`*3SϼmKXM}H*#a*6B/Ǟ&T=$4㑽@CꞞZ¼@&9+M^(S{LqZ{tIT 6W='"Q(jNB5g+nr-L%$'/++E[wfv̶ $9ΑCy1= $^tA c੧xtZHxudApjN6:d Ljuc}$"{3 ׺4_ӪwobIq62+.kHU m߁euuj]8yS̛X˜>kPqo${5I!}x(QŖéU )k;޵u})KDZZ}-,β3zIvqsmH5G*+&jl})J[ZffrJ®C*D1D4 MϚs2쾖D:sDSp7Jm5 #R2Rdי´Wl.T_o㧢D?A|JvUV?ʫ$n}\7$1 4jSRtʋF./27":1cW½Ý"ҜާD}hD!xS;SfŰ~Ŧ _|ԏ_ƈ_|7N |Eu#,)xgT`ԸkuToF8>d,"D9)ɠʭnurCH~?tk{T<3Yǝkh6Tzj\"vq43X=ϖ_[:TUm?nJJħÙlvCsg}|X1~Np݉6$Hm:Ej^^g!hda՞-25Zʄ=6\ua,6 qx05;Vd3\.ԃ#H#dOK[]$[T }e֒[ &4\xn0aVp+OqO0_)0.l"qn_ne[60 aUh#P[lҵCuA"gF>_O5'im@HJ;0oiOD+Bl*L9 qH"af=h"7dp?z# RXhag*e_DLR)7 i3^ݑ0EpqF6{e SQYD3oou,vlخ[ 2ylKF.In2M QShE9 Bhfl]Ɓ ۮ+]8 uyL0y|T"痣IM:MzB;c[ _˃"jH0՚06!P lVE7OO'sztW?+x nɽi`4 :`^+9uu&6~ęrHC$ =ڷn |uHa`f(pzxhU,8V{Ay%ُ 2vbWr%1=iIa-^z*ҶXP"G] -5 )5ŴcU^LxuJx.RԌ" ԍ7HєT7!?Gj,T1)>v.K< yQpAo5j#>tw˰wpKڧȈr7zҧh;)Qл0q$_lςHWzvbـ?rd9i;K ab}}>Nnz"U.f'c\_O,9NG@&IO;"eL9ɂ7RJ(Z>'dQ;?e@.:/jq+k/c"υEs/܀V:W d' rFV6S?M?@wL6\އyJcyYİɪI8܅bhc+)ě 9&jSEuǰ10ۈ[$7Ԍ|J8! dPsp@\\eߟK)Nh$q{WU2V扚{Q:L|I+ʄۣ]f]@EkQ">rOTr'+$hR嗻i D-i +Diz%K<s}\Zpu$P^4 }Ys=nWx-F$n[)jvI Xm@#7;/D%>a*QfʙQ[Y)%[,Br#v=xWnZKNŖ5|3HLQ K:#TAep( 'O(W@vECDFH"ld+]l렌\5e0y]h ~܊4g.v+3Sڄae$Үl.OÌRjqq)oK~ƭ0d ;4mȀoxqM8ukCgǨZfJiп/9$dEcm^ACV:Knh{/a |:h ǒw(TG\I~h#Ft l ܙ]¥5XgSzQN.›IH1GzCF8J0[a{u+1BJs#AZeC=_Tq+YJ.hi ,E!塳 I-&޴FSЍEY;(@o1ex [wr M3t9۴k! -B+fjKafaf6$8V+各NwvkF~Arlc3B\cST㄁tܝQ+WT"`vkJF.=H06aGObŕ1_'C+mlK8^7#i 'tzu:Ub6bLʆٲB niMIb4/thXT-& '5нM'Ҵy3ܺE4,G,Lo6H ?RY`k OJ܌zfҿb:r{hdtKD!Tf 0giy^FlhtG?#'[fĪLy qғ4d`v{f *\~TV\Brq)a2I|Tۊ  umKSzpBР+E!xB^7?Oӡ25@Ǖqѭن7>b@pVE !J[f ߒ^}Yi9U]K}yPǭ2J8Q80aB9eI;߅ Lt h8Կ*_ qL.R\|ed 1 tM&s>_"-^,YҦJC/ Of׫R~ {뱸TXy%1Io7SB~$L5r1m9SϹPxTGXܩ׀1nXثڟLTc?΄Di(C^ʫ^t9oǣ$Yd4#іx;Dsggba4*j8FxmC1itB55i)-{#0{rv@9ؠj ` 4au{|wś"-Vܒʺ㯎rf(>V..6D:IO:N%˂:Jv-U-)׹k[uRKjw Qe}ܭBc&`qrX[vp͓{SKjAyz`l Oy%נ#;a}yKyau{E燇u6Sh4pȇ5k#s^ @oUxU-~hԏ`?{ \]yOXQBe^9JVbjf˕g'|zɮKRFt:~62YcL {bҼȔ8na&ԌȚڴ -oպ:HP|?9#^HVmVRi'T7< 6.#b{NB7Fb̷uxjڳ`%ݤNF?5WhV&'P h; ~|vH]czK>na)6:ZZpZvx$)ޙig;*8|F Jt(Xӓ{֊3>jETU\a/h@Jbڙ:U`%?R8*=~9+L |xbi"4n锸'Z?b$r*t5]}IF0s2+Dq#Ć86WS&l>rNy]VnK夹jxq|E2/1?y7Tx<5r `ӎHw,U^sͲH-^1G*gg >XS /^3JN( :ԉJQrc7IJU3_:!B&2ԦNS y'­^ڑLMjNfLz4 C=j˃JƺhWs@wHyPӯ@7TL"6 !_o/ /f2"aR>fvA9[Nimw3M1hX-b<'.2 kYWȝn&QqTn0et[#) D2p76P\ӞR$nP% fW~jCO?5ݸ]D8}v/wڪm9=6WW 1cP;OZ:w>/D6\B_ƾnf8SF_o5K~1bQCÛ> 5wMЃ!//ϸ^CkQƠxduIu| .ы؛u!OMo~MqKP$XR+E-@%e qjיz ̣Ϯ_ӿhe VEjQ),CH(ԫ"p+fTg< 7 q_FTG[aTTӶnfu|\i?l͂nj$zMO.icAin eY*%8L2<]6}KpQ[l-jC8o5+#TVͥJ\YlbmPB"3=r|տe=hrƒ-) \:tѫs=,zDS Д\"B`Z$;Ad$Y7%뮱aΕ?j}6Ǭ }Qש]-~"^B۬2{V..u^ejj7ތ<޸(6GrHF7CB诣tvjj"{okNzFͳg3ߙkT )|4wqF|z]7R 6T}7m %`eo]XYv >u%%Sl؆S/$'-5?v*bUkoώ]^>Z0oU=z}]1(qU64C^ 8=$dBQhq 5Fs-\{.cL귛4T 9jr`w_[#^]~m!x> +Zq)Ď:BȺT0MmU`O#J>P'giR8{Pr%9F)(b^_-Ɍ9*˒$ŁW <"d蟪[ˑ1(5\YH)T$HR8a㘐iH.@KxuMu96@vY(2oz{ 1Ɩ "j8dVNsH 6BV87i* <1^9&_(y"rѝ9>q.5Kx0Eq@Й8R_M/U*DUbmo_cy6x%<&glUޥw@>P |#ÃM 1AB< ns^571:V񆆠/Y' V*A1.sW#ث/.tRޕv,,u+WüvO4%^*u {5->PB_锈Bf0nxOv`نâv&#JYRq* Rr~n WYt{͂qfʴI+ޚRUL%P ,Dpbg_ܮڑ,!Pn 0+4I&i03K[|?Od,pPڒSk;%i y4ܐQyR!sd/[Y iۺgdamY*ebJ%OQi[^MSs~k&8!EifxT<<>"\Ehjz)hb_UF[f3uO-jɮ)EiM>ko+ lV &P,`N%PHZfǞ qxUXErM{d5Q\*!x~^ 4Gw6(,ʶøR7D=\R>E@&DJ|.szԽߦƅN> 5 5olrtDgJĎfwDİ4J>E 0ÎsK>JOT&ub6O턩 ty^HI>>´G KE]]^!a`D䅀7y.% M&FjT&!^-1:0ƃfİ48Hs<(eGheO=j S2;wr޳Wr,g"'bDi4>0% prW.N>%)g{[cHN`Wx&xA.o dg2EydU5(Mw IY947f /j:* P_TάJ [{@:ޖ.o+s9kr}WNcWr[H91xLYcl%MNu.Lvl& ^?Y {Z0 OXtpnzY <^*dIXEiFs:`\C:MUS ϟ/c@!iBAF .lO$}מxy NEyx,Lz9DB*@wzޚ! NZ(9QIJ. 1.,djreI"O"ϝ/-$ߖg{\4p}Ѕu19TM Q/LX /4;QE'I{$% //o-;x {lWzi;elȑآP~+S*lF-fTis±2{$.@7LqIWԵ߽_ ~yr\^5_x0n!ZrB^MY^ 4$tt"-o_ JI'5$L{ `J7AgBMz A}.-`~Ŝ Ǚ8\?(0I(y-Cd%!' Fov;iIQ HLb_!46B[>+mԯpqp\mOCh`TĎQ oh<b;IB= Ʌm?;uQ.EE\nWPsRIj.EY6[h Qn@`ѝꋔЅ<"DDtCosSί*g%/clϫ/wa4WJw46&*Y.WaEk(+K$eInJ[&rAYׁʛ*s'\` 7S}bQc`a\d&$ۥ}@F7T 1ӛeNо.l߈ 5l+&t|#u|NT,UvŷiV|,} 7&9O 5t2yIr4Sl}]pJ{SI'B #\ZR=lI4̯9BZ=Dv<'e'ߪZ/C:&ۇbaoK{K|(w5BVYZ-Rmɲ?kIX8P3<Ͱ$`^KGf Z`[i>nsh*\OWf69~d1wJ-R])Z=W@s"@t ䷹b Og#8?~H;U4[.'9uFCҒnN̘0$ў+!o9 +Ň?9j~>U7G)n+rG[ʸYŲ͌AJ!R8] 3'wϙ'Z}I#=l "23G/!C%ɢa/Bj ?z BZ zP޸ZKZ9fk BUuyЏLF,̾R-̔7$Hh7H̐]a'AxMsZ%|y 4 s^iŤ8Ar/e] ={a&}u!TSf4;A,OG4R-3:d;/Uvz;qX18fZ~ T.i!=K.NY~kYs GmDO}""嵶kRJff#jFGpvcb˱t5̄-\jTV+jF#r[VVj"3.sTXP{(l(LW $|u,Wpl̝j:|N5e< . {8rNE,.98jJ U5o*x3|Ûn ,g'ʉUnKtt]HĆsvgU-60yX_,TB#fp1lIӥV&Oocr)aF $ `)u s2mG#O^noSj6ڔEkZy]5+F9a} TG/H [SKD6|i6bAKTo8!; GK&ȇk_$WB9#fc%ε3W靦=d6dI m@Rw5 '~\(6AI:.)\#n[*WY`'mX┞WR@j Xѳzd)y3 rqI$d+}ϛ^uE 6F΅BH⾽+JPIl 90XLY1tQpMPMOT(I36rzk#9|5ӁI-x̏|Qĝ/^Qͧ(}Cⅱ>ab3*0y]@DԷ۶d7Erϧ׀HT@nξH4!K$ZԿLS|b{@+qV`qM9x$Gs9d{ky/s8w-c,u 4+&8r=Ux65+ҟk\78tW> M$&>Ai~'f\/"_?~xkHST<DQC?jt1B2jC\jx!Ņ}zkh?~!xZ ,MܤEu%#DߖN]KS( 9m=d"Ue *I e qԈ"G{cB8:,(Ql{r,@ 'Ԭg+W$+y[qQ*#Ւ̛l'wg[Ps3;[J{Y/qB}rJLj#_`4 x#|,WҨHjY 䚶Z&M e>9}QҖ&IPn'l߲#Fu5͘*<__ =?s rA;QܓWm.514si[O۱1q3~-T`);#+v'" ͅbF9͋s4I?urQ)}ɥeEhafh ޥ"hɪGϚ_iE;˺:FXg fR|Sz1VRb)1p2NkaDnqX*"4dL;#gsÉuc D H`iYOr}ؒ6]\.<= mzl9!J۶ 1`spFfp4A$-Ʊq#|6&+1ٍ텰XjBepS}GLF<rAY-ഭ`a1ʤT5oژZ_ X%l,n=~BZpjmh#AuhOi~T0R|sR p JHBVخCKĢ ( 7ƣrK' +lعqr]%I8*Ats\~*JDh) sa) 6Bsҩ ī&6֖lr?4>  /HI63Fb3 !s.O2*҇Ԕ*C‰Y@=]p&$G{7>O7b 5~Ry;|2 <[Z+)bLe Lu#0s$%3 %ݙVBNYry,lkr5ڦvd><㠡ӊ,a?9&Fz1,<-Pv)/rɸ)&E|jG=]1RC]{1%A[`}ӃTOZ8G&-:3{ R7[oJf yY9Cr䛺9RM~㏽rhIgj9 .nCc_}vwq7DF,MŢwZ;8m)D~<}s}a)W gVu}R~#9~>m=%H< $>ɟ̇?kxءڲ&ÓAs'hN006'+f]qO+(2q0`t\1(WLU ې&ɳSG&WY԰uPÜ|{ "G:g­Odʮ! Kj4sQ/^nFfuI9"8 {J횜'GDYw5og BQb ?x m+޸+"=҄.k({*USɝ"@a&e\1?#NpH:AnjKgQuKh5mSsc†'2=nlsW#E_mt?3R8u>"G 8ݔ8\#Džj2o&s& _mV_,8ܦ w 7,Cҩ,Wmj׏n=`ƪPP{Mms0 &l' :{ie )ҫh}M7ױ<ԝceK޿ճ*G5#.>cn~}J3OV>2/1͚Sp`Kuw,k6LGI rAɉhҮ m\FabѦYldY0>j=Jfd5^s}<]r%۳!Qi Ń^Yl.ڽI:߯{Biyu!4ߢs&? c;u_DnjpA;98iQ_ML8.Ac1 SoN`F$ϯ C%~qj2w_EA花-`},&ODO*.\W-@/zN?86t-]5]GjCyidz[Pl]u(lҦ2!Jzr~pʹ|¯$扭~L0?+1#6r@z+m }SX`b,NJTi25@ϱ&e %Cz+^}1с2K-V{34У|w=ΠI(Jmtr%-pIn1슻3fsE 7+jȹ,Z-E3>S5@)*l+>THOM\k*`=EVL8U߷)tz`( Yą':eX?4uQ>=~T LHЉsRĕ#9knprFS|!@ $AE0wHN!ore7y@km>^fW܅ "AlC"gp 4\ V $ s'uFt`]n. $0ٞpӆLba]h gF'?<5]ЄW}Z^H(V611̚!RҐǕ(4E-0ClKĠÚm(#HrY0A*qR5fH"\<u ~2JT;Vl.m qa>+KLeXv3}ΐ29.3~=+oӎfPA'KϓOpb}vAo(׏g+(ܬ $㺋^rAK7#OC#hjT9|.(U@_vwDJs&ph{\әzup X'8( *$XO[jpT3$ye+,y"r&@ >)9N;E?QtZrz~BMe Ͳ/SޝihZL^(9_fo<|[RP΋)GNm߶OB#)$z1F_bP\ᶰ l7ðMpfx9n, ٿg͒!9ONa޾~17lǮwnxih=z^wS"sv|{-Yk9n;{oo-eomq-֎%CLIU >tP8'C _Ԥxdz۸t^0/>ڰVd=96oF6^^AǬ|_G  sͪ*J+[_|ӆ8t6ϟ[%+5쮼$Z7 ɄdbMVzQ|K˛ύ9,+ ĸQ+I-yN`{Ws"Nw(ʩSXK@}RNQM1oэH3EaSѣ!cF4"Wd%G>o |Ђ83l'%zہf .ãcŋgnYr`;Ḳ&Qmd9{+Y&",H":/gJ%4 Q2 djμmŧs!9,J%[oS vt?pC4̮|m:"]lFqClvNNJ9l #'cffd@m k$g8v/E`S[JRV` R%@0ObɆu#֬;~DՆ< $!p$i[Ϥ$WźS} ]MNpBKW3p1pGQf9i"CMp-wLR:E;CP DVAqW#7::0h(k 3\@‘R?}ҡI$\} xy3r>om征>Gy@n g=[{ t-m RAz4x^d%clcFE ^R[.KgR.u^u!^X!v_ݱxēw)xĮtijA\gO`U7TLb]hQ o,#6ϴEI5tq*QA&;3gWYp:BoK(K37wR\h]x))lj >hy~"տ3a]פw* qd+nofmQcRo,wY'Uþq"2N]bA"`H? F'0آ"B+e(5\TfֳYM+.L)Vo7]SEX]?A2֛vD UjUF+~Y6hlMZ>ј'`BB[y!Vh=vc͟ggLQζɗ~>~&vr~Gh:S2BX٘N@8r R(л`3C\4?~ˮX;a٦8Yn>șAy+rCbN,K\kc};(oo^N/G;> rx?lcvcX`9HG[~$rݨFJQ-m Ub|[(-RC泋Misx$"~Gx*ý: *J[7.?OcӪВv>OGrjXaX:|y@hժSSG2^&Is;#$ڬ(TQ/?H{==Rqʣ49.7tVb NBm|u9q۠" |FV{vqprԊqg%  x=lHrAv;f 5V2(usVD4|p® rg-^q'JgG] 6$<)ma[OJszj:\J\= 8Pt-U G?j ,4oz7MOF!