%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf LETT_1-2_JULETREKK_GAMMEL NISSE_2 2017-11-10T16:41:01+01:00 2017-11-10T16:41:01+01:00 2017-11-10T16:41:01+01:00 Adobe Illustrator CC 22.0 (Macintosh) 228 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAADkAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYq7FXYq7FXYq7FXYq7FXYqoz3tnBJHHPPHFJMSIkd1VnI68QTv17YsowkRYF0pR6xpEnp +nfW7+qSsXGVDyK9QtDvSu+GmRwzHOJ28ml1nSH4cL63b1a+nSVDy49eO+9MaScMx/Cfkhr3zFYw 26SWjJqEkhPpwQTwBmCglmUySIp403ocQGcNNImpen3g/oCTxfmZ5f5BbqK5suX2GmRCj0JHwPG8 ivuv7JOHgLlHsvJ/CRL3ftApCLc6h5m1g3GmtLBp0Sxok73JheJ0kJldbaFm9QupC0nC0p07YeTY YxwQqVGX9W7229R5f5ts4yDqXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FUHqyJJaBJFDo01uGV hUEeunUHCG3Cal8D9xXfonS/+WOD/kWn9MbR4s+8/N36J0v/AJY4P+Raf0xtfFn3n5u/ROl/8scH /ItP6Y2viz7z83fonS/+WOD/AJFp/TG18Wfefm79E6X/AMscH/ItP6Y2viz7z83fonS/+WOD/kWn 9MbXxZ95+bv0Tpf/ACxwf8i0/pja+LPvPzd+idL/AOWOD/kWn9MbXxZ95+bv0Tpf/LHB/wAi0/pj a+LPvPzd+idL/wCWOD/kWn9MbXxZ95+bv0Tpf/LHB/yLT+mNr4s+8/NCvpWljVrVhZwBlhmZSI0q GDRbjbrvjbYMs+A7nmOvvS3XfJkd/qKX9obe1uBE0XqtAWkjZmqJonjeIiRexav66kSb9PrTCPDK yL79vcdjsyVQQoBNSBQk98i4DeKuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxVC6l/vOn/ABnt/wDk +mENmLn8D9xRWBrdirsVdirsVdirsVdirsVUVvrJrk2q3EbXKirQB1Lge61rizMJVdGlbFghZP8A jqW//GCf/icWFsH0H3j9KKwNbsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVQupf7zp/xnt/8A k+mENmLn8D9xU9csUvtJurRljZ5onSD1acRKykIdwaEN3xDLBk4JiXcfsY7cwX6C5Glara2oKMtn CskaxAt6oBZQp+zWLjTwyTmRlHbjjI9/O+n7W7K08wD0DNrQNwFqsSyxlXPwtGGUqxOzUNDvtjss 5496ht7igodH81v9WludVtpdRill9OQuOhgIKJQbFt278K1pQccbDbLNh3AiRGh9/wCPf9rMbGLT rWFYrUqsczPMih+XJpWLswJJrVmJyJdZkMpGz02+S46npo63cP8AyMXxp4+ONI8KXcVaKaGZBJC6 yRno6EMNvcYGJiRsV+KGE+cdd+s2M2miympcTNbWtwqyODPC/RliVqAldgxHJd8nEO10Wn4ZCdjY WRtyPv8AwCwYpbmGRYxCt0iBjIZJCwaRHYPTjyNQGrT5Hrk3bWb3uvcPLZn3lXUbKVdIZLKZE9N7 G0uneQcuMfquWicIeLel9qlK0GQkHT6vHIcdkfziNvdz+PJk8n/HUt/+ME//ABOLIuAPoPvH6UVg a3Yq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqhdS/3nT/jPb/8n0whsxc/gfuK+8tEuo1RnZOD pIrJSoZDyH2gwwIhPhKWWPlLSbO1htow7RwLCsZcqWpBIJUBIUftDf2wmTfk1k5SJPW/tFIay8ha DYcfqXqwcWRxxZT8cZQhviVu8Snw+jDxFsydoZJ/VR/B/WrweUdPtoIorWWWH0bpr2N/gYiSSNop B8SkUdJG+RO2PEwlrJSJJANx4fkbH3KkPlbTIZtOmQyCbTFKQSAqGZWryEhCjlXkT8/pwWxlq5kS HSX42WW/lDR4GRow9ESGMKzBgfQlEqk1HUsu+PEmWsmefn9opNbO0htIBBCKRqWYD3dix6e5wOPO ZkbKtixSS88v3Mt808FzFHC06XfpyQvIy3CRiLmjLLGoBRfslTvvhty4agCNEG6rn059x6+aVH8t 7AurtMrcK8AY22BT0yOQk5U49q+/XJcbkfynLu/HPuTLQfK76XLEWuVlgtkkS1hVZhxMpQuzNNNc E/3YC0oBU+OAm2jUarxByonny6e6I700k/46lv8A8YJ/+JxYHHH0H3j9KKwNbsVdirsVdiqX2b6r cWkE5ngUyxq5X0XNOSg0/vcLdMQBIo7ef7Fb09U/5aIP+RD/APVXFjcO4/P9jvT1T/log/5EP/1V xW4dx+f7Henqn/LRB/yIf/qritw7j8/2O9PVP+WiD/kQ/wD1VxW4dx+f7Henqn/LRB/yIf8A6q4r cO4/P9jvT1T/AJaIP+RD/wDVXFbh3H5/sd6eqf8ALRB/yIf/AKq4rcO4/P8AY709U/5aIP8AkQ// AFVxW4dx+f7Henqn/LRB/wAiH/6q4rcO4/P9jvT1T/log/5EP/1VxW4dx+f7EHqn6Rit4mkmhdPr NqrKsTKaNcxrsTI3j4YhsxcJJoHlLr/RPkm2Bx3Yq7FXYq7FXYq7FXYq7FXYq7FULJ/x1Lf/AIwT /wDE4sLYPoPvH6UVga3Yq7FXYq7FULpP/HLs/wDjBH/xAYS2ZfrPvKKwNbsVdirsVdirsVdirsVd irsVS/Xf94ov+Yuz/wCouLCG7T/Uf6sv9yUwwNLsVdirsVdirsVdirsVdirsVdiqFk/46lv/AMYJ /wDicWFsH0H3j9KKwNbsVdirsVdiqF0n/jl2f/GCP/iAwlsy/WfeUVga3Yq7FXYq7FXYq7FXYq7F XYql+u/7xRf8xdn/ANRcWEN2n+o/1Zf7kvFfzh/MXzJD5ofSNNupNPttLkVle2d43nZ4UYmUgrVU LsoToep3pTA1eoMDQd32J2XDPcsm8Rt8e9kXlT899BbSbOHzC00epKCl3dJEGiPHpIVQ86sOoVOt aCmWY9XAjc0XF1fYufFMiMTKPQjuepWd7aXtrHd2cyXFtMOUU0bBlYexGZTqFbFXYq7FXYq7FXYq 7FXYqhZP+Opb/wDGCf8A4nFhbB9B94/SisDW7FXYq7FXYqhdJ/45dn/xgj/4gMJbMv1n3lFYGthf nj81vLXlSRrORjfawFDDT4CKoG+yZpN1jB8N2I3CkZXkyxgLLk6XSZM8uGAt5Hq/58eeb1z9TeHS oq1QW8aSOB4O9wsqt8wi/LMGWvN7B6TF7Mbeue/kE18u/wDOQmuWyNFrlgmpbfuZ7akEtabeop5R