ߟ6l,@{E(q}劵qo kW vllOON_$xQ{jgASa`S,ơ тaZ#nLOph YUEh"w$z~/WMo`;ٗOQ1dg;Uz̝l$ H `!M*9=`vH<'yg gYC=KX+]ҦMnRwUdG+4t&=Ykm],@HJ!~Jl[?@ e>,O{6{`g?|d+gOibdo·2;ADB=M [i k5@Mcysݯw9*E j*#ӟs7% b1x,2`kW;pX#Q NePX͆@Wz鉞9zmBb=O4P`Ӄ6Ug=+`.;߭f ~r<3/* | ݰ4jZ `\dǝDuvf7 @K~Yw#m%4X*ë7ڑ58E@zPZ KqX@.Q6afAqXFyHQ[ Z{gpܭ mn2y.cxZGsq`24ii뮇; "slYMee%CsT}_NA9 sˇ0n[גp/q>GsĜ!_ X|WSzv#<}{}t% A "\CwɫǬR \$U.퇻m֫* [=a{!.of-]VHeN a'qhT4tn3 jS+8ikq+[23*:܍d(5xHZpGJ3oMm |m^.ɻ)7 \=tϥG h V6DR2hLly-Df" =7%odsVJ@"7bK|-/͖-yNr놵<,{6j]`W8n Vm? $ŞD`/rզ@^,vb15uQ/3-MSEIK>(3O6)=wDhpdKò$4V6|N6;MF*4z\Ԍ'1(T!L=`9gkvh Aw"m};}P!%!7 w!3#-dZfRbl;L 7Khⴌ/}+~u~N/8JQ&{-A} izG;;r5]>_5MNͯq3p+ Wm8FȮ#?3͞زUi{}vn`[26 !+{qYZ]cME'l,H^z\sWSR] Q+A ӤO1[4hW-2 $+<1{]g z7V ɖc@B|r0v06Hl/c$P[el#.>ViNP#\N<Ҏ5Hv:T6U79 ,gÕdmϫ.2ѲS4X.ɑ@O"2\+n]wϹEڙ#r j20_Z,QVr}lUF,T)Y6eIǙ¡6@Թ5٠|dJ@l2"rWZ&D ;Ʃ2sm$8.H_nim&?(];/MpV)@(5璐} ~Ghn9!AΙUZ2Ac{ SH5H v<5w^u9hNِ(N2d [8Kci$Y83v8jn-=7%s~jZDeF˱ȫ7B)2rP}tGogg>B`V(f{뀓'oJ0 ™2H]MW~+0,?DK֡pH$ .0-DdKt[n'w}i |k>&`9'_aO̳ȨK9QS7[ȌkEixBbi:yԉ+kJ&{\ÙKPl(ӢLT>AyD: 6j<.(%.7ڊ&VYYlj|̀\z~BVvglDYh`K-fc= $U<>o<2:_!)'xr~1!=u/ӽ(2 |QWJLUz_˕hx5.#Z:t bf~EAAbд_iFU^#'O3JlxxK0I)d:{*|*Dk7z2[G~v`rLJ:)ZkHu [YTDMj[kiMyX|-/8!Ėz2 hAi Rҥ%Cy[P[=4(:|P}ix"i6?\>>Sae {^pp~G/x^}G"nv25s Wj5@4m8I?a5# '-r|{Se^- oe+#y77'倌'q<)(TP}PUD40 0e穠/72=zSө ZǴڃD(SGIq'gʑjB=ѤN;#ȑqp yx לS^\lTXiM'%hYCqxF<2qBJW(bw)cXH9o|`\uN-JA /0r$%C~F9{ kilIr}5h:*r|L@5h/$UO\Md0~>$ ҽbiGσFpkCT<:Y@=${6} *EM.:juU%>*S]ב1(ʛo6.M_O8d6/=gepAs-zb#&f!R }#HgyprH&H3ywju.::Y6 lO~'B{CKA]kttEfd)<3";kDh טs[G$wEmڊt˺uNɫSݯd*˘Sj)`WHuh*uNzCeg"S3 #pѐTai "Q] :sm6{\N LC9{S 6KÎ=H'87w PCB"`X(Q\ 7t̖@7ӢDMo {xz !C.*NAVBBrFi< Ezf W_|F`]}q{x,zfY`]r󕠧yR\o{ wOrg0loehxiH|$d+{~xoڮT=c!fv1iCb])qE`{?́Pzl$lm Isᩇ__.M wCZaiUs؉$e@i.[^w[%WCĕ@\2Z"ѝ飋A $1lj)NMɜmg#V$"-@d5(,L ɍA\2DyF`sNh ʯ~)vP-NCx'fg dsrUJ=^Z@g7D_n<|)+tOr(Y?Q)-ۛ .[`|4 ^۩N/΋VG{Z׮ߖ^t !W5^*~" ':⛑PMPF- gd`W^Ewv*/& P#›i04cIGB3ְͯI3ٟG}6lTg7H,`Gv5N H4)^N0'AxcR@nTME L5{2bCvbzc"%Cc%wtUьΞ?v)╆ږxH]+@)"BE GjFЅh\jjH\0o>狠ФwBXa(j L<9K@EPQZ2,p}}dR>8t땤7g꒺Y@k k"uۺp$oЌqTv̤ոKJKw;2TAXWvI*j,GvJ.rv!Y&:wlN-nPـ c}+׃C74#Oy<2h3&KvF;[ K*'F۬| FwYyQef`C^$o^4C^ M;+!#1SГ- OWrR k5 ?ί~/rtܹP$yG\`-Rotq/]!e"4x$G|]MÒ ۭu9sv:o@F wֿPp|ҎB(= RWۖӟ#3cLML7br\emp'+cgr}~-`P o96Oz_|Ⱥ.ILހe†)!$GH1ϡ*X\'_DJ>.2ѓPc^hS{Iڿ[ %1}?hl~][Coz;׸/Zp_.H\cxH i gnotRe,*vJH=!Ć)PzXVQ0KEcͺ!-mkÇf[~eޏ u?]IJaHW_£烌EjR^DC?yv /F+5X,u覿+ށӥ uTASg h&9R.$"7(YN.+0}3y IaB;H&9GSHm2@)5CbowϡԅޤhDrwǙKm,P*=.єcU'@b9^Bf H<\I +}Q63 ح-GJXu33'266t;O+&╲l'dQʚ梀&s&: &\n9nFuC5 sh4^eΠy$`VF5ľ$^K8{9S):W$huU *;Q89 VSyb8[(R4G?r d/qVsWd єBR۠&vVR2Lħ9Pze>K̾1>k]x!~cHd1 h$R >E7rI?<ԩN?:Lb$ @ yF2=~4sBhNf2RECODLr>ԆtE[u12ůKm Z2HpJꀀV{E~唃Wɯ~'²f&@SC(w<^̆Vέtಪ v)*w_lfE@&=ŪsziovR+WI>t4=D] vz#~E-owIuZ"t=2磘ƪY!ݢEV֏Ӕ[l5Vt7ё)7I_rSC&61/酹m7Rs5By{tdYqrxH]W5|* ^"a[7ҎߌY D^ȁpRR;ޝK?.~⺔|ȀS3% ie倣Ǜ\F,YoJTd%h /ml֝wnO:xt?H{nԇdx>iՅP yulDI!L@NY)@WZ'h-D|!C]m6IJV9J?>h/6NE0hC}-)m˧tp^qn(w6 Cp"_xNXX ^;>`* [@&3]gGm 0Vzl1>[qQB r} n3]ꂹPq ԼM/['KY#Ł1 8ď-P瀈v<d|}J49p;Xy2C\mCϩǛGe*5ϩȬqr>R6CTFM:Fqe'7ش|N0.;ǣˇZҁaO!ݼtYB+yf+\_RR*iBԳ'xaE -o50*:]1.]udۂ+j*7l(;ƘQW >Jk M0X H)@t:!@*AR6 O-d2 ?6ϛȼ$ue[㠭 xmHq_ˋp2D`#FweCa3v2"G7B)A=r:n`R&rJ<܆#vܒns؜˕S:b.?|C2OUd=ϏHEg.La^:/f@@1 xLi`; rL 0n&"2szK˸]rPxJdOV9:gQ_/LT~Q=Fx`yhq_oῥ-?7A+ \ u6Kzyd yLḏn}pVbM#%2u2XDC?Ju$dD6ab'cq!d9uu4&g]i=$9zI d T+@U"gQov4^HfQߦ=+[u;JμtF4LHʦӅduIJ_dWjrz6c ZRViUD?M.̍L( ! 8"kC0C:E鰥2#̷E8YPh0 @{ OHV4`@vgyK%>nw;o[ԇ0ͯI, y ]TŚ[BOt1rb۽x&jq34HHa~WNPxX'IH;ZhMZuC\Ɏ#%*\%Po*ppVڒH:dgXȩ.^jC nrRd乔" 4>Ru *œ2Hq E6S<'gKY+(4T}C 9c\-OsMUgLl˾M[StM۪4E>i]d˲һH/qє3UZtb\ _ӏ^ / 7#g PB +lRk#8TCFZ=> }6~pܧG,m}@K$?<%ǐ?}YtsB>%Ȏ]\iW/LITbj5B??}P]cj+Zxf"[nϡBq|ԻjD=PsȢVݏ7ȥ Y&{h*b*1_1LdtAzE48rBb>;Q}rœvL=H=oN9LĬ/g8j[ВIppQi\M?B*.+(ŽE"/-NQe?DYOoX al7dF,b #vhx|G YAxZO\#W5R %11LoԻڋuqp+4טs4uoХ}?uߚQAf"qDDҒmHXGEpIۄQmk9!q Rc9fDfL a\0x%[cw PK`<.fPc RhMj 䡒/50-"Uw(C{ )%H1Hs"V_kpw. 1Ҽ\m\HML`` Fz+h {a7QNkrM]fn_zy.o]@zG6^TϋۭI>T!~ݮ !TX1 7Nqkx!c"s4<ܸVU;yw'mZqR}HAJ7+q#Mׅ _AL na*xx04 XullȎcsUjoA7~WEB5%I%>(;g:m"7jyM08_R멄]<ąE&ȟdf!4 )BƏۀNE[uwt>œV0_uOna ǬM)u տKg 5՟O5Z~/q"!jBٌNd=KJиI\RgKnM< g5޼fߐK%Iu[ڼ U.i+bQxnC$:A:|X {)Z쪧pN %/fűطs@'3%\ê-ހN3~R}P6˙J'D pzP-ZUD Qx5 "Y3ZXbsR.VBFIDY̰ lYFW;?V R0j`d$ifi= 7*B+_ivo-dd [sJbm|N){Sai#wcW_ lZEYl|ۜw13?bNz:'gn:Xi3=6N"`Zg7|xNʛ HA'>!pt\QyЃza>HT}΍eHPX᏿M|LJ, m8kюQ~v$! ˇ 1)d'5ٮQ3ϼX-rޞ8ۣ!޽q ǵg\2=!CR.춀N7 V{l@ʗvaI>;ɽ"7x X VH& #_-GhEcx2#`,/i#قuf?7}H%C-gi7<uF  _ h v 6A;̑m͠ 8zCjf\%1diL}wPɢ6i`]>8]%)Qg{Z'S Z *6~"^M8=GfYNPL;bȺà6Rz_O=Zs ʉ,CmH%Yn~ݪYW٢Z4J\hPll?E7TaJ&BӉ=VdFel{5+HLDGii몖ΧHoߪim$Jg׏O{g^7c@/QUbhJ5*˳EM:O8{+TpNՇ +ǀs@(s@nrֻۮ 6),Q̭i1 5fNKymg[`s\^K ʲUev:^^-αVTWgRSRMJG,&&t{MKpvs>9=ד.iDE q)iY+<njyn4gSȅ!h=N!7GudK°~?F7Mے<įe$[iqN*٭4U˃A4ZB:~a_ʣ/.%>*ly􉎸  GX& 6h5(3k1t#]vh oWϿ*>9j A)oI~1ztq@]?Jh9Q|B(+:/^SrV{/!W?>՚15.C,ҩK Fr^9=N'эtzWSEhjû|8Mńy[wz ^oV^ɔb/[ݻ/&]Z(Jvwo9Lj<+ F'3=U.\V,@)R-Z .mwr+gMJk@'4+a91mBhdt'JNd(x`VN;.I\T֧kvkT3:5z> JO!||L/b?|\Om 7j iЏZĊ=Dto6xGW6 vc.7pw8^DUP9v!8Ui-]:֌"0g8 sM^|m{ydFXSi. Vq;-\әVQEN=ʄA"`74%> ->ܿ+ |8K Oy aj1|uSܾcX(DEaa艭7z+@ ļ{E+'FR\~'-z: 37dn6ǺhwE}!A3494 2Vr|]ЗCߋUewxR@!~LhTMO?\9 `@* P@gt,؜V?@=!ѵBhw)᧍׮L\[ڶDQ1 Hnc7>˪ꑻsIYfB(ʏ^nJ}A9)yA8_ N w)fB*Z2)66}lN(jZ$IXS4%/S ,PESZu6;&Sc'kfw<)Tz@Ҙt<ʉԠW{MF-ۅޞlK-NfOZcbayt#b6ZƃFzUIv`>5~)tɭ]8!=PphE\5b w^wN}Xm]W=']‹]_Zݕ],7{{Bd'yF}%$UxTLeN«UלqfD+ӣ9o"F@'OE~P}i2b |Kdzk՚<۔uZ'Mo*qlG"혐& .2g*%"ss#UI*dv2H,5iKtVnyWڂ*4Z P{R8̡ VFM8>Ը]Ič{A3s8L=!i;2,`ӯ'`GNܩHduwS}Ն>wB7s}Fhƀ)I~<m.Lu{nZBb+ģt%@ ͉&?G-/Я0[֊6hwؠEGc["[H=H;o-Ք(dAлDK|ju1ˎ>ȒÃr"#ZZto5"^݀Zߐֱک{s(3rov̭2^WAc*n wPs2fV .B&a F3OK+[YI0Pf˒U 6 2V)D'n˱C"@} bP9e6!: Ksج5 R{nc ifA{;#;ys Vhw"'~x9̍{}1Sdz0A]_Pc%Dz8{3IKj3-sVSAS< hf)I(|u'r?66,r)V떗hdY:n"+*O|=Eݩ܌*#_mB?0^^U5G3qSKFe.[x ^i#J$ jIO9 JF\dG9 &͕ p(L@jƏ|6x3߹=WeTMzx-2m CdKRk1egB3-j<< sz4G<ޫ{ 1xLoF!bx8bǏD](>ëqp_)o/xzlv?׵Js!d>vY[n}&Eg8t'A`8ǡ :°߯Zc4.Nu?$ZVCZ6᥮3$ aym F.I@k7 LOOt\NöOEYDYetBڇ=#^ ss I= ra_=IDBYxߝT[>bqfĸsxY7ॏ}~PgDOn6^Jd\gjQ7gBS2yxND83Qju-; NdudY0t+<ՠjӾQf1x DZsq?<4J>%c[WϐOYo>nBO~ڹ5?9uI,}BcV# 70[]p}p@+K==𤵇Mtw2LV`iYVq_[ocU/6'BEӪ/:O o?n:/Ӳ,1*vД f{DAHUvadr AUMV=M(1#4 @)!}F+~rʖZú(5BO=aA~ [ř徖;CoY!'NY8O/8e#N O)E71r2CRV'Z }6sbN9rqbPrΨ3wC1ӿuy;1ll'@@'"B;H]V@MlmȜHN (z*>p% G Vf.ZB3w#}m4_ediw֍޶5)d]h䦴^ h|_!P9nnzVnM9IG@K&_IJ$>pX-mr{\D'd- 4Ăm3"%پV^wmo[larUоyަU0,Wߚ q ' ֪5lҠ Ӹ3܎OUԙfί GGJ@i a9FFÁ/O\IUI61@HJ]3~C? edJ0HD 1bedD&-9CD7hΎEgG_&[fv,B沦1k5mP3`}F";ChKGlG_W-'))ٽ8i&[F)p@0AƖHjpe}䟨qpy Q;5$[ ak$yc0$J)Fj,r0 lPϠt}M>}i ][>@O""}%RS<%':5tauUO7'"7Y 4ķnNЮz9ZN#&WKZ@:8F&`"+N⥻R{熿ȋpJ ɮJJ@?䡭#{rT7vjCr>qAi 3ԈKѤ|ISZzs-hȷNi@dm(WHiSX2\u৮ o;---W%Cg& ƫV$4Pxa WE n(Y 3~θMb?!i2t?ڥ6a5j7AEIajH()+Jҥ$a]?.YdC$VFq0}ÝNE#8].LC.'Fsq)N;wMrԲK̑{[dӆ, G芖-SN5֫ f*M'm6T|`晘V:9:{&Ѫ83AD, h<̽]{^u{G>He@Ot44d(*YRO>$tB7Cv3]B˒j#*2o Vi7 DeH@5'Jr9:nkiirw:^1QCP=P0K -jy S=f+91L;Vƻκ1b44`([:|n )TCPq  Ȭz d4e #>Tw<ҐRw!D+Z)륿9\XQAR[Pk^?guē =B`k@![Ȳ0 龂tTFKE8,.+|87!dFsq!sy'JGq4'Ic D>R{VD!23br>'-84{ц^OK?63K*r*][X1FK@ͬ sL{A!.Wy AcpEt-0^Zk z<8˾aբP}7~ @oY 5ĕ- w98+7k ; Cnj.de}^dp2=4fFbm=ԇtTI7ndO您YHc䆎+,+dpBO, RT4-Ȼx06I՝?Цf ] MeTG%“(EX%c\iSX+ɬ|kC=ŗ׹X8 vxع(X' CorIF #ɧ pQd.