vU9WXjxHRWOWY9aDzFOHq/Z7JjFwIkP9LXzNfb8Hpf5Z+erzzlpd/f3FgtgLW7+qpGkjSg0hjlb4 mSOtPVpy4ivhmZCXELdFlx8EjHnTMMk1uxVLfMHmLSfL+mtqOqzGG1VlQsqPIxZzQALGGY/diyjE yNAWVHy15v8AL3mWCafRbsXUUDBZDxdPtCqsA4UlWHQjb7sVlCUasVe6cYsUv13/AHii/wCYuz/6 i4sIbtP9R/qy/wByUs81+R9D16zvWewtjq89u8VvfyRKZFk4ERMzU5EITt4dshKII3a4TMTYfKN1 bTWtzLbToY5oHaOWNuquhKsp9wRQ5oZwMSQX1DTaiObGJx5SD0n8jvOF7p/mOPQpZC2m6jyARjtH MFqjLX+anA067eAzO0WY3wl5r2i0ERHxoijdS/W+iM2TyTsVdiqje3tnY20l1eTJb20QrJNIwVQP cnFWMQWc3myGS8uLzUdLgqPqFrayy2UsaivGWagUtKx+IxPVVHFWWvKqqbaFqV3JJcaXqRX9K2NP UdRRZ4HqIrlV/ZD8SGX9lwR0oSqm+KuxVCyf8dS3/wCME/8AxOLC2D6D7x+lFYGt2KuxV2KuxVC6 T/xy7P8A4wR/8QGEtmX6z7yxz8zfOq+U/Lb3UVDqV231fT1I5ASFSTIw/ljUE+5ou1cqy5BCJJbN JppZsghHmXy1cXE9zcS3FxI81xM5kmmkJZ3djUszHqTmkyZDM2X0jSaSGCAhAbff5qeQcllnlvQ9 BvdN+us8x1OK8hto7dlWS2T1UkkFxJ8Pxeklu7Kp25BepIpl4jwR4oi5b/YOnvNPGdv6jKcnhSNR G4rrffueW76Ht9B8vaTplpeJ6dpb6TbOsLRlY4I1cK0jKGNFr6fdvnvvk44ISwmUZy9VG7Mvs5eV AD5088ZESohJfy11fWriz1KS4guJ7Y3MTW8L8VkheeMPcRj1XA4Ru3LjyJQsUp8PEZuCW1XxMJM8 UkqCQVJFSppUe21cvYvLPz48sapqen6fq1oEe30n1jdxswVlWYxgOvIqCBwPMVqR0B3BlA0XYdmZ oQyjjiZXsK5g2KIeTeS/zJ1DyXqN0bSCKeCchb2CQHlKIOXARyAr6Zq7bkMPY9jM2vaGsGed1w8O wr+aOX4+x71D+cH5fPZWt1JqYh+tR+oITHJI6EGjJJ6SyKrqdqV9xUb5EAlxsWmyZPoiZV3C0+1S 5t7rSba5tpFmt5rmxkilQhlZWuoiGBHUEYhcH1H+rL/clb5q81aT5Z0l9S1JysYPCKJaF5HIqEQH vtkJzERZY4ME8sxCAuRfLvnHzOvmTXrjVvqMVk1wFV44qknhWjsx2MhGxagrQbZqM2oEzye57P7I lgh/eS4j3fT8jzSQtR+SbAH4f8zmOJEGw7U4hOHDMcXfb3f8hvOmoalDeaBqMzXElon1izlkYvII iwWSMk78VZl4depGwCjNtpMxnHfmHhe29BHT5Rw/RLl+lm+vfmT5L0OR4L7UkN0la20IMr8h1U8A VU/6xGXzyxjzLrsOky5foiZfBj1h+d2iavfppWiaZe3Op3JKWomWKODnStZHWSR1RerEISB2yENR CRoFyNR2Xnww45xqPvH62WWXl23SWC+1mYanqsbc455hSGGQ/wDLLASVipWgbd6faZsyAHXEp3gS lOveX11Q2txDdzafqNi5ktL23I5DkKPFIrArJE9BzQ9aAijAEKqdnr80VzFp2tQfUr+U8IJ1q1pc sP8AfMn7LEb+lJRutOQHLFU6xVCyf8dS3/4wT/8AE4sLYPoPvH6UVga3Yq7FXYq7FULpP/HLs/8A jBH/AMQGEtmX6z7y8I/5yH1VrjzXpWmRsGisLOR5wpNfUu5YyFIG1Vjt+X+yHY1zC1hHDTt+woyG YzA2iOZNAeZPutg+keR/NGrFvqlhJxCJIJJKRIySGilWkKhuhPw16ZrfCPXZ6bN25ggajc/d+2vs TmT8oPOSRqyxRSO1KosqArvTcsQPfbBwDvH2/qaR2/jv6JV8P1p3+TYs4vMGreUNf04udTEfwOCP SnsQ8lG7gkPzSRT2BHVTmx00BXCRy3ee7YzeNMZYyuJ2rkY10PzsFktv5i0C7/NQWjWpfSgDpcV2 W5o1xZ0eFnB5NRJjcIJGNeRU964fBw0cURw9fTt939rpPH9VX6mb65598s+X/LX6ZXlNZNKsVvFA vF5mlenOJZOHNOrl1qCoLb5bE4sQ4I0OEcutN+PHLJIAc5Gkw8s+btF8x6OdW0+UrbIWWZZqI8TI KkSULAfCQ3XplsJiQsckZ8E8UzCYqQeBeZtS8yeZbnUL86Y11HdyE2kVwYzPZwIQD6AZhyjYR15R j42buBybWz1mMZ4ylOhE1t9J9+1WO69ufuzdHeOUZcN0QfPY9GCPppmWO7+IwXFXWRBzVxWhZWBo akHNz6SaBDnajsvFly8WLLDhkeR2593f+AjbezvneNoLO4lQMEX0opZACDQKWVWAp3r23O2DLqsO P0ylGPxd3PNpoYvAjLkByBP+56/H3vRtD1bzpo/laGdp1+p2TCT9F3AIakc4eM/EvP8AvFqQGX4T mnx9qQnnMI77bcq5W82cJlI5K4eLjNd1gsV1K1/MfzJGdWv4r29gdfViZ1cpwkoaww0+EMKH4FyE 55JGiR9jucM+zsIBjxE9/qv9H2Mb1DT9QsZ/RvraS1moD6ciFDTpWh+WY8okc3f6XUYskfRLir5/ G9/mhci5SO07VtR0l5ZdPuHtbi5ha3mkiPFjC7JIUr1FWiXp2275bDKYAgdXW6jQw1OQSnvGF7d5 6/Db8DmCJJ3O5yol2MYiIoCgi9I1XUNK1KDUNOlMN5bsGhkABoenQ1BB8D1yWOZibDj6vTQzYzCf 0/d5vRLbz95xubmzvNWvGna2lSVbaMLAp4Ny4sYlUnlT4gaj2zLjr5CQv6etPlPaWowxz1hs449T vZ+zZmGpfnC8kHGzt2Eh/aaiAHsdmcn8MypdpYh9MST5uHPWKdh+cd+LYpf24Myg8ZYAPiNTSqsf h2pvU4MXaOP+OJvyUay/Jkfla+l8329tfyX6ixtpVmudIADTi4jZZIRcOaFBG6cwqCjUDB2XY5xy RnvHk52Llztm+RbEj8w+YtG0G7s7rVbj6tBJHNEj8HerkxtSkaseinJAW5em02TMCICzt+nvS7/l a/kD/q6f8kLn/qnjwFyP5H1P837Y/rd/ytfyB/1dP+SFz/1Tx4Cv8j6n+b9sf1oiy/MnyPeSiKHV og52HqrJCP8AgpVQfjjwFrydl6iIswPwo/cyRHR0DowZGFVYGoIPcEZFwSKbxQhdJ/45dn/xgj/4 gMJbMv1n3l4d5T8mnU/zc1yz84Il3Oq3l+sCyJIjJJcKluzmN+a8IZaIrgEcQf2VOY8cfrMj8HKy aoHTxxR2oky8z0+Qeg6tY67pjQafp9/bahfTJO9pa3R9G6lWJCaclV424ll+Iqg6AneuVS0cSbDQ M5pq6LS2yxyWF4JZisISTlblXlIQUl5KoNepiJI6jMeOlyX0bTmjTz/zDDb+T9cSLQrv6x5huNKW