<"&E.4"|0 3sٍ/H_ XrLL# D#1'(n_BA}d %Sc\d rԀe8j&o V; X*BvM4A8UgfZV|1B>e\sF\bREEs'Y*dE1' Dhbh>}_VeiAO?#i~Mg@5z$:ߝ, ҾT~Ɣ8 *3ݜV|4tGʂV_uDA [s+[wB3B5>jlD4ڟ0G3!͏. 0đ.k&ӆwAq?Mf ||фVݩIJ=蜀Ƹ< jc` q,{"M`qhfo,oHM__Sr,U8W#h DW]J/KM7|@AF$_㛆{gZۦޟDqvxZ)؂L}/DK?hAAǨq##WrYS&]򃃱wjl}gTԳ@'.w_50Tn-ArdeϽ–oW:jK`0ΕTGG]oODH!yeo7qiobi {o^fjlrڰeMԺ7?5QBpgaH mS`!8m]2(V<[KɎ$(oxJ'2 0ʔ&FyB#/{=vf@h[]!z-eIh=mI1"Ksʻ ʙ/\<.UjnAX_ϊV@Ġ݂j&ȜB0>ug4tZmZ m{vǘw iIӉH=R`}==w48W^*moIwAUz_?~>YgNWZ SנmAl~3b%?{àl_'z@;_<FHA獜bڦR S.N}'X!uUK6(bIS|.đjj|9AΧ 㻥3(i͒#O_Am|h]L )s~4%5w o4NfPG8߭|_t3_̇7ly}䓌"FueCKߚ^^/T7@}ZhS?ύ2~lc|/}!wٙ 4fT֣زոՃPJs& t}yJ(] S !e&2 xj&J;aNa;K!\H&fNd1 R56BXԒлނp$VZ//6]٘K^'BWvr O:@;Y$ S@ʜZu|Eҝ%/I3!W%187mB"/dzO( *,8XF]ΨXvR%2FPu\HvW,N-G^} xkwϒoa5RR6!杀=GRo]LwL{\AVI=&%Dc8]l]14 &J ?:i3"#Iz!+HLؙsaY2eSȋuljf/y>m-8P#/$IO9C!*)0UҰPA8 ɸA FOnޒ.BDF1~ԅ%ټKkWu,JL3MQz]ӓ(n.usme `i%ޣ!Sj& 9K w$oXW4|%rݢ6-M㓆ZFFt FY6f'Uwb UV8"kr-k]Pq|<rS5ˮ9މmb` @-[[ h)0&7gM{gA+tX,qKOW OCcTHacQon& ӹz}NB p$Ag2/ߩes2wevIUj W݀y7 ݌NԴVvu4k-6,yHK)sJ@a]U8;9UbU ӵ3 zB%;i U 纹*{59EFNZ t;pI4wUO ijܗa74h•'2M GzJ@tZStע: S)U)xn*7d< h;5m5Hc,vnrܨkƲT. ".3ZV[+rzwU1j<8Z.wjdq8;pYK?zlVQEK57sSrJBlh*4.ЉL?",1޿oRD(PGV~Qoi#@AInV>nP#3[|V++YbUљN H^ti5!)=Ae6vPSux:vmf2ع Bm婹5멟\6^ @x]oTZBќ6 cMDh:Y+wFbEԃe9}՜ ?[*ubޞTB6@ӽ= >ז"FJubN4t|E]ld΂[U'Tz"Փ"= rzq(ă&W0l]qOh(>yq 𮪞]׫ӷduQ|5nԟ1_Pϲhf[ijH_as |ăK@ÑֲoiP-Wݝ';@avz+> ] dzBJ֠ȓlHnJ"3hoqz{k5f|YYk.JY-L*r%fæfc_(iׁ,[xxP6P靐[-Uԕ㵓PH Ӓ$,d|m$I/4 5%~S^3Mn1٫ A>DVXW#RܘP҄>|I!LZC5 V7 \~߇{Sѫwxh%qՅ8}9#Y!K%g3M5FP[;8iw5%԰~:ٌUE|Y*V%+g.e5Wbv9,aBʽwoHفQ]Mf[D*i+*XE}"j襎Yv2^F:v1ֆh@O7Jĭhnכc=!*HcvN=eQ޼]xNC_aԤ*U>4,bƯo>&ƑwP?zݡ21Q@נ/\ 7׼H]n"@6|H@ '!a~ z0PS94hi:! @f2 =(5 x.4} _J'~9Y=_5 )M(i,4gK{ppt}ƕ@9v$ ?45f5Ϫ#G Y&>t'xc Yt+2{" uEZi%Y VY^1Oِl70Ek#y[`/!Wcϳn6 \*H rk &@]f:dF c,Ԁ L vaDsPMxBy9u|Pе U%\7`vR(tmחa#\IZ*8o~FѬJDdGx) Ѥn Z TiHeDP:h~W3߮ bE`t"TTBu#s*i )~_b=K>D+Z$灲1UR}dN^c+[o+`u6َS7Ģ_R%ptnIY:3iȘR5+-V>>P{g']٭O<#`Y^|]zH"_|ʢUmӑYB킼ˉjWSsjc$qq/,(lBh,?33/cs㓧e( r~"~΍V27\J2B!}1֚p7!n'7]b]ԡ2~ʔa=S ؜J\'DG˜M2֢9rZ!wJ4F-S @VÝ!ЬdBG֭Z*t:R\2< 4|;̽z#!ÿ쬄ݵ_rc_ӏ8^DF P&7%'T5wԭ8P04Wl8q1;U:#iz;Txk@CPABJfVw( "v'uپHbyx0*M6ɼǑ^G,`w.QmFa@ё~BZ5a~x|u(90@Ok@3^%7d uûQ(v2qy i w8tE@_Zx:WONzrABw$>r+quWlyOV$̪u!j)޹2T#{,nNjOiႥfmJ)0ЛC Wyzwqٹņi1Rv=m _4v :"tP6 8CtEq2>⩧Y5NzD/v9 ^2☺~$їyO9EE,~Gw]#51h9 /j0y$U-@'Ɔ?ť704GHv#N n\-fo_xG'bT#2&J-1 62?Bhx:M<8, F-1ȋfI1hu˳2!Y\$<ڥLh2GYN7;WP )Dg@ 0g%O3Fq;\|妆Ģ;9/[w-t?Pƚںۅ+E y$f Hz8ܠQk=v 6dG'݋B*+-hF}&YQ V[q3ȮѤ.1445#|G38Sip}:ø8NnO[Wxy('kp\N+(E|G<[7MYpfI\jF|nu%ԮS$0lM[Bt],徚X65nV51[\#K~|SHhn{ddV@92URsyzQU5,2fUFpn W$? Ϧ"Պv/d3נ~X=/-B̒?ʙ˓nB+2ʖtMțы }qE}0eD˂Gن@JxGg,4e O|9b=R#"Rx J. S?'Bqٽ>h^9#62P Q~}0/<Ԡ#_GLjE8xn8z1ypA&(&hxcuntkY!Ynキ2oVѯbKvHD';c|r9r}~tɚ]d>iaSQ4.jM˕0YGY͵df3 Y*9\Ɨǟ-T 6Hgލo0ő)=ɁW+0gcsC?}!&(]! ee־>7R/ !l+ڞ"%Z@Elr`@X^D#QO#Qp5X5#zqCƐM*Jy][2dNd5y7˻5(tշ݀<(Zv7++;!Mk[Z !^sg{U}My1@Aѫ ? MFK&#NA#r"%83Bu=tȷ]F [؄r++32r#qNUM1x=z 6M>2{GܣQ@ٱpck%og@d԰n`j)qNvhkxBjKc|„ >cݜ*{#%"rhHJ=kpsGFb7L0, ,ؚက]FxgCiM(G|ʮI(6??w0ŧuԢGO1M?ڧ VOPO'W㐊-U'(rR<R+雞&G)whJ|ۋq=] >=I|q{fL?D:%luBʯ]" Dx6qS>T1oYZWbT3oʢAL̰<)܁Z]Ay+z 3qq '|sEZ^֏ja)&~Ek^t(8KA(*~zSE;cZϸv۫-Pv5 ,j~\^[W C?_ZT:76 ~zZAÓLMa.Gk(0nó5j$V6 T`;O>e`[RIA60ZТE jy {,՞XY ?AICoƽ2МE/‡Eϧf՟k?5Xt|[dW^*ՓΕ=H-VIN®%TQP\nrFzlDו^&bk"RF>b!ǯYlAYNXTrK”N-Ca\rV7b,4i|'Oɲ(>mBhRTx }k/coe#ŲӼgCW y$fOH_Cgtd<^\O~{8F}Ixuuݼikكb==xt-Ϭ~t}z.B;^4IUf"[rVw_,Bl R瞕t#*&Vԝ`oIj"ekiOF[) i>6Rq# yggnxi.Dq7@S4v9gD`-VHJ'6pXwG'nBn=S3-U$ S3KN<`m^f H͡6< VS R@+Ўt@DfȬ^5ec+]5LY<7j`ۅt-,\] F.#=B>'PAdBoXgDa# s|ܨ@Đ/ pOR2E;by٦)n]DR/[HxĤ|gBCxJ潦2)DArafZT!˴(;)!JHk@F@zШH=A^xc9 0abWM)a}Uj"R>ܝ^KM>51jkNwa$2o8;@V!euߦ0DtKxNUԘU+|^497P@wۥܽRG8}\D]sQJsl8˚"oFN=- j"O2j{żȀ#}vrhyodY.~ sY7OE'^ Y#E %0baݷhc)gs2) aB5OIકjCS+h d~ՁX4J&3R߷잒dȌ`;G2"|1lfwsSUBS6J^)1sׂH8%%;jQ $xv2mD^ѤUhBD$^R-QA>Oڷ572iFP}ib\eT/f>w[4iF$94 wY[hܠZS)eXe;pk5RUP'2T`lNilډV"dB (¯H]q[!?Q_`w_ZM"b@\`V|U[.IQVbHJ|Ѻ6(+ qT$!c%^/* .]Z* ځs8җ`xp&pW|t}vs(Ĩ^=,Dtt,.*Ve:-'BXMʔ"e~kR^H {vɎ]K69UN]1EY{q!2'qb\ɫ~|bFyF[4a+ۋ As==  =–$sI+Tdv@c*- 0g+)j. <׶<3S!Vò:Dl46fx?S6 ;CU4}3RNǨ(W! "@5=VNjͬR)ב U2@GUxFxC0]p#}"0XG|BLC凜-q8$O{X?v=h-Pv,E`JVh֬# u y{Ԭ=s$pe}.W*BQ4@z=O-H'/\g+IC ;Sa'J_p+uW"+Fdd%PG`K# VoZ1nR"?haHf䔳6)fɻu?9>%7ܫP8=e9_=y{Yo#WeI)q訕>\205?0?RIMjJO=jVؠГM RhKWshz-a7;']u@\$zfz_/uڕyB[ш> 8}-O^D AOr dۧ$ixk6 <::DЃ*K a'-&UUb˲Hz6` FvN#8a?AcTu J˓(my#N¿_pyan5F;@g0У>s([@-ګ I qT2{ t\Hwf-=cH\7PQ!K{gK&}C?8*uΜO]+4yB:TҦ `5&%'D&7oƚ2Z%ڧjB]G ,i$y^k5xp1 6p@?[.C9 -h'y{^V t=/ypy)^D iKҒ38$3a[Zk쵌OMpap(S`UFEjj}Ş{ۺnRH 8^Lucvɽw;Ykn|{O]FU]_w+otk)vGR k9dцv(̩+8^P~MvkʭE\r* Q`d8/p}0zxuرh(imT _i!yAuoh-?Rt'F;1 ;;K,dOsFKRd颕RYL/IMS&cx,lvf3%OHG4yT5`*;#FIK  l-;e zi%S=Ǵ):T X oڛΝYBL+r#!=@e9)}?58V&M87Krp|OH)}R =8(N?_A c&w'l}y_H ]\些PgH3WZt >HĨx&gvSP_Y`V]Ja]I~\&6cҔ}ѷ;TKToHKp(;h`Td7 eoGU,#xA5ku>NOVZ >CT7{e5Pb>"j}>I#VmؾLc|S:B-|.$A4 ko]|Zі>bUAZV uW((Q³.!a> #h?rꑙuO0򫄀#Y!(ND$.ʠ>:ZA5ԝ.@5%.uPKunڠtH,zםg8-p5%c8M:%&6Uh[Q3둻NG(]}eTeLYz(kh[ ̽CL1kW֋;0P>&b c1*-Uq]}Kj9u,qeu &-s6Ŕ8oq%B,q%%<5  ϓ 0nB+knJT.%W(.Pr^$2'ݒKlCki, Jtx Zbi\c* =nW3F)u&q+XS @{]EaH1EZzzLqjM!N5!pwg|}@i@<,>崚N$,X;EDf Wr]Ƣ(ia6aMv$iU%('Oe&2 FjR 5& SiZǵ7@$W\dy&a 6s|vdn&_G9MHA}Zk~B"ޜ֛N~Z3Ké㼟5 te0_Ãvk,p`_ #?4-k+ԬDg6f BegYf. 6DA9N& +!ǶBQIϻ>UIo*GoE1jPN&CSJE'fE,RCv$ʚ$k":+ᶝU2ĵ[AoƓx)pdjEԆs9<1_ebS!XYSSS纼dYrX"߱!5sY)(d-ݯ]5uP88 sXSە!oжߜB)i7ffr]|+uJ8VJnXRdF:18R(pJG균t_q:&>nBg-qby{b׎Bby.T91UY)z˿SΈ1B;kMsd+Q\}o}kpQFHY=3a:4-3c۸9ˇ+tA;lrofeAWߪy .ÖuJgc!.~B'.h@mB ?ZL{qF}2!2wą32WԵ,)nm+SU!c*hBh~ʳ2?Ivga~.d?M:jti*EKq>AzH6=R}cnUA*x\׃GvL&v]7`Nʩjۍ1l=]l3қ$\63Vtu/t  3d ߪCаIvf@3CzޫFqgLGeOjԣJ1ݏ Tmy~} h^j@ck.Bi#rduu_[zt4 (@@7?fMA'kngX;AY!@;w7рEٗ@VqȎrCsUi8A 5SLY4Է{ ι?ɛb&=AI!N4f>j6*2 _zU;lKf:IԺR V`G䤮XOR =009'U[BeYWgֆ9>'Mj}8ogi>G䤝mj=wW> |*iv0z,Ұɏѝ~aRg8 ,;5(ps*رwE]H l4)馿n^o?*/M(rk zn{]QMYXJXĤ q2؊{E¢ ><7 aq LSM+e&$? z>!`rΏg[_ki: Ei Zo@_?a(r8c=%r> !PqcQ1|C%RϿ:X@FGP39 7t@hzsauͬ%pnSߓ65͙2}psTB')0TМ\ʂɽUoYBz:hW7P:r<1RL?0n>L2\9mR~otʒ#\Ά.\biu\!T֌?pCʸoꔵnwL!+((kx>Q>H#kw%dafFy"V2rSzBu*=/2ޚC)$ekf3D?)fAޛΌ *n'KSҾ09mE@ROVBP4xk'D͊(/G iD).95nkާ^a!8XչO<HZ*kBєV^S̙HVv >jV? tB\]]TVyl[tT/uSYrwEW YZ )Le'peΆ8@Bzƪly[5/ًR<5<2WV>/3[be12%gȵ" *PvĻR6MUT*҉q_$Md3tuW/uO{Iv2 )C \ʦӏ9C/@1U zGxLƖXPmz+NCV"Ɲ8o<vjF( hzD4drIfOo??#KW ieͪ;Q   ' wE 69M52&=gqA/\Yhj@H߬bY;%to> -Z.t#m!Jq/G'݃Jaͫ$iVuh UP@c-r&}/pT{7))hn*2b`RB&ܔoCi4EdA?un nT6u-%Ȳ؇<5{ !!=fb 1e*F-bF74jX8Zʐx>9SKioˮ4}ËqYZ~au k _C\U\p²rf;zJ V3Mr' (>,7\J mJT.*܆/7oփhNh ATeLyVJm_"{=DCӟQ NeȻ1uDI֎1hWJdQ"Ӫ0tWLc/;+:f+Dƌu!hhQ~Rg8f N=(8Wxݾ[ubJiUˍqG (d/HZ6j{'xf3_[ޱ || ~ȅ %1mlMq{z#0ܵJQr^6>j&z A#Ixrr "r+6;,Ճ|ow^!1p)<, 9hxY0F\[#Y˝#럼V43$DZr4톄ZB&ٵ3Of\`H!](rͥ,ȣmQ$JyN%hT*@C~H{Q]:5a}cY6oKżʊuqVOhy؉~12CD.g4׳5MCw]ӄƵ`/ WӰI\ٝX,2h*5Zk)4BK-r< Sm&cC,!‘<%vn8u,p^( N6B nNQ,2xTm,g@y8"Ds[kL$@,ȥ %f֦Ϛ*]Ig w1v$/c5-((?47 qf/#4!B,l85|)d+SJsѩgD.>/zZ(`)OBG+ޡ|sӿNȢ:jܦ(>ZbJfyEᕪty2OGɔhSɑcF]?ƺ3,=xW6+Db(;ߚu<'3ΆKnwL+J-v~W!r`8žG!S| 9n8mnoCzIjnJ5;"ߘ^Eӷ |^dAv7 qaX9#B*އPH 4aJ/He,ܶ^/ЈKyՙ wVA *dx3WUJV\|X}hcmfѸ1n,MW+j_%7FSdO/D "5wr&j2TWN-(^Hps$`ZB@tnAf}, Cs]Db=,9ah[,'BT*:R49uۜi^bS͑VOu8Amj/lQt` -=b%ƁTⶑYǖKK_!"Yw'7VCɍm-@vCN`gmG}F}Ŷr /8X& XF]yڗ>AB?*%ƃpUNyP|NO\IM4U$ϒAru;t&lTQC2z5H C8g-k~*֫uh֫@;!vl Qy&lo\P)c7) >9g-pyG[H\ /мp]q  -;BﴫdҢ9Q{t#iB듖),a2UO&'ăSCbyn=Ml+w9sw9:=I{Gfd<ə-ޣ^0+?h0Z#%AaEe w*=3}H IZ=v4 {8EF$ *Ld`@0 ^zU#!IS7}vRY"4Nhޜ螩sKL쳴,f@["oO:{贡 {j4IqnXzYR7J$if0?q3+Xzד_v4VNq9P*O[IE@W^KGc ,cԇ]Z#J$1,S۵C+\^,:p(u*d ^E1Qh 7豑UZ/@w5 L, /8bNX<>7Д,,ƄmYU;y`9Ebɂ#ą\U!SiHHC4z:Bxnli}ud9T'7:՛\6 M2% *U{6#){'2~s ']*ԠkR}[}$4Sg 9峓o(5sm2] 8|Ps)injmq,\1܊&b5mɉ񾝳yH.p)DZҾCEs͐AFw RAHf ȡ7sM!̥9)K@ ‹JIp i7ܕHtz ȤY(=hP1I:9, 5G6q7|~Xi;$.ά٦r`y5cu Dr0{R_Gp<R4PE"StjYdm #{2]zN"iZIN<jDF1O ̀; *9)wt0\?] qdx ˩!n'>")i/WZSoNta(Dvr\@*%o[!gwP$w-3,r\sT{ Z(٩ eNeEcJn+n/9YkPjOQgvk:r#Dl{-h͔`+g_DNA- ;5|p\h˚U5O&"znQy6z[>Αo`CTPβZ;w]kj>smZuӍny[n7EI+S̀VX"*v?ș7fE֩pIDyG; Qr-4U}wCFuG'}WrWC*T 8fnCh㯜jSkPvb={DTAE/acAch<":I+#)#S}i09]bh`-uY]wWKY𔭳al袅FaqiY7p〲 W)-K!umON,N&o1t@3@jGhCjmUOăPz!kPYĩvJ2DD"9 "%A|& IqChxr\$e:^h|/ȟvNZHnY哐`13ƍUg`⳩:g#B6@ JNw'nXjs¹F/BBtSP+(C]EQ, RœYt->uQn:<G5& I!+ \y ;*߮bO(Io7eY>'6x3R "h bDčAv$H9O]C+|~1p8l8ѵlhZ'32X w(i3CܷG#}`vND`=c=A=ڽbdKFVX,d^>&Ky15 H޲?$:@羪pIחg $,dY]ߙl .@g{ 9VG ar_A ZuRn=NKmU|<,cAʊ{T ]%ncbM>{s 0{dM?hBtZtGNw[đ -/<ᢑz=~)kN9RTw}ox!EUqϝ,V MN)J# )vfH_~z=PTl-z<`MYݮ}\$@7 u_ή6`]pÝ]c+I}rW煷,sA גT =Wz}nqH{t߷DuV͢fea{W(I^=P>=?-xnGibѣe;㪃WO>'Ѿy-Fk$0/ףy{PO*͐{_4&kӲVod kr{ڨnv2 Λ"\a7)*ԛOsxQѦō,jFzѐxY Tۃk:7;! S{O$6dfyP@?A'-#${C $gs}.Quѳ"3MŃ19zA5JEgx~;}O􀖛?r+InW2I-hvk}j4O)#{J(Hv0wzB}),'û2*<- O}<-3j1H ; $l_H?^`5YpmɈ}~;v YTT*8_z$H|C*QW ; sG!ӡ O`5K/(*uZ)$js$O7FeZ /D(qcxW^' +(ʼn:B(xXY29CK?Uv(I Ry!ppM~5C +,>H@q:A0N+"$ERNKjO\ۊNAH\ ɱXhn8#z=wߣT5zHƙ1Klt5i4hka6OC[?)V|3-4p*fs5n–@%$cbJ\Gh^zM&c&=;6#2P;DƲV~0 }U8OiU8i79v#= /V3&5״{3((?J2EGAfqx籠"3"p f]EȌ&%-ͯ8XA#f13 $>1 bO>P nDA^VmU?!BQW('. W !rܲ@ u~Jd@9;M2"[k ejZBò`wqV^Ʒsoz{xx./ɓbiޞpBɌ,䡨 2j<Ÿi'- ^H1^C ZAh*%̎he;^8x Et0 @f!x~Ti3@ZN*şw-f8ofi:4Hs׼?JuQikuIJs-4r:$҇voL~~pv@хaC[b㒴<*5E0<@dUk/*7DP"ky5]z3ѶR \$4!-L&yЂd݄,qz@Z%߇W72-Ѡ+H/.rP.҉XP$C3fD81j1AXsy 0A=5U 1@, 6-$=7J-"_1ܫLG r#hXaYArg;dF uxx/^@sw1[ЂB8Ršk"NC_(JrDM"2C:!#q"0 EFƨ`|_^!d&TZrW!-Pj4C!Qt=sӀ%z.̠9qWr9u1H,jQV K)G@&kr׊ W΁qgdl§J9RBYnRt֣E8@YKuR\rGRB+яkY kGYaG >~PYW y4E5d> Aj{5@ʁpO!}vF>3`Wz %lbhToLև N̯@q#FϊdG(> 9/!_]K)jG!MC'e#7P\ -=e%2[Ľ8?`~ j !\k.&_p.OiD 珜8s $Ԟ\ Ov 5}VY9v6 bWwQC y =WyfIW8bۃ.B3" THE.eMV/.LqޖBV؆Q4xDr)$ HτCyEys2B OȊWѫn+d*g`LY f>qfb{xPU鉮J̛aL ttuϚ%o2 .IzNnFUۭl8i aO&}9ix\ s/-j aI:e9EnsB?-]IrXMaʩ(kj9v )wBSVx}@B`tQHFR]+USHƇ*CGs rlon߯`1+Bnw@.#?Dkȉ&¹>3/P f 0.70& ]!MBMO{دdS^d8tFs;ys?وObВ7EgpLb%(& %&2INd,3dVy:5W!r\`Cי&BAG~۴T!} dߐ`Jt>[< Ѻl =P4٪bLG}8[HQ@TAjɘq2r'q"DD;ڹJ](1c*M{@N'VQJ]6WZ" cv`r0 :yՄ/ۆI {1єlo =ZP4 nVJ TQF2#5DTHPL0M"Ai!ݵq;NCÐĄi% h7|Zl-dgsgW(zVH,MGJ}ð}oP'RFe(a|3 ӭʿi +ۂ7UwuHr-o?CTڹ)ZDXkoL_٘nj~29HE% 3FH272uv 6X%bF~l|ѭ񖏏3h]$lP- Ypsbnwn!/0/FY5F @\т0E nG(Y\9팳~U&T4 3# R??҂<YM XrGmz L?Ez}Ntwnu2)s|^0Mk9Q|M0Jw…VE(ȳ_CgFhX5eaΠvq3<+xÞºpr^@I^1A6rKb~|ʺ\YdXsMq+!6\L"=7xFMҦbT=]X Ch^y+1MS=wu!u7F0lw#|HTHIF⼿s ?4HrL|BG40X>d\ -dd ɼmW` ;a;t[&չ@װ XչDnp7'#DǥA)װ#U'C4-*}+WoH [KV.шߴaߔ5Ė7@ jMhyF͢:9Co3-<Jg&_&:&ƫj:E/|kڀ 焾wdi";]}jC@jk1DAE4"M!a B†m7#)#W1mͿE;:~!@H -g 6 =RÆWT\]YHNXbo}Vt;uyA >o_sa~D8LKFOe,GO>_$I3.af OKwW͍}%%xDv=&JAJy|7H._~ QI8x1ew,>!C2UZ "=Qgv&% {q39NygȜ@*A4i[ G_c џ5`U9,Id}rŬ;ݴ5)GH=qK ICGTϽ} 2 c#xJEUo6$'I~tH&Q$_Uw41ىpih34+A- mǪ%lnnԼ$;McDҕ8í.G"LpkYƭ᣺81V{T BJǖ:lc퍚P'$ζjjdI4~ÝkjO`z"h2& ʛ 8W*d&]'MFR׸Ĉ۷'R( 22 +` U8؋z M$ (*G n.`@N^DUnut& zjS][oBHc UXP!$ƪ1G%jßR-YTB+Un \_\)r =v $2pG [_**49@9=2?O]}OsAvbc 0/w"J4HT@vsgiL/MDAv-2#sI/AF?7?1)PJpH}FT~: dD/jCQ?Tch,B(BR+Bg$F1sI] `vVE13AnuXZZ"B5Ws~&V %t.gN R-ua2n@^9~=ןfL2uP͈2%t|L zмFr2.5 hX>l[>IL7!Ҡ[Gܗ=llQH 0fﴤ]ÔdBOJHq@jV r:|o*bb dմnA{_"uh7w7hVnS~PY-ZWVmqG]?J6o>$bO ">5M赽ӛUAwԇ ܮVRhlϻPY&qK}q s'Fгe5(%(ƓqljAPkzߤ}v q`̠U\HE틙x絛.6h?HF\wDxk Я zL$A %|4G.Yz @>KtecNhS F{&?kH@?ѲA0Xz<:3d\ZYӪ-}=W T(<-wp} 2CM,JF~IFcD{nd64҄&ihc˴zꆤl2nC[k 9sl̴8F% QPBIoec%zr a%BgZW80iRv:l&K" kƼ0 3dWCv y.󙄺^+!p,h{LHwqhuO^3R2W>-wBV* ^C s*iqw `BkzwU`cjw|U*?^] 'ffQ8x݄*+2xi'߀f4}. U3/ՓX{5$d@tzu\W[e)ѭ%Ě@*W9n I`4 !ϪΕ܎9Bwf+{th9Rv, PӬb D Z3zh?Тt? ZfWFFʿ.,\y~C_urT"8Z9%~ )ʣG扆vI~nBQޚ7U'Ma0Vuڽ%el* {9Ƞ xK8Eܫf>QN6!= )pOa ?[o%/߃5ml qrQg0Z>H.8K (Ւ6v'4J$Od- .`b[#4o[%Wsmrm!wm: iB0k<񭮦u$~-lzk;a30K 1spv}R#h %G|#ZE~6N'lss3H3#RsQU0ɖ|~#C-K@upۖ/f͵(n?tV-Z#}4vjUGz%2$8^qYh!*=ô_?VkF| :)Dn虵GZ)'UVl;y"Z*OAJB;ߦ!~־-Nyw%*HB+;.UŤ>i`(Bwv||1b96θdFth2&f ;}BxdUkЙ}'O\qU`QO/w(صSwMN$F@-`Pƿ5Q 2P mMw΄T#LnI%x`ʯ`ŀ` N3m5iMpc|365;]QʯsL(ChZ橌Mv!^~;]Y^F0PZMx{*cWv>&\@7zx=?YUI}eKσ(E 䣇;=hM("]A\%K e-; w9uF_| ›tϮ1 ЬÈ a-y:R/ :=Tr1!~JWK j;fFt +ƏUOoHΆF)&qOf F,`u4&d6sYgԬ=%!N^2#3gD_BGErD5}UJ^Il)N"zc4\!_Θ9m;@X"4ӜEۺ&:Bx Z47vWP/k`_6W8}݂<*fT|^/O2jGX{,<|bQӂ12W}C+8ao6O଍0ƈ,`X!G Cz~*a^cE^g[4[#CRƠ&s'jFs5̪n*VP/?jH@[u1֎v]q57 ]hNU᥺\M`HDT6EQ+q<{;/(.8*aEjdbbx4j*4;AYmx$6&8ڃ !1-s Je֪`U qYBkL>Wt&YUq}ꏜ-8pL~4_MA@*;2Ҍ W,9ϺO1hrq{٥@DF%Z@eo'ȰO!fŵ`i͇,oA@ ^yyvu*_8SZ-5$UJnQ)H0U0+#b}~b-ڠ0Īl{YjM2;F/k#^6ZNS{{zK0:S?wi^x{kO VmO1?rfʏ*GA]B%2@y &9 mR ~(hI`:U7![SU hZqgי|JC[v]b!3G>KAC;[֘&C`V*Vg"杛꽠w6=;s)@&5жO/"PmQ?wInS2 `:/ K"(`$<1G- & I!dVdL<&]tŘ)E4?Q {^΂V%`xYfࢣ=zN%qhE@^fBkE(QVB \Mq;/@τ|0^&gd/R+0H2O "᦯CpM;C/ě$botѰ潥÷,hӠE9\GB?GFrB'ث^[eގ<5r sH?%v]PQϙ 6ZrXl)0/tto=3 Xh0*+,oKRbP^E:p3H] Cd}mmuCyG %oV;%!Zi,zv8wJL"@ 5Z22C4@!w컱:gM9@CjsjV D(gAIhC cDeRhqU1=^DN>[@]fpm|W@R#T;Eve۲.@"~7AXNIg/dr$~%snՉ'Ƙ킆Kɍ+ Lͪ,uzqF\~v0&M钑Ё` I(Dh m>@1ܳ0ٜ^7+DJh^9z^@کE,@rugGϷaƪ5EvɽO2QMnS{QV5"mZyԙN*vY=7檕:Xh'=/fI& ]hY繛%O6BYs ! FvXk^krq.]F0 _w wjdip& gmT:ɗv$K)Yv5zUM:>|lNe*N ǡBÝ4B]oqݜ2SڠoT䚅Pj]֓";*uߞ Ğ3yV uG t8rvֳAaٹѽO=oP$8;`W+u+Y" XSTtm+(P}s(\AP$v) -dec %S y7n#/p hc6KuWPe7o_7*09i0$ qTCPV䛯2 "jKtOK*PH0[H1#5;e`ҩ{f]\PKZ]LsnʭeFvRօW{ZfHD쎧# Ȭ0c}2Ƚ~=h$ӄ٫=̹Լ1Մϫt>#<dI-{ rIb'y:EZ<éNi~Sw{_n",4dZ]_P[4ẗ́VZ@+)>4#vCNޘG;(~W㜂%%I?Y ;m}ΤA }JQ>ةB _ P 6: A֠ uottH (l͸w<3߄TX-j۠6iZxMU<'5<,Z],R!&a@ úX%F//I|A@EПZJ.H%2͓]SGj s~f$>7Aރ32C81͖hb<w.*^ꮋaeˡiI,kK&1W=q## :3dZzUgDZA8} Zk !DF-jt=(ͤVpXAPekС %>8wR# J%buG>9 ]Tp >V"1ɤDC; pfgZ*&bUw P^<`JweϚ Zg|U΂͌r_',tTA⋬㹖NzFg rq˦=B.%!;OB͏hL=gm8 G2tI*heǝ;CؠtF K2`H"?U-Ɏ¶6px7t66 qb4y1]@Wa@ .>zy!>lS2Ļ|!tQxg=rU}3:.ڢDNw'4[@KLJݨ>*NddR@*"jlfK Dm6#ےo~ :y =EUPq]Ͼ搸5`QYy"0#ɥvP&Don_> 2ʨѴ ԍf? -%J#gy@F{*J  Vj$1a4x _TXVUd&а-J [qcŨ%Uhw-uߖB8V$4jc {+zέiK{]ΤSW\VUoAC c 8^ejt"z~Al@ ͩZQ8&ۇ 09³P:I QY8G:ԍ\tf--lJ8SHVuC)V3A yot(9$GCgj*hΪUƑངbׇL_A4<嵻ܡ^bp@t48pZ'ϰiU8roR=,ĮOxho1̯Bsɕ@3+yM4.lϬw?;)~|#:l_ - Z BEw笰t^븃˹s?10~zMnDha]thG&qQ ~M&Lvw?cժ솚NkGLU WoziݢVw> cSBkb/M怱ab hӢSW!Շ֮HnfmկIe ;]Q~\'XapDYyG7K^հS)ׄ8=ksբ D!,-H/*ZL*W@%4N>Z)P &w4::h!ӂ2h?c@=C(O>r;TCMWEɴV_wHڪoHY@o/HG[g`t 9cՑ@jaԚGp_& twM c0Kq"W{ЛaYjij yyK 4Wۏ1Wۋd,H)H%!Av Ȓ8}?E #{ 5uj?D֑W3@EmH5mU S#'Ŗdh^BL8xɤkfHk JǤi+0K"O+I8i(cAE[D=-ƴ$@ 1&IQFa؁qm~׸fmN1S6F<4zFih":i)ߒQ?6rbȳHa <}xYQjk>O!G[@I(|#@4[w u7]C(jQ#طnfdBs@ `y]pz Ll]7xqw#S5Cg>.cg"剔PG0v}EA#?6u:DG6\du`cܼO:z gx|c~W:gNE[;,q'gl" hgA.Ү糉P6 6<˔d{J\:Bxɪ_6 +vwVH'R4UxYD]҉=̴ćYG zF.mE` NH./yz2dBRB\i|69IJNݠEviI2i:quׅ!=.3?B@+,E{5tAZr8rU;p2K$čN?Ko^K1T;9^Y/(ŢACW0yAV S]mW ,Ib#!vԾ6 )JeN7{iJkI1;M5Fg, H)"'_.r2bsJ fi<^Á j1ztӐA-^f;V{Zp{CǢsoD>Y H_Xn wKUO}GiV Ak0lj/j+ 3gOPms9jZ!@m1ܞwtjt5>AD3e^Ye 45{%2S}U1EP{ΗBiE;D46jY 3Y|&@ɹ~W#Q֮FU83b-jEC (g&#U_`pb3&LHom89 ϕE\;m$ 2f߁ZMpDߢKz@ϜTVprXlB% ry٘FKvina@^ԕߏb!|A/DT2|yW'@ D0q t%{ᶨdE>3VtF8$sJTHո_VE|f3j5o)C[ނgFjSQg+V:ځ(B L@w"tw'+.MĊϐ"-}wQQO5oĵk4~q2еG/ R%ᘊ vsh#}!~*y9+%|AʅDOZW YRDB \i"% GIL_ACe3vկ$2EمмP+xHܴ]Khmz#Fc]3C\A]Iot 2UDK&3QpQ0*B5e~z<-d%Fq-W4ώWP DH,x ݿot]WErUӕWmCvk{ٜ[CM Ƹɛ}ȁEAX`Ѿ9߮UfO+5ݡPZPg[j?ns3KB,w@DU*SMJg#dpFX(|=g)G{hBPVdd?[@;*lVC|γ !$7@ݧR4?ꛗueQd zE8P#W?ւ6o!}H~׶_g۟4p.2 3[A{N =:Cj;5Z@=vVۛ#3[JqZh[}n$Zu/Va, 4mp ͔̀FUN =J)FCďD?^9<~Fgаhy=BȊ|29pjy]kV-qlUӞg֞H⬽TТ2`Ig*;[@7>~"N؞h|/3+/yRL_F||3J! +cv÷w Nx#}vث6K5 Q?ᑑbLC9VȭLۣ o5e<㧚@?.̉GSqe$vx&+67S\CKl6x߉@+ڮ,Z]yj8 i)r< Hۦ ]kZE*d#d mEƛQX3/ŽB?f!GTz3=ͣTYY2]s_nܣOKD]~.=^e'HT;{.{hj-Vw_kv DsdLmU@%\2:%z)ۇ=xr[,(DIHIK1IRAJQC_{8BKvrQ2˕jGm#}]3nC]~mFZ#cis͒F{azx? {K4ԣ8<7';zguK#_N<S[)r1VaTq7se=uo 7j?Ukn^EyX_Á'Ի^Wҡ8T6!\Ma#n8`/ށ'lNM1p:0$yuD>42Ylr2oCbfAR- >s{<[I9sN@efˊ9fɲws}j5L)=e9/Xr Z{yX/Os<Q6G"V=#>nҭLggZ4,= [%:=_'pֻew 5=1,v#@qؐWTcmwPwxetlܯ ia22\݌\;<irី=ZWb&Frx%Ɩ3D}Z7)rAXpoLLpTQc1T79MOKΙ:]Z_Zc@{fx8N/n! gv(kp|N?ÔJRyr=bjXSFd`Ob][淓ף[g{\]4:UTS 3rO w0)=,FvPL`Jzܩ']"ș|hiƢq'a%~W6i)S K!GXU5 9@qy U8 |#7L`pvEENWI'"s/ ,g7/amĚG'ͫ*{C&bKG2[=_9j~WƁ^T7;PpvUm+QGdft@XZNcOh` q[<wQbK8+% r 6b= ;6`+85–!FGh y[u6/,v-".l3RN ( H ;->ډ︃w$8B>qwTZ4\';p[0K0D>% - C3՗U.E :+WYsÔ`F *T|%5RH^O6m2 WmW- c+n La;-<2?agc%\IsEVCZ\O^c #m  1"ˀ1' (Zc%Z[u8yaXP$;( hC rAl6K UACVc }BO=jC&yaVݹZ֎Yhvh5¥+ai 7j!G}N~Y6-ُѡ5xybrNG@Zxe8;p)Z.&n,0Q`{G<{ Y9MCF)磶g$MY/y=?,KdXx>9Zv$e!#jx? Yl9 ?eg+K~8qApT"7E Ņn j_6a 'Z1? zrLYKjLXxxYY覬"u(掺"rKU/S c.{1kWeU kȟ4Ò4n¢v{"&H4 B6uϼeV:5L4Eq RٖkPiFھkҭl^Dn47w]㹌OEmU~^NQY^}4 g8IzhFm(hϏQ]H_롫(4!KrXR|A1dRw'nyB!6j*bO 1aRi. 8ϯye1#|<lI? fbZ 9̹16:s[d3m[i#I *3E:0~kgȡԂ.$lύ8J:4z/ޖ|q^(dQ>l1 $ =sOĮEe||DLSp1`Rm;mϛgKAaAJ 2#:T[ddz'q,j_][Np.FF(.)iѵbria"C;~-t!i0x$ 0z aZ%-hNƨipLt,th]k8z9#*yy8\:g2?')NJ?:R QPDC-ڛ=]8b@C9.7@]IesUkMp&HOBuD">Aס-qh1 N CEʔ֐< $zM^PRɁw uPiٟq[S~+!_F!O5clfV*vcv[ uI;>'hw8(i@Y?;WV=ʡKC=@X+^GY"^L߽yt f2l6UZJm)K<$ 3CzVQ^,gr^FeP%*sEnGRPYW!_#T,۸#5z5~ vp@ ,h1.0qzk "WLtuFjwOֻJ)gTL)-Y_ŭ z0mSҳ]11q!:Iq}8 Hjv([Wv_c'ƒpdyމJap3[٬S_f)lL^UOOS2D oteT9 ZOt.A姡 CஶDZVj9՗Vr,jFaV& (Q)p&a':j_^3 )Wh&jVOңbaPJlfKb$Ԝ(-=sām *r[o?Փ14 \n: dv\)H1~Ht:+LE*Mz`B An!HǤ`xѱvx8JD/tGzwrDzx%%Y>W>q/>V|DM'\t{|Ӻys._3a~N%M9c ٗpޭ <1(f\~rجEIROW'l)eu)&آHWi_Mcz 0Ϧ3RG.6: \} fcLvL[9rVh v @/c+=k3s\\ y !=v ķ r '[.2D[3 Ǹμ2xNcWd 7δX1ۧfי)3v[1=fV~lw5?SևI]$X^8ǜ17Th M1j&d29N,)u}ʁuW3VȝЇ33u a+Xn `f|m̉}R(pqW~3xmNB83>g=EJZ̰0szY^nq&[{VF Y+]î&dAU''}aA_1rx,Aܒz.gZ3f^]h~ /V_w.ޢqֹۧ;4_5}V_geG80߅fڈ~nV&г>Wħo8s5>v^,,)!wo9ԪhfG~VS`iڻf3Xx巒[A75(_] ,lAKBz>BijBp'vX{c_Zw[uǨ344 E-A MBQ.HwR)wL9Bϳm\! u܈(ْcFHXg+5BLws_fH~K>=g-FRnqVn~QQn&VE1*seg\.D4:96&Pݑ얶s[cZ/[ʌ(-G*pڢv#cuPآg2Uhg{IK N^rGJi}8@<$^Ԯk^6Vq0p d\;_>tLK/p(;Y:VEe ٷ&3 MglN{yAԜ0 ΍zXRx3@ b=j3)md%<8ψmx1Kpsҫ>f>s?-*3g e1JdNyn?dUӬiߨ&>LĘ,kxFZ\[uAuL5sS<3d4q.sΌ,geg'\x#%wc&=# E߽=WS6(hSoCD ai 9t=Q3R}x "}5px Ge.J゛Tjb N)~/P;%U2}>Ggh\ǂs5ɳn^5*`)A;d۲݆-LߒD6;u:FhF4uF{ 9Q83UWNHlNJu;OغuY8.$lZw`o=rqwt-nJ^k G:s2(ֺl&%I5-yw/1a60wFaət ’7%~%~:+*lHgOe>/1K FVGik pIvU2r㜭+x{:`%ōTMT KaU b&>ûI,~iR$ju.0kZ{vLmU]2Z%*0C#d܇y3Yd78 ʆHs{cNGه_czQ(8an-j`vv1_&L℔/Cϊ-n^0;bcBpD`BrA&dYN \Ta1]3,ȖvdnjZ 7=`_4f-|CR8 x&GYa y4w=B+~gr$ eo+*C0X^ldLm͂[VGk}ɣ-xaf]b$efh2-,R2'cc?">NZL#ټ9275%cj-vf [7X(]; x'b*q.Cr}P |p;πK[x]+Ȯu׎ҥĜU0P6.I>pk$/EJﭸ%P$$A/-R )܇Qb] ֮^]5yw:lɲ)Dzqe" +>ٕu*kw[¶6j'⼫ >W=k.15fQ8l8S_@N )MWS$ֽ3@ߊBMu`fR0H 'UkBbJs6)Xկ(X PRXI(qMAP$26G2d\( 5TlFn2kڧW'x3C6R!ԐIC;:xrDһVq7F.8MEV 8d.yg6%'@/5$#E?I#d2|;az`M 4(F&kg'ЧPM`XBz?.r uYZh>nNZU(m*) D_k׵$*n377c ,tPG#&^ԟ6RS}/\`^Pʛeh4bo9X.LD8JFMl+Ia7βYS4Qc9L6&JZ,UsVLIZtz 3ܡf74MJ6܇^p=(^5ԐP*%f2QJe& 1Y{TO%Pm7T w"87͑C$F]t %`/]>y; ̩uqJ\Q))<)ͭ<1UwRUTQ O251|!XќIK#>V{{ՄΙ>"d 4 %:/wDKW]r1c{p ,7q}>/9 FyA]PЏ7R\E{r`=DߎiȐ͉}P٘9_5jNXpKe:[9atB$O|23a)4Z916EHpS^A|;? ߯Bo9u-JPo:3!! W@ N¢qioWf;p~=;i/H\oDB~E>vmNUs1HvN?pq@ oJ)8+!)E̒QX1bUW W۳1Z1^%ٵĶn+{Gծ)'#[U*A }m^뼋rr>5)wIzY-% v'T]Fl\F.Em?QW!,'"SU~c֭j$8O2=Ѯbftf8smoV/;4Gq^dqLM#F"@+P8*2AztPʬs8* &ڡJS̪ !󩱫XQAtJ8[('R j(."מ>fM~Yo场pxH?AG`Nqۊ5HdhNXD[GnW$/ r.&)oܑ"L# FΩ^G Y)vEXxORΩ/Z~t>6ӑy"m/K^"yoQ`jy@ljP*Y }rwqO)7v5+% 6_Iqv}zhYڥrqz/voЌڗ4]Tժ* tVzZS(Y, P#{ JLAմZv6~9% ch`M)Cte_[\va"7B>ݎYrw7M{CCg#nZ(Y ԍ^MT ӠFuS7lZiMg-o|R]yh۟H0oV`%;2{wSH\9#w۰|n)ũOC8\ϚlʑM5 -ڔU˗Vٝ> gmK7G nPݩbitPWz˦tPpf! >"-NCHGnl循c\}W0.jq5܆pꁁ:,~{X(ׯu9(_dy#ץdD]o~ioEnroLPlʫE]]} K?vC@} {4#>,*ٯ|ܾA&Ӱ6Q=3+ZaƟEY1L^}_3D !ͪgW Z4ݸE Lj5xeWz؜|σі1~d_)1 p[תصjvY}Ч\W6tUXZktb54dڪnW@`BlrpbzY`&jLQNϽD~.boår7cUk^EԶpNߘ"FGh%kSWL$iZ^8M."߱m92q.:]C/ mXDx|5W{Kzh"eVWEˆ+ЀGxA}H;+ 2z=PinaEcC !D6~BZ7˰~>/O8(˘H"3 D++Qx짼]"y,dC6ڋԧƬ#"7 $܈9 #]݉`ƪHDElRF[pG)& 2G!ɥTB[[e6$$@eH %",ל1[/ިn  c[e䣛So9{KrKIp 3RouUP+Mm 1590TC!Yhս"P8i o%v]]ŇXe_C>e IwfCnvZ6 QN0>;V%ڵ*W/'z~,kѾZ dqߤ.jp80:8Q+Brȇtri^PH@۲3)-v#OSjav4 .5"ӢԯMivX,fqjC*?עJF5T&EkU~ q[0x~ P͋~}'ֈYo/Fҩ|'ipߦZBYS9\0+!lٱVAoؔ ?EIkUfQ-~ jr yy~ix׺%'Tuz?ũuLWrElgR LdѠPQݺ5BW7SvZ'9g!^?Z)7KRjU}AZ [A@h:tzIA]T}ׅl> 5B?UTUbЙCDlBn&'O~`l7 CPpim/3}_8Waܝ?PMcO'v< ֫%cGG[!pbHĠI!]I×EfZy txZ{ 0\wbdzd@'.$HSP C57&@yysy|=DE߂ṕ9u/3Lʑ )2JՅ]]ǭ$10Tc6X*$.,"(Թ&fs2/jf45wY\c%Lb"Z)6f w,Fݜػ@B.%@k˷_ТZ hԻgϤRŬ`'*nO7!j fDG2¢B}J8dRaC gg&bPg:o(?MXUnS0CuO@꧘R(fO *mwSQ"mwOJuyZ,#.J2՟ xGcD -vu413LXS/GP!*,s7d)f)Lb)6Hb|ݚJI;Ĕ٭pyȶrz9{v!謳7}LM>3\7U]-&b jzijʡ7IF0Kc FrLnyUۋђk; pmrÌhU\TWYƅ`UEw oIޘQK!ոUp4;+T ×.?= Rpo&Rҫ֘aNܪIh`ls0sYCW5V0eASe3 iR ٣'8Ep՜Cf|n=LGR[l2oKy݋nkUǦЯc̒3jsCL`H08_z"a_i$'&(]EN[Y#nPڳYf27DBsmU(WȦO$߱)I%p\aKH1R6ߒY%H}3P7OF&*0eE=>h0e /cV+0P(-ϱAkz9&ΖM5J;Cn)jNUvB-*Lo{8ݽs V"݋?Ll`NYs?ǎc,~Kۄo?^{I ȞJ{pvVxS3&.e`!iӚ0oɂ-̭[z! xD2,(84WxSAC]'CWw^R)@jM o_l(Wj'5ZQ<4x@?9)e|iuk{H㑕"-!$hᪿf|o qrS5^@+\W4 B6agJ Ms st/^XS:Rp0>\픙Q„7[Ge6;s?HB6ZR](*:I3QXKi Kڟn#,}PA)Z0?:pRO39zLjhW8}:,nwIMG9=.T04`ee@۰]QΎc}@2a<]);Y6E2;~K-0>&0Ck!{t8.wqtnAA9Ex.yG:d)ol B1L &Iȋ^7>8iGcia;؝d}|jlIn)OEF^m WPP ~jK'tE8t?ߕ9d=ig_bp+wbzGRqJ^yϗ^z$8^(ig#ToLeBJ8C4&^XJ4oZ{rYxY%ҵ]^]Mzr=[ 9/<% "52<z#kv8nV;$V1ᗯnSdh#}'_v))>Cꟁ{~Б1UM_A/x~LGȻƃeS)9<AoM'(f֤r a6қ9.-jazڤ32hc jLx]X8Is]b/} ^>HH(+eغgqq}ȸGHV~h;ܣY >K,O!S#|9˚pth 6Es 5C:vu?N:q[:9N̂ꨗkn#,W.9QXUeK$rN|nOb~[)ę;ڝ c`u"#SrƱkyR[DPdždd% 36j$v< hBGX$GpT/ <3kۯi'NWvEy՜)FH/`FD_ٺU 6D2pG;Zaj(D>LQy|sŠ%x9iK,B8-/Ķڔx]tIoSE[رUq$?ζ~%R/k^e{Lz돃A]"8ݰc8,*P%59EOsa73`j.G3"pT khr)%g`n@Č"SC \bxK+P{$Q ס2&Q} d-;IO.2ouߓ/ zG'/Bm `2Б.%wxM!69p)=?B7';ڒPN@?-fxegcWGi|QEn1xD k_hiM*digZVctKxK 9`\=\f%B:j$$!D $mhBS 䣇οit4!IQ;phc`Af;9op#Ѿ`jGQku*Ay!#Ss卷,YF N=/ x1pXRͷ/Yv~kHp'gv2jӱ-'? 1##z4*G@F Ų"gD3u5zʎym`FiEn=o5KPme|fK)gm蹽rix!<6)bewTlKDW]̯6-I,TThh fRJ9<[6Xrjb<>Ac=ڮ!2T=n j_*FOd7 Jy0&IUXShWv϶_[M1OA"@j@DP&eF~VP6k%gӆb. $w 0dAe3Dʞ^ǟbye%C>  Dg#v42zz#Q89CǂFB9АaWj0Y2DOj.|Bp2c (Y2rF<|Y^+IP/AS <]4ˁ,Xl9?>f kv5M]H| 4gO2-3f23/*  SQoLk=tr]%I8ޯ(Gu_('zNiD*$tʥ:Q\U F/ժc<4Q+|:ee9v;kx(%1m 1 O|s8+7Q{ 0$QQ`:iOZ= 2m>wQ(͹Jk ?.{H3LJx(Zg_f6f|vԅLp  E1U`w 9'ӐjYiMfF7n@w*ڇhpo- $t)3<2@BnKu?g%|)=~M6h C nb0LZxжM @MC"+$h5|I(Fg+W WQHfh|As\+ nR]јpqgT 9~g,O`GCS"Vd:ݢY@ĎpJU|Dث檰n_iR`/y0̯|¨\ǻpʝ'bQR",X2>ۭ$N}X3Z4ҁ 4nIHz1J@i(i"o}:0&9#ht^#lw8T@1I7CRsRpR%ם«o_t,T#΀ rJ5{e0MU9X#l)"$" Vօt;+*)ΊZ?WDK}\hJcKkۧ3*3⭇Y2͠WDڽ::n䧴ǞʺQ\dyYUeei̜8"]5+]+VK^).`]ز}ox:'VcL?%j6^=ʤ}+C> =Drm*"VDf{FZj]@rql5 =CS8nt-8|k .3Y9V&-Ҷ\36$MB+Jr(樯Db e*I4i̬ \a Eʠ*}uG?EvSVͦ=Pʇ٥#8 mZbԡT'KU f+Έ8Q@\1)" mVʋ#|XG^ (SɰԸU,_p{mɥqAW1_ܚ[2ߵ)6('h ܏&`ݖSgLsIۚºgfOak#e'U6GeGrHnf D$yˌ('D%Sd̒$k=ݚ#m8 /`zTqF>WwĴPS/ fuh-Aչdݓ*Yܣ99M],V+-yC>,YJf=%##gCJǪMև RQ7u\1$woيhȖdP A/N-Cb9vaoQQsy*Wՠ J13!n99CϞYޖQ `(Az_D, @AE(N1'{x`ೆmY;=:Js_+u|lw>j"$ }i ,g=Q3kKzyk/K3](5<Ö^x\`q%2Pa2]J5q}R4Ѣޫ[\J򳖹1t#E #;`BiC^v(Iw?KxF pHZ̸_aHC YU( Sd"x1iądWDT_3v/ N)i?O>,U#, ˌNjכ =ݔ=̐G@]墼/5x`{=88%//#얟Hg:c?/n!"]C* ([64pmmړ#׏'3jP@ȚnT VI<ļZ)tY)WIzlGS3@+/E"7c{6CU0I1-Wڕp?j*H[ïds*Eij* "I i~`k◨ti&EZQ\X+ 3ÁtW\Q)yıޛݖib!7Tw*Xx7`r$zkh?B \0UWkk-o}ţV>Ou 340h TL.P P~@O Wsr ~Pe,]-/e/~Nl+/-.?l U'V~=?ы3tگx@SATDL.b^jl¿ئVu> Ma@7 ƛjj_{sV^R1k5Oc2sK٦r+Znrh2h6's#OER6>n1F(zdSQ[fu"`'9Fzܑ ga(-kt\Z,uhN"p]2,aZ [@F:Beig.h) @H%`'P DQ=솊h79VPG.Zd6;2ǃ݅! eN.9 jC C}|:ˬU k<O m"sKH1T![v!xdrRMt!H4RΊ2d㶚Um&bBkOJLgQ`TYğ5QR5+w|.0Ϸ*aЦeZi']}!o.g倗>6cQ+z nS]]ǒ0,MUI b~7eh7Ox 8gsHpVwTW;,eaYO>rH vHo Ixq)=W~Ha/K zXՎr[!;9c$HfKQa ۶58-: ůFRo:/A1o:5q̏OAqnJI/&EhH`\ڜ!G( hx%beO)8$0dIeړV {| [zڒǂmKZц5$m%Z: ᰧJzM )l? ̡㸩"*K@h0OE_ @<ioAQXC=?J .H䲥v#U(r*n)s+Kr$D $'ؼ ͒^}`n\S QcYÇ9(14n\|Ǹ}V³QPJӔCٞ^5#T_|R[AH_y0hv ;ÜKy(0B{!#" N'dW2I. k`fIepPyc5]we8rp-Y"XR',ct @WjbPQ[6NLZ̻qS=.E2oZ"I=!kOgnw!ןPb?>vہ 3Z>ܵAf*RBS Yo|LHn@*PI&{i<0Qat^gĄR+lW+y $e6'Ub/"IedpJ)SFx7ji-e^ @ h`Ɯ=R*̞kJ#JLxRDS~pc7b 7q}C 3dHH{dg|"yl'+d{Cdl.JdQ2nǍd&ӃRM5=hC)+J+ms%tRpVT*ӷ)̯i-N |s)~%uAV"E Sh2*$·T~9pZm8i'?C3Dc; Pp~VX/V'1h0K*]-gv}B半o,5d qMϦvPZ3W%[%v=^n7 8LS}Pd<[`zHb~8vy9a\u "p41f-E)Jq'v䰣 $E GTڷBI]u l:H}h"r{Z@s8JH 657 (*g(I#Rv;;ˏ&RVC=]1t-GTRQr =i;Vj s<{s8pİ<[C)VΙ~,{XUaLvOA7Scp\%ׁL۳+yOsD=)08f;Ьt ס㞾ESݐCXl'{ (LoǙo!DE+_x\ʼ Mťpva21]>yp^ҏtաG>iIF>uSxo+"c-A՘Bd?썞w!Q oNxխ}IlTsX Yqe@ {kyE7@rX";<]i(]&'L S?dl]F=hx=Tу@:f4GTR)#by.5@ ']j-P"%3YN=@3E$詂F!0$%,~.$=8EBFmHVK^>! 9nlfIADMuBN2zfPl Гx޺E/stDI} R׃7eV;x:b(` >==_^$pHl9(0`J9/30G-$ң["Ƶ+'-ox5Pl#3ԣK`+sxʗD@UPK.b<p o|[5qV4hv{OtюxOsClpVl#ՎA 3MyEږd~U;{b) ]-̦7:4+PH+m\5_A)2+}e9piY0[Wnbn X]-s{!c.4ĸW&^^_RpZ<)}>dM[N)!FqN٭tfF_)PRS4 =͖b:q^بIh; lzc̮,IBJ;}b_wl񦿪r#@0JjϊG)OjWb'͍DxUYx~}}*7uKa\\G4_qsۑ̉:'Iq+/Yͻly1,bl/S˖SYfYw (ȹіMTħģa)2^rfDUʨ~I^F݈WWP1OJ5yf9hd1~|-蕓oON08y %ϦqIoxLgBʫw$mͧ>;f5czAV{<42D S)- ZW5HcL1HUEΧjcZBXm\!K0Փ??;dc t>glwDߝ]/|]!f+;@ tu[7)i>ڔ(B̚LHHֻ:UCq|wTӺA#.v`em!H $j&\/vC0 8ᐆv4^j6%E2 <|d-hj >\V<32W'ݢ˜zzD& "^ $i>[!r.΢*Zq7ՙmqrxyY*efjenkUX(fƳl{§ӀIũT۽ hE 86_"uFCqxʍ0zۖILS\4.UW&U/o o^%ք_-{l̙>{ <#Zt̡P3@֖5:trN7-7sRŃƁ˳Kʮd4(-M2ad#j[,z_0\/cd_`=p$ ף6'.hhs[*aJj)Lh%ќ;QjJaK,ˁ6Yux %bP5 b?iZIH_ٔrVSNMїG6+t\f6LiYw|tpIWITP4:7EqﰉkU}>^e u@)hZ4(>x&hU"J#'$Ns/%Zc^iLoW>N*M0-# V2@.ۓ66}CqGw('ӤpȑW$K)3Vbp㛱5-w=e'G>2E:,uKnq֭:VD'ĈXR4`vRL̰R{JHjLkϸ|jrSCt9rMv- 3`E j͙TKj^:iqin9hy,GrȲ̊1X+XK:g3qǮ#<3PR=oN 4#kNM*?tjNG&6\܌Q{m'_ѓɝx-NF%S-q.\Ir#:A iodܙUn4= }A\5ɟ ę=?bz(2lDDOK=F3L9_uWT| + yOjTIy˖S.ZDnT+e;`;oH5ߍ6F5l ɲoڣ)A(wrXz{oʲ\g_ͩFnƃ*=E {|?䠓uߟpYGvsF֊gy@$q1 _~Y\:~88('߰+A6vx/BWR*-~N:DSBcW SYc;/nͯ[|V8kG4)y{hڢw:Il|5|XwŃ XC_oOLݮa:3^H%>N£럺m3|&A_|$=64K5jxSۍT} Uw|XAò=k<q1|"xBS(?(7?RL ̪yPxZ mA ƚZM#P^u%eAqK=Rݙz #+ګ-ioUU/ZEmhR׺2+I6Q@"g@AG ՜X=':@); T?DWQ`(.zAinB`XZ3(F cc=\&hD8;/`2B3ַ/^Rg]v䯛s-⠯Td4TYsΪhN{90 oԔ#S)[r ÅwawP65&PDљ֎=lsN??ؚ__פYx; d ?=(yhtHsG1tԣC@Q@{ttXM9̓UB3ƒX@m=8@o%?g[CiI,NS\%h0 !4n6F |ڤdhfksશ|vPué=+k.Ԑv~|}TR[")>On'Ŗq!ު&Mh@QDjRr #CI)(nj;HS%5FSUZ6)!ǥfVE2NQ<&ˀKK D&p%5k#+ /Z_7!IAaX lm>hLs 'h'* {˻'op">bܓB$R?$^$Od0NTz1)vM,SrYqQ<&y]<Z;̩͚Ɠvc:t3HΟ q-]Q*莬C*"(ߴ7UmȈmHSGJٷ8$ W%^%Fms YF3Rmcٳ<AyPFF,Êp;+ J|*;(9~+ #XN,}ΊHl|DŽtaڬIag#K+ F,(g=(J/n()BkO*jX&A=G=T8Sq}_)]|YFYVwD/s$Jx( _Zok5=]|jWVo.]&򝦥wDŽ]cq5\ m+F7o5QK`pźhuvEh{;ձoc/AuwGmhUrEZ6t{C|p>C[Jp2ȝ%; ^f Fh#B2xgPB34}/^`wƐ>־<~߷@3uG}PMm%(kP#Տ?mmͥ ZҞy~^2S:Do%魷_HN4܇k֚%F:4 Xc2Q:ϝ|5v>F;=ɹ[&3_ZJptxu$^WѲMva+CC]-^ .D\ }9%f*- 0Cs@ffUO4Ow#2` wZ|n@e P C"S >K뵓`Ji w%[ 8J7)Zyb"vP hxM9[׀3,3֖:rEܜ_6R'իD7% =*θZetN)=YîGPXZ"Nm=Ϊ;klyF,ӒN$"D]"ZX|Õ u:GÄS:U<=kqntVqRD!-v3p'd4<[[qˮF=F`x_pʌ-Wh =d#D(kgzљ[yob!Wo_?Cؚg[{exi^ӱ)F?Q4-)Mu:-[GE7kv\usN,ʺpv*Ԝ((.DMQ4&9Z8ՙf_V|VQrʲЇ\s=H ӪF71bFC󡊮E69U!##۽x:(vbΛfT+|Q#DNK::рXykٷ'E5 ,XuJlзKnil}aܞ&3Zz0) f[)+ԅ* ׎2 F9ccX_%O [qf۸/83%YB,=ԡN t.D9mb&HBU7A+;d k%ɯBb[cp1-{A28n [Kq/Iѕ%3i ęQ pKS#阖T#OCsZ}K 9zݹ&JNI23.?fJG8??-ű4|/j5:xPrE=[@vT܄0Wcn\wFA2g)=]aMDVQ%z9ʶ IH^HxB\H.QpDD,5.PA}fcپ75~ShFn[Ssy!V1!R5%Ӧ:g>%M3I:XXuMshh i`}]A8ZP s}MMKiUfJԷfǒH2uXb{.Nv&>ߎPZSzDqPufMDD+.9 G:׺hZ@MX;D*8lD[7zr>H9*/k*B2iLqMlolLj2'&m K1eR76fuSv돦UVd֕Re92xMŵt&l)jcnFMWBUz,sA7yw ġn4vaW5M8qJ Ƭ6: ,|74f"~{Ir;m\lϊ6ȅ]1IŘAaŜӣGbثTLa بֿޡtF)ʹ>뗋b-*N;*"DvWSׅzR IЪPN NT=>R%kƥG򂌛vdrTIk.J'ѵi[P z~hn-)# 7V~9{z2K_\hJUz\PK`d0ӌPngaGBf]E"!{)>TPQšRg.P'ZAJꯦ[OKV8)?3?_? `ڥQ}0/=ǟ6Ӭ'8[`Ȳ^54UgY8OT^C_dBZz\MTU?~8ðieI1- 18un0߈٤li~rh3~XA˫+r϶j|yhJ J!:ƞqPk9$Q :fy$v$Z. Xe W  x"%>xALώaBUnzVP?V9Ofi fu\z>׬}%o1Zx,Q (9K!|IIJ.ڳ/(mԒki>P·V|&f$ XѼf} t?~~>} V%gS=fɪ85W(d1n\ZJX?+Βy'k}S *1}pՒO;ISɐN3DʂhqH/e5NnR29u2z2 ]/k9V:&fckMy&{"&y'7=a5OWƗTyW_~0+ SZT+wݴJ ng> e>3>B3t*E+AF7mBtVz\P$y/úwdխwԸT3kxʾOxpZSċZvϰz>i4Ii['Er^>UMwcpCH/ pMĠ"~RhP!9nP>vf%W ۡؑ +S,&}xD;!ԟ5(SW|KfǮxHa8uH9뵚J / WB'dlҷ8UQf=cYQJòv>_#S|(U9jP~wr5&g\ij: i3y:A W eJ#I+rvl*ҥՐY$7Rδ3cg2Ɂ8ɯJo[fvRơC%Kپe)MJ q$l`#*qI>+-wD]/EY,A1&Ѯ 7U, '$a?l.x0#Dap\E Z6f[ƄYz {hMI t3ھ+_ bPMOr8QYսc=.BRIOGҟ3[խ.ibOih?{A u% o!Y; 0ITSx5NŦ8n9N`|t+uv:Hé>l)Rs[ZncŔNo[jmMPL]Uɯ+> A 7,3Mxe&RdLk\1{ޤ ͛} ZִnV9ܘ=]=Ĝ`Bbb!BBeIPcmVEU&>.ّLf3@ ϬA<]%ϴ_@) CH u?_Uaˇ0#^+xF/k8[`#vX#/c a07:Mq0E2YtWT e҃ʑANJ9 F4ɿkl2G1 ֱ5t2"QtwOBnn u$w lrQDgR a]AFQˡ?#CKrѶFE^EQϺvl S}ħo&isCSVTYFЮ(l2 !<5v/7N ^rGY (j}wIJUQvGVrW $ɮ$IRz@ә~HS w ^rQA?{J9_;x95ͧ땸< .i2C*móĿs9-t@U*&e0zc?:YfY0дǽT1OwSrK\?OQsX/Xq(}<݇ʇB6C!H{4>'ę.SQ>f*;5xtED(ETt>Z/:VCp֖:=[ 0Eu$u@͚58*j=w4(3T |/mu؈#[@u6zѨVy: ^9(u5&s 0LȃZVe:@3- xzc) 2ͽɭ6m ORi.m< pki,.:C6tSb/۽# [qKܢ@-zz8:5k.>j4j}. If>%;yid3A1^g\i$?Nt(U/L7DJ1 U>E55Wt/~"3ƋŽruXZQuSiܓ~rlR8wF9|((21&"a8Jpa(oNQBYԖzKïg`OE_jhn `m*dN-wO!F-/hI]p<%|Q UEO.1o,'Qhf-S?p%ibn}"BA"K{ [ .B0(۹ ʇEHS}B!^0HP<.|_1wy 8ݴ|qYce﫴RXH朅qU ۸± µ LjutP%}SJgùZؖՇpGbרZ1|˫}>n>֧Н2 z`UcU⎢wϺ K.a(T vchP&3Y$`Ul#,~F dNZ,\r"K$5Uas!1U|Hfm1PHctF`qi}htӬ^V^fv8(6ǖHo(Iy;9QZCMGmm"a#D o{ _n) `Y%hIdeJ αYz6 Qev )-ߥZs43&,r8!3!7L㠹Izg8 -s:07wk(,b=f-LJ $~)c;!Lɩqw3QwH)8/g;m8YSS-epbBBPBJ(X6k}i!?[Gd/qCHMlL)єݛcUlЀZ +fdt=^" Y-:ض;,A_eۡ%F~7Jڄ;J@[f;=)[q/^QHjT|OpF(fc%xZ'0{fmY?iץ۳cG^fdvLlbu4SYT_ZO15Z-mwVGvnFERRu__OџxPjSDLD~1nJ?s)[ Ztܡ*-wQi+uw.e={I2U#eG]rߖmt,ؖoW}SDbvܘ=vi6TyA=9 Nċ_R]7gFu(5#䐧@rJ:+~şj8`DT׼[z WÖ~^ۉ"-ؑJrrs^|VZbMـY(rZ75qzh5d<5,BM-daD@x7ӻ8DQFGZv1bCTQ1iL1a[kN>Gk%#Qh^R~1Մ]Hʶ!A:B- .>س{:-=)Ó7XyQMn Uz_6{= B,oA(A[uBT{z0J^`Y$3' %g` '{Гy~)G1| 5y7[1ɰ;'sGj* e8"80z T7t~5J5j`&5\j Keܽ1'U-S9n$Z)g2܎mE塣u'>r8i޵anl!kǓ/Ӌ}2HLkdB ӗAZZ _[>2آ6JgЖ^Kk#S,%|/x 8E~S-Vsk`%!-x5&?릺B_ k_l>Ez=J{4Z7dX[*@H:j ck-4[:CL|揬D9VZMoރ6Fi~F _O_| /N!V7KDY5<jKLF4(n#۞9t"7!"u6⦟WLRE6[p%`^ӫ33˔4%/^J)9 f doz)@ȵG0Hxx~Hp, K;{EP A74?9@j#pRjyh`F.}NPGmѧE^q?Y͌Ofuny",yNN@֠@U(WgB]Vp)q {GPUZTIIy."}[<>s, ?w3syտRʋ+hq~Xe!"9#(-5AD=RP^$<=:&ᡭwwΰhb|ki[jk?]# ZbzeL5z}8xmұRLC?1^T'Smou-, Gi`W8V=3- Nw~"k3)Qۤkڿtq'gi,xc8{Z$wfpQQW|;4NSǻ3ᮚ$oZ'4Xcaߙ>,ږDρ̧J'tt' yo+soL0ę7)ngWwp<ZҖ蟕.tdGmzYAвkEHWQSWtϚKhPVtGo}_%G_|=E p`[aAt_?Xe:@[5v;K_NJSiet6iQM6(‘ǽlWx^×D xV,VL]Cp9,`S@~RďH'Rp-*I=U헯C'1D; -zS7;&AcLӮڄRIO&wx S,5MLCr@܊mIAX΍>RBގa{,h1YJq>K˂+?zjDg8km0ńİ [Q-[5Q%)8+$C/%44lSoY2>` \Qㅾ=Hɐ,S@<ֵWTzUӞ~tu.ApQEPjuu++B*=6eQmV G(鈶j3a2{G7!*]',Y.,nzA6^*>K(3pT."~|y4dCƕd^nj.iڦmHDe"PSc8{O5_^2zaxOpC7*"o}G\JH B&gBe:D+Uma ,~Jnvn] Pmץ{dĖYGfLb73 GD&赴v g Lh3&aHE!mq-PP^V%c >8DT_53v S C if&%M6t,3eϨ%f^(50quuIh4X.`vh ^>>߽LɭBq)õEM3jkS/ԬtX hGb`Z8OZèy(2o}ԌCcsx)#=%O Oc>>uZ =ldDz.pčF4sNg OMxq2N XrˎX oԨ7b1 ;[KBEcnZfqS*(WƽDX:=9e[(3f7PVhI;&ʊM5oMn##3vwf9<$vcTmfh N+h8 ]^7QkNd5F]bbE1;h*i}JO5ww$Z2^}&TBz x A] i`F?u̪Y=>kl$xl, bݜY7jqJ]T,cB]Q:%fL =;o~^Al áHH긲䆁l tPgzG߆2O՜J[SnOrC#B^v1/n"PNOUFnhv("ATy\3t?Nޥ vWxҖ؟zj'D;9HZ sJSf1 B۩Hrz le:@:Sԙ@&ք>)& "r@>sKIQƀN$>DԮ{Kl'_|Ndx|膶y{6mOE*f&r=a{,S?0$QYOBފ܁{>Yb>Wgh4.V #7HV=T "! x-i,މ F|]d*,UudEᆑ@^yR󺁋x=|w iHkg{,@sM /&2(Z*'@09ȩae`cۮt]QDC8FRiЇb4=Uc+1+9[d;>l+%`"Ʌx!oSB)|b4!p<;Fևto6H{Jř9# d[RG{SovߐVT^\'Zn w)Df*DŽMMt!,3} i~Ӯ^l%fMyԽDS* WDy۴ [y|;LЛ0%A/]V7JiuQ#gKm?WiZKuvί=pi&C5v\8݅r%tpdJsDE!+±9 [Y^j2Dt"ic.TA10 adSđ/__"m.iGS*>`1fMJ$ho`/?$T@D'KU*8vK6:&)C|VwMqaZ"B@B^=}`F{:^|sy{fy2oRzU[N>j<}1ٙ-ǭ|y$Uj![ ǤjѪ9f 6Hjo'v&kKLvik6ګJRw6hsđ=BX3Ȕәhf.Wt}h[hdtS2(6~GT.:&픀pX7='h*,3:ɾ׬KfLٲ"mkr*nkGN@-eˣY(shiS8ĸo}@kL6+LU:e)ܟ2#U Uqdi;PcwuQm*h.( ;^,뉦*vxZ=zA֛ߏ\q 4L!!fV˙ƝkRB츢ΐDʵб Xll+`e4%pvܨ#]˥Ye[l\W(rvmg׮xJe;aViv4jL2{p#ɶAjl'͞Yg/X~={|"\=Rv^jZ3cDZ dSô@%6A)9^m[Dʔ=Xww~ymx|_I6Y~ն"hDlqFx7ͼH>qI'-&sgLWQFmz8/r>zޖ> .2b.g\QVa02 H(G]$9UA:<N!S@#c}-tq8#zܕa(Ms _&us"~="^\u2zT\Ъ#\wa;~v:9Lw}( .KHRQ?)u|kʈ$0^.WUV)pw:h¥{SoD@] a} |JddR7V/&LD {vpL6剃(nJIejP>c8qcg:yY.SUS&hx0m)vJv?HbN9dପob3"G6"$VyKf/O3lQ$hFMgf?o!;3 Lj}#Kd,Z5(2|Ւ^9Ĺ De  }oMt@&@[dEtpi* 'q}V'O@rڮB9cj!.F[h!Cَ6M j N<i);f{e1x6?4m)QL+8@Dy텟Kk?< :ϧ]EgR2!pxHn Duj,8Yqҵ/jAm# EURw`B@M("&P1O HIQQ]}@?PxaGuHKZȬn)BY'3ugMIrVz KJytY5uCpݻ֮V_1݆(Nk`1VoVqP} 2BCN,(@hW,icj]BSR_ 8kNnH ϳ#[O#A:A\TB!kHp@.1vވ5cUԷgX& #D8!aO9YzvQLɣwn% VtɢbvnDc=/g:%tEvz}5G9FgoRztehȓGU[ª~ O"#6q!2l=^&2(W5{䋁H5{ĹD.$aY@'Qp $ލ8 t|,,@z zDZeT_sHx'7) Hk<Žk(&16=XBkiOw74en%I8Z$Q:el޺HcFo~q15]?&04p'1(-l֣)uȚգ0Ox uet1Ր׹Un\l[Y6zHδ*Nb WkWd$$W{ȷ']UHXpk3kk9nQxVfg֒#7&EԂBdʑP,RxjS/ȑ G]ٌ5*ixE"( fiJgw9e4.VXr.7B,a$96߹n$QIЇ (8#O}F=kIl @NIkTTQ9nΎNyzwI %e|&)l2(8"FQHb\2d!;r)pIב b.[u]ÏFBR,'esXY L>C7 I> H(>vH7KzIeoьT^'g!6.>$I,i dhmhlpx͇V=bE R*q!` a<db$D~DI y? XE@4?G| c9|PVhh'#9?RhgFFʝ 975&;E)TZ 7meJ?hrp:4͙BEH8f)D<};KlyiD $]iW Tv:+a2G9 A~*w?2u8XL~QNe :]Ub3wKr\nT3xp8=|ƒ~Oe){ ROEJ.XfYˁIk-(՟KNT}tQϸoK YX Wviьy h9C9r'^#N!#(3ttB/ Ԁlmh>n̴Vrcj^ 6xgfcjDы0W>ܫLP] .8Imc~=V3)/Gr,Wp+w%/eeGQ8$v${L< pWf E;]Bs([3 RnlW3'S>ǑOB1v,Z" VjApTyMDrP^o3o[k[0?7%s#ŇA`|X,q SsD"]-xMִmGW̏UO99uYϧ&4crRs{?pBX~&Je_}C_%fzi`қwCV )lo5jZ; 2حkRKx[+x+;V#A,G2zqʨv([nB䟦] =i2$>OCY<.,Vd(,-Q#Q.wԶf"(I>$-!u4o ]zѨ=K ~4sX5_$enuhwI֚,߁Yl3r$L&ՌȪib#;u JH!%Zbql_t ; b32OTNfG6=6ksx36n"Tt\x-"^5OU$?SmbyGeҹ01J\0}T+ӊVRX.^~ p .q0e$мIU/ܷHԞE<7O+e"IjaY9au _e? r*4I:7sp.ޱ mHҼ+hwo=tK-[Ed rezSxaK[h3tm>Mt.d1d$`p e>|d*N7ĦGGy 7&okN9AG%Cd֔gD iq +kFEd8Q;{ӥ/K4@/>=~_zyhz:V|Rnaqiޠ޺S9}]:5#̀Nr.s"5͈_D,3{\z/46%~+t_zќS>J/:u6Zl'^3LwrZL"˽vs!2M5,GΞ.1xjqhzE~=L5F C c>[wuyh}N"nk8W?-n p#^oZhO=w%W"Q %3oqԁ!H%*-ox8š$i])3V~/um q];\W%c9maXN6q{ſ!~k)EQY/H1vE9m?ťK8 Ya'ejZ4]g~÷"_v^6Q !O^B7<.ʢ0o ]<8ϚceA5ݛ%8stKF@- b ~jHߜQ VH(-̮v _B~>N^:CUoL/\EZC))}[y]kN-N& {N!sm1eJQ[lеYn gcO-GscOQ毂k4dm&K>\CBFK|3i Cy]HkQ;"y8l"ueu.a\M"r MJRܭ ߷baDRN?:5iձ&qf1em%ʓ r&p3N0]!H FR^YMkE:gzټHX/vaXZQD/^=[s"wƨSZb:JPEfY`ZIeheg"Lϵb6V-I%ƶ}2zVZr8R}nL c(fDAN xʗ3/Kxij5^g%m-=|zAdiκ޳d;2c+'9\/w[ k<:$'3Q5'<(AQu0aI*6꒼ĄJ^k^@,jGMy-ܘx35V,=9X:̒LL* v@)YF\[|{c 61pT}M cg7EIPLȩ2QfX4 6C##P7\R)*ǁbz"p1N,`vJ(>X >7Nm[%m$Nc! 9:237w lHxH(nKK KW9R1'H-LZJv:#Pdגpo>oAqOv9/=Tyӳ-FDX~HM\ =MSz>٩pm) J=a#-\HMR˳El`RDJTɖ!.\? PA P~ahďqTCi$wP}>i`}|h^?A"zx )l0oH~T)c.7~rg(dL8˩̊VcSg}ڃy7on5rӧ1Hr^HqO'eyWJ! OA!Dρpw;z>#@v 8JQ7 csdM!@oIso'*) |H+D6҃-`#3y+ȫ`g߰,u1S55+ ;uLQ]8l?p%~-Xl{*M,Ma Htp\SHk\ue/%7W(6epPnG[v!GaTS]aXBKYF6B#A9| @(Bgyx4:ҘKeǹwtt1#)lm/>xl@+rsV1EXXo`>'hBLI1MSz.ަglg% 9k ?ӳB(H1!MI٦BnAQzʾH%!-rH*pf(u%EXmy5L5&s`v48w^ :Yr) :sE L]aqM:?$bxt媕XAJ4٩um:l]JpWKi *-HNZ7rs,Jm1!K/}Լ-E2Xx &j%dzP>ɴE/<iۣёL}i(yr: b+&h̭]].(OІƦHL{e{VO>킵@·=Z2 =gk(ptƄGP9c˂9' 7-w J'_gA_C/F >ytTjc*TC=" j~$셧5eK|dpóUg*CW5N=ȴ߅I/!OtTC.oEVh0aNX_@-iQiL+:9jj\¹-2K|i9hd& yԊd+ԩ,sv-fJn"Deg sUf)uG!g@Y^ ^H9P_4Òr'wm.o]TRA%=-*(weܱ4biX58 'VG7sZDNz K5?Kt9)L.9+.ֲCvviW7 sw}L6E[LkLmsWjGeOdݓ;qd&4ؗyN@7bzBeV|Necj-I+PNqxgj*{5˫^%"atvlŶIܰӔ6cQT}?]JQlbIh hgv C( % &aQy \PןQNi> L2$v$hGS) ՟rdSNhO=tAĆL79G!dvSG2$F|u7:}?3a5gJ3 ؊rOlShc)9;r`:cdGSδ}+k~~C4Bb"eayvŽfbrm},$Chg,D(ܰH%%Rw |a;6_q`1] B}Na;DF^Q:b\tm9L{ktۙ'(Ud_'|7"; Ǔ|^24cp;[҃@UMh,8>|l$9!y,5nOpw[yچM2;z;kx]d8r"r5Io2RM7#7[kG+<AFz'uN$jOu7Į7jFFu&uu#2j\Ch`hjJ_^. l,Y%Gȁn!-Y}ꪹ̪/trvV{&9SKm4O+i^w2t\ztmD?3{Qlv3! c/r"G'FiuNѧ. $}EPxr1;7Lryu>S2UGx*oTJ{ZVԡ Mwmdpfޑz'{ƄZWj@,P# (T ,2 {Pu{`u︉Jۘl :6wl{k[ԧ!`_կ/M%mSI_tPߤ6(Y$HYrv u4Jnϻ_Wt84SYu"ho;2"Ξ6(ʧa46Fb_3BbuF~?ɯs8TT`]NΛ1s7'(|Ota&;5_mἰ ATO Ȳ($qx.Cb8IO5XcI@בD&P`$>9~[(M㰬9P[<"IB'd:1z8$n @)f{Bj VO)cm(OPC[CZRuX}gAFDָ`dFeSƎdE&;8c8pRy.j؟ `*AiPU*nUHU5@8I?Mx#AW^8nP]Fߘ29]pQ+@"HFn+"g"w #@γ<2o9mt<';ڈvtkieӂ)"R Fs~iqK@8a{F8B#I~aʿs}j#!hGF9'Ump_Wp.֬ӋȒ綾[?CeZ ǜ,L ##g3hPvQ(/ڋ+Yz,1 z5 ۈvW'hþଠayd̝RF!!AȡDSWFCfsz0GC0=Hh9lN} jM#M/ߗ07d%ڜTz~á.6,TeBt\ٖ yÆ@ dh]3$ϴ r @$\00=|I wFC>M3cSrE).UHi+z#v/ Vyiw.w85TY@4X+|fFxY !Ӳhfmwe]}L [ JP#p_*|i8 LrN=D3bn^HߦxL;W XD[͒T|6#,Cg{Be,B=%$@JlHt]DhU`MI.0q3fm~BhgAF°cE_G?\C|@0h)" wD}fuqqJ ̮ hQɺ7dJUBYuaByV_6DN}- #n=}3Z#PL;Vj@Bo(eGKL"!a3ij:f߉zO &dIŷ8'pq%J!A#!wY+,QA/0n]64Vc[z܃ϱWמA@obd,uez„@朏ci(Ju4TѺ1*I>E є38ԫ*l;$Х47I)cp .,H1G`DPcσfKNkJ2l=Tlxr2+T&QG G  \nR[] C&+BSċ, *'iC FD6i*|їnGM{a⑒.s 3r 3;3<Ȅ'?F?q=0I?f~TښR0͓`F7SN-}T7pZUAJ-bJxioUr}2nơ.4% .\‹9)RF ll:ŎnBra vP'?da?,Ȅz,Mt3BY&r:)`ur*q3loQA:5GKEGhBeN0HI'?&qIላA]4S5B%PSRLӵPlĞ, (펚EQu`NLO+; o ;H= iS rQj,z'Z:b.ʹr#ဤ/ l0cv~"6pCgD=Nn{ 99{v}/9Kj!/zpc4^I9:@#{7`tc3ٳ%N&p?# lnpԇ=eE\~,Fݸ;WNTP2 `KiPMޗVd3k Ux{;<\nj-ZĒWwml |~L$nTzL$X[$Lter@ŗ5 Bc唈j]hSVs^TD}DUSjaB wM,MPUJFq:ÁLE?0ɚoyPѲS(ξ!|CC#K2Qͬ ca0(?ݕ =t|˔inFgՏVe %;0GqPae愀}*0r,&DAW3I’ГjQGrOfO9teC-ToNAڽZΒլUao?Q݌Q-I3Xly%EMTH6oW5l~vGo,}6S |p [Rwܳ}.G gZ>3Mo91ԋ[=:Xtsň!QF(θ+e98mߞ[(įx` %¨݃QFŔfϺbO9Yz.fx)]j3RWz{GcP "K$•G/agqBe.C#N)bBEE&R4;p*=O M]޸x҄Z(BӥHҵPC+D <Եn01wH0**Uz6*S,, t.X?a,kz*$mR6 ,Ԅ8<`< ,` 9Mv#Tͬ ]ґ [p`)LF$t1vt=|1mv (곦j!McpI 2@&z y|et&tO J&P5G^9Eщo X+YiQBmG=GXT_YU?,4cg K<1[]s*M|*^C/:z 1dk +["I>FJBiA H6̮8ik$5"@}Ǐ+.~?a QDZkA&P 8 0$O9HnIpDhi9E2qL=jYJ&]Pp,Q2H( RC+/dD,"lG]y~q( X8vxwyHoUc9K0_^-pu ab6ڰ*$qUﭒtZ-oCa~譱eeEb-/eP(,(/U1\ѳp5?$ x%QZbx*+4YB݀( EZ1ZB?XO G[\$$%VY۴M 3]:BQǑe{,UJ;1v/#^Y=r(#a Bdԙ2L2Z2kn5 M'ODQDjW'#8 >AdEu\[L0(Qłҳ ,\sd]6Ÿ tSU vQ.^vӊǁӚnϺQ#` Ra6V#g۪wiV i߰s4$=w \Tos}P|ko߄"oHC^ϗwmr\YߖOmr2~l a?(nDvPqB4C!H,{h fE] `tԙA[G?q(0q"aotJI}DƔ}sr KuX@tޫjY`0`? u[d* 4^jץKRs/߹L=nR Fz))goD,,9F$t9Lacre[S9>rEuSfySYFͷ$Rs'.Q=97À9ӈƕS(,4HBv07D՞5/˖ Ig5]]j TikzȲam8Dtl$I{hxM{Q,=Ҿ[1ߠZ,e[̪ Rg᠅ p^ruµ"0X+*i{H]k+_ eWNI-+rw=wc4}AG}ʍGTXNB|(>n=aA 5 |˶ xuW8jzqXL8'` S)NJR;)3V5M'ӱ:Xc+D8±kFt&R(=|jjrLOyoAur׋,m3!1rqLij;6crN:,ZS͛h@UvCdM۲ǀZstpo^߽ aKq-z1l)~*8 *ga@A?ؼp|=v,`ǮIh<M2#?A@P[}gTչǏ: vN hf@5b!^29zVEu1BqSẁ/R!]>(*j{+?C)mk߿K=b#SY)AuU␲$pW4H8/fLp2>#Ss(c=d,*z @h!M9s=.z^TeDq>(ݎ\*_AZxX$6e-fqJ9;eD\=@WFΕ7PYű%A |j\68Rp@Quym7lj[f~ML8jGR@X++w9zkbEÌgSuDӨ4vu2G.at`?3WT5h+Zab4][-RrwCB,AVB}6;̳ {R|SJ`*BC ][UȌ禣9 YVHV)&6;T@\j OC51mq^aZ39Z`N 3l[\-mjxqݶ[wHH6IcZ4{\&'ţIV7ʹ[yW=iyA2UQ,͔NC`޴jWz?ϛ" h"Ta;R5eތPua*DKjB z%7vLIIO2M.ΪR {rlJ]Ä;'%ԕ6}rwk=Y !{O:W .0sO^L}ٯh2<Ҝh֫i/3gJ|XZ #W)eFHFJ4шg"q(eC n+n=EeӉVVXaᎅGttAUjX9hCFӤ7nP3V{^xYf@ѴCS)`GO#D ø95u8]wOW"ɢj_(v6St?-~Jk<È S[c+Ԕ{Mv-5q'2M&,ײjZ5Ț7A=ӘȄb L9/pCG5WY(_=]΢2TBS`jAVuV>4,dIO;+iP4Khp 4b#7)ᮬ݃.~ӤhbYՌS nr5]6o`E\bɵ=RqӤ;o1,JvY?4'AiØ噵Mb_Az KP{RfCw(AUTgPnU)uIfU b@tl]c·BvM"?RCp͠+F(sE=f:,#u t2jQfLO$2D6ߢudo_y}e̞'˪ȦX,a.5K##{DAfUf'HKiZLUb=-g޴hB!|yŴUB H&I9g +!xXVAx߿.B[FlX {/NOc!kTթ}f ҧGά-Y {CEp16]5ڭhGq g W\ q+XLh(Iݧ9Ya6 ԍf`F츛ihj7z8p,X+.G5nyGV3 M͵qEKˎz1cv7qfm;F#V׶"U,[VvGT=`;"C4qPFv5Sj\x FK7EŊSðW'+ނ"@؛Fdt gjs Ã!` ė3cj_63{N `"['8hd իDigŹ\şֹFkXglɀ|"RX.rο/Dj8%UyҲ-9uV*UkAӀ$z/?hic9YtQ3D8F]ߎugW'OAM|*Z-+f;ģw\N;nɄ'le}`v I<;b8Ȫ$*nҢښt=8"3meB ocQ#ӂ"kQ!ՙ B1o`=^хA1!j'MV_6iuT~ ϗN[:ջZ79o_")1r|Sc}:ѿ6ۗl*VB'[٤-om"v`&>? ӏ_?{WϜ=tX.|S+4JUM` iHRZ_ZJc*fJ Z'ACeswoȥt|: >*nMnb 1W7L^L"֮&"Hn#yJW9baA~h!_Z't:;l}EgrYqlY.!Z!d tAqHrL2>p##h q>i4} ۤqZjƨ2U) F#Wj:HqA.aeUzR^nIV0 g$ˠlck&}i[JUʞe&p{Lbݼ_NWKI*1o~`M os[seT[FSu$js%~Fn-1Vr/CX-غܤuv~D/ [e8Na=c>Z49 0Z!B:Q-k,c'~BRJ}>m5n Na]*Q:P?< N2a5 x-^a8ݴ<"&7iζcj(TՊ@sCͩ,L\uamCFXwjJjJbޡd(,dΦIXc<˚86qڜn} 3x܍s;ﶯoۿҞ;&PQs U>{.4(4kC\zy V)@Y$]L)=~ )LPx^/Y-=-m.𫛎s1Fj G ՘1wI)"M7YyAd[/Q7uXmb檼+;֕m:Rw(,D]>2pc,$1Xb7r5?eM r<99%{B.n~\cviRӓ&6c:tr^0;[҂E9m4ObZ2| <. _)H5Bޏdc@2QH A^b`h(8WLABay;` >G y㙘6ΫyIbcnnlmb@83DdDZ}[k_z^j}.hqe!ʘYCўQaˡ> */ޅmNrfJnL|uiQx4M}=6Bl?l#j?u~`PDٓ~6 ݵKj{":[$j\z}>Ֆ,Eg1f; ڥ+BK9u7X!Med endstream endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <>stream HVo\G?3s~7^;oHHUDޒlj%( * yj+d"REJyZ@x@ ,vRD39swܸ*tz4%(K+W{t#"vO|F5WP_Xx5mW^t="Do.α%kHj72+V7~z.H߻|s=y U|u7^Gkk7[P`$7JfBZv2'5]7h-_?ߴA&z)v7yq6O%NI4'O3{R 0i/PFi~z )d0KёH!<)^"PrԤcE*Qz|?&޽^`GTyjыB_tۍڑ8/2FXYo]:,J_"SKDJ/e;o3)-[Z|ﷶX[0 D\|܁-bK G$1^=#'XoU7Ϟ߬-8#jN/^BZgUW[aDZvf ..`_$OV;qj BRUwZ_Z-R۞K>LbbgҡfҪ:77+GޢOt0zc>@$E1r|>ݮ*^gkk'O/h"|~Lݣ%`ch8E#P&y ı4XЗ@%@:{L*P)V*+_tt$=F'mm4=9:+OK3*3; e$i,ʅmrs{/vI}=.{L۷'|稘LJDdG&kޜ,\8Z991-ECXУ\s 09G ̈́%}+%A.򜻡+ϸ- J0Rz@;\z~Xׄu1=9BqQ"?9y IQR:(GbT(}a<"crrLсؒgzpEkl]`=gU@  ? ȸPFyn*7ӐSuȯC!T~;.wS}rr7|I\;9~<ʼnɩ^%՘l ֘k<Fӂ9{HMmOQh4ӳ3:ݜ)M̃"Z~K@ MZ TF1@m[ϚRQaX'Jtt, #hvTH[.$3v*$~BղbWRfCwt5jj OH)d /hXtJ gNT^Pp,ex6^0 /=GqL d1eB(\O#'XX up7F01\ >h[J8 |Qbv [jipの`"gn+hLэc$"5cG-6UС&2Q_1th8v5yA_GADDS؅ıiQa3` ` #L d7 mB͹|cP $ڞažfa|w]D p"̑>al΍11n֕S"R(\.\?i/=,} . z~Bgq{;GBV T>L*A^K6v*o@@ɗ;ϰp<>8q<4ؕmd$j+-5:37y3lY*vjXEK`)w-kh?:1iL)_jjA1Y*0gш%W@r" =DYq.*c)|8A ~wsH 4Q_i!w` od& <3PN4~>pP_DBb_|E<ݡ]u#U6_mܿڸݿڸ U “Y:En3/eS XH`4=7 S]9=xڻw7$nF BH#\PP3\"QN\U$ !$.QrHX/v7vƏƓW尿g-ǒB4Tvt:6DX;v`D,$0evbN8x".z$T2|Svæ[YAZlcd >BƼ[uXq^/{g'!G e>th=E;GFwwXɝ?xMcnB"p*.ChXQ&+ܡg}&wdrc$WuYy DF|?yU]ð;JyΫ*tw)Iί(s6GECLh1 升5q2 tCMEcJ8P\j-`1s-ĴR#Jb-Q =( a|i)O";i1%HJ̰!,#e"Z`m5e}J ߲ P%>׌ȁR*.sq?k8?P2 p A%PIBbSZ[E&+e6IEQ&\={G}W{ z 7^;ouy{oŽ_u_]_\3>__A;C'ڿ_ޓqoc>;|ޥwޣާ3@Ys#-$:=`5U.-YY{x2 Iه}-Q rNYȯr.f44HQ/ $7fw"^c P)ֿ; ^i4'B#PA_r ꄚ!-`Mf$4":)KP;PHkX*sUӌtnU^6\2fGcy.@ z\Er9-z r*(@؇43L.hQXӭ;U92 ڂ8MYy\+;6HZ&؏o"Ta0^ 1GĦFD( lt:! RD!qrd'Iyq 6 WŎGl!/GU su9rt=D;:vͅvsգGpL~8D" Ł?>E.]V+#VP~^b~='.YvE{.v W^JIbv"d+$>ߎx2* Oy*a%DqQP09|%b0{}1pQ 6iX`N Z!%~^.; 5%wiaHE+#Ϋ[4 r?':%VA 𭍭Áx`7(l 9Pp|CTl0of` bSR1U}k/ؒGE*^)&{Ifڱ *^O@uv߫<צZd%@A"T;~4&?~3rQ!E40zt:BBB$tiHbk;\F&!2B#yb \ˤBD`@p92{pXgG J7 T7M:4, ^}mzj #B*{7lƸܤ-Y MZB1)I٦K6ٰRP_ѠyG/Ui EZ"H B WoPl;g̙3t\n(U 1"՛J6VX 6Hd*MRf?u{Dmc Ikj=_\Vm{qQNg񽭣-a5>(Z4=("h(⴨ջ& Vȓp344! BEɯ‘ %bnM LK[_ C4t>,u2`kU?p@#&tqCx۶\ݠ.2J`860՛=WA8艙!C_5y v܉#QH2mCH&F8֝06 /4#lH5$pkX]6 rp$\$HqjˮY#pqILJ>8vlݿCc9n=@i u{~7؆+kH3n6P=T ]bhjn@hIj'Gtҋ3wR:RC.1Y7;n'7NJ<7ķHBpV,"ne-Y1 Ee#w38ηU~2AI~_6 ]|?%6/0;&"|iA,OMygSoaNwx˗!B\gd e'bK3GHbsm\i5Y]fsʝK|fsI\%9o%إnq]IaV5EIH d4m^dAi+%!dEi; ݑlAEMd0|v{zysPRk~RJ|>?wXf\_WkPsD97͕GҙpK4NT Y iڇPuAO9*Bk,y>cr-EV*ʣ>C~>:A(e>6ݻDBsshZn~1JQkFY[l _z͈K84Ɍ qtETV'sgi:ok_ޤcP ]‘7Ba endstream endobj 15 0 obj <> endobj 18 0 obj <>stream Hd \S%{bk\=7Y|@uQ@E*S0hHXPB"ybHBbxaAiWu>&Os:]mήO|vnc|wh*>iM_p|CɔT00Vhid<}OO0cٽacıуG|]zYQzM'-ڒrMQ`z^9W/Sg6tK|XoPoE#_o6U=.2N]Qd('Yyq7󷩧t$ɠOS)jKͤTJ,ZLSK)jR`)RsTDqqVŏ_d0Gl~-zQ֥+ 򩁉0&a4?`Aƍ79rߏ9%P5k0 ~"w<}sӫۑ[TTcD[Kx!0wxA]_>~G7x o݂; iM+۽c^_<uPv#S'bVXa,^#JZ TހGu(B<6nb-vd` ~~{Ě s~ QESpkл8?p)x,,B3ao8 ͐">BWRǥOo ElRs үA7RvG]B{k}N/mkyTQ_Xngj ~@{rK7 [ ('F#(|Ý7EZ-R"F ?u,N˨sA޻8B:b/L&6SITf2uUm?p4;>08:ѵYCemt4Q;)TnՒ֑`f8x|N.0Sd:ζVe'Xvz~62Ho!^.]$OYrP\NC % %%1620r&,߅șXdxS}ߟ>oF{SQP"x؂yq#`/\26G8%+09u0׏"\JBaа"R |임d<iǬDـpыS 4H_Bx Xkr//[H*صOA 0!9)#(BSH]NǓsfvVuNvkW 9<'`A5髵0^ 5 EYç>)WH*|h"ZnmH~⺭K߾=f [W.H@?|C{-|7Iu>'ɉlٱcW^$Lλ.±SLGG&o7 gCad?"<.-f}[ߗ^TvTHAw@̳ n奭2.*mf : KK${`hj㩏hC'҈6vm…LJֆ91mp3 uD#$ ^&=3;q_J!,9G_&uZ0 Zr#*6?nŮ(@c۝W! ]Wҧ̂<-::uxF@淅}{݇Wac筘* 5[;\T Xim_2yث$Zm\^j#5I+\5f v_'\zG~ cjYDi#MNguӇ;rEZg$aaq$5Ҵ=0+6n?,h^h R.-YZ>ZŬavpcʷ]ioDcNGv0;# bw{|DTgKs{*eUP  -fu[!mJ3A #qz endstream endobj 14 0 obj <> endobj 19 0 obj <>stream HlU Tg1$>VgDw+D`Q\£e"B% `Ph"E*_ǮUVUnNuw'A'~ $rG& +1wxǸa\4穷-·)`m#iز7Ff͒-Q&VDDDGE)<.&%:*R&[JHUDe Q U2N*Yvdq1ɲQ)"H %W%ki2/)^)bA 'I^M3bIBFDAX .8!mBDH:F,& Z5U4Fqfq,/.JL+l*qs/v>|in*)j~ N~Qdk+7䶈ρC43W:l⭒Km؞Qiϱɠ}koAU]ݲ8s*#Nq9}tނ^vLu6Q WgobBSj{U3s'TƞZv˾k#;aMwBZ\O [ =%E~̼ `,:9BCMI{2r~ ^K}sb$Wu{A#0FxvtypRl1YJgFD fIı?ÀKmɞ["!k%}VGloR'%U5.%~ )bbi$ =Yfy#ʟy /">F Lf$Lt(!Rl2fF-h0(pHCg_谽jK-OGUbs^{G% 8q^@ ׅ7:G-WxDT `loxԼq?608K%gee0KNppBD9Ͼx$bQ^xo[L흶HTW}?j,9|.W9 wDV(a\'≾*O`ZhI ܠZ;nkCeX5t?h LHqڴ$Oah=+?9΂e79<Oz74¶#~ٞK'ʄՂ^6VT YoyM֓_.cQvN[5'n״] Hq0ؖ#DŶ-UlUeYMcx7ޒsx ƣExe)G?@YMzV'Ǧè,ɺ~~;!#姴Pyl†-AR˘c#vn0g`5eK]s9QqZμ)M/P$ā|f`83T /Pb#q 9 "\tgcy* p+Yp皰l9K@ƣ#pNn$9G+ (RC$.X8+0SK889 rMZy j m+";"ѵ''FLA0 菀R8XLn0X| 6G ܔ;g!6-r^/p;m"u?iBLUOxocͤ=6~EZ.?/+{@Ay-dilxpF|9 fA=". &8v.FX^9ҟҹ<MJW@Ѡo64hމ-(PiG ȌEd-aWW_ziZUU0c!NB^D$pX/H#;5ih^$oDһ c63n1fRS*6#6FMtzs_ܖ>QkRo.`hpl4 endstream endobj 10 0 obj <> endobj 8 0 obj [/Separation/PANTONE#20707#20C 20 0 R<>] endobj 9 0 obj [/Separation/PANTONE#20707#20C#202 20 0 R<>] endobj 20 0 obj [/ICCBased 21 0 R] endobj 21 0 obj <>stream Hb``$P\쓘 11 Ke߮10: 0䂢 }RR N*/)3F"FN@v#]Z_PYQ`hii\Y\[_T_XT 8@~u15 ɄADdܴC"YX98yxED%$edUT54ut ML-,ml]\=<}|CBnOHLJNIMK/(,*.)-+ohljnimk0q)SM1s9s_p%K-_r5k׭߰q-[m߱s={?p#G?q3gϝp+W]q;w'O=7o߽/_}??BY!x˨G ,< endstream endobj 22 0 obj [/Lab<>] endobj 5 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 24 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000070148 00000 n 0000000000 00000 f 0000333299 00000 n 0000070199 00000 n 0000070524 00000 n 0000332209 00000 n 0000332382 00000 n 0000332096 00000 n 0000318700 00000 n 0000319349 00000 n 0000319729 00000 n 0000328808 00000 n 0000326394 00000 n 0000320073 00000 n 0000320323 00000 n 0000326696 00000 n 0000329138 00000 n 0000332559 00000 n 0000332594 00000 n 0000333181 00000 n 0000987707 00000 n trailer <]>> startxref 987961 %%EOF