w13UmAkeCVRGFmhdhVJpI1pwHwhQjMNlDZefNHFHbm63PnEBvzSDRoLFdQsYbgpHYrJEkiv/AHYj DAEN7U2328c03iy3kBc6JHvrb7XA0kuLKOLqXo2teVj528s2umNqoi1zTpTNdLOK83CGJwwUKVUE ng3E/D0FDXLdHKGTj4gASbEq5w2q5eXUEvS4NRLBkjOO/D083iJ1HWNGa/0u1vpIoZi1veLbyuIp 1Quo2ISqsrnqvffJnLLH6YnZ6/Do8WsiM2WO8ulnYfCrKtpXmrUtPht7VSJLGGqtb7AvGUZTGZaG QVZuXKta/dmLkhHIST9Xf599cmrN2GAP3Uq8j918x9r0qw8w6Zq+l29vYGOF/SMUVrIOgjC8lP2g aBh4/I0OajUYckMnHMXGP8UfPr8/d8NnTmPDeP6Z9xRzR3tqtuvKCVEiL3jQo4LSBdxFH2q2+7Hw 365izjjkTuSSRXcP6xPd5JBkANtuv7Epjhli0a5vbS3RNIkWCeL1hObh3Z1DiWKUBj9kCla5uNNC U8w4ifEiJD+Hh5Srhr9TTjIiDVcJB775dWXaB5fvbfS7OKaS9LWkb2d9ZB6vC3NWt2VYOTqrR/5T cRxHTlXoMmE8IIA4uvV1UMguidkL5sstJ1xT5buY5E1HjJ9RvJo3CiaFUP26DkG5/FTwPQ8cxfCk Bchs5eHUnHMGBqQeC3drNaXc1rMOM0DtHIvWjKaHpmLIUafQMGeOWAnHkVW10+8v9RWzs4zNczPx RF7n+FO5wkXLZox544tPGc9gIj8fF6vo/wCT2jQWqnUnkv77b1IYZBFEnIVoT9o/P8MmAA85n7az SPo9I+B+dpJ5l0Dy9pt9A2nWk1q3KWFlnYMGeLgS0dC3TnStcOWBEbDz3a3ampli4OI8JO/47ktz FeWp2KuxVX0/UL/TbxL7T7h7S7jBVZoyK8T1VgQVde/FgRXfqMuw55QOzdhzSgdn0N5W1K81Py7p +oXkYiurmFXlVQVUk/tKrVIV/tAV6HN+Ds7sMC/Pj/jm6T/xml/4gMtxvQ+z31z9weNZc9U7FXYq zj8uPzBu9Bv4rG9lL6LO3F1Y19Asf7xK9BX7Q+nrkJxt1HafZsc0TKI/eD7fJ79UUrXbrXKHi3mm tea7ue0NlZySWei6SttDreqRukJeWSFX+qxztX0qLJHzcCvxcVKtvkq3csY4ynKzW6D0bUZNJvtI v4ngtNCSS5tpS8axRtFcxrczXLSRkIpWS2ADyAl2JG3IE0nKOPhC6mEOcQzDX9Q8jajoH6Tv76KT TY2AjvrWZxIJCrJwie3Pq8ysjLxXehIpkyacQvLtU84xJK8XllLuMzEhtX1K4nu72jbcbVZ3lFuG B+19qm3FTQjBza6I2juXDy6wDaO5YnF6fD4DVamrVJJap5Ek7klq1J65rMnFfq5uuy8V+rm1c8/q 8vpxrLJwbhExormmyk0NAemRhXEL2YwqxeyeeXfOV/ol9BdQw3U2mwrHC+myXDCZoYVKhgyyGPmX LS8GYp8RXbqNqNbHjr+F2Q1ceOv4WI+c4tKk8xXV3o92Lywv2a7hqCksRldi1vLG4V0eJgVoR9ni a75j6rEAbjW/R9B7A15OLgkDUeUq279ykBFNj1zEelBZB5J1S1sdaEd9cta6beo9teSLWoV1IQgj 7JVyPj/ZFelceDjFVZG4+H6w6PtzTgw8Uc47H3H9R/S9B1e+t9JjS6iisedm8Vm090ZPVWJp5YpW BKxhFLWxaiv9lCTX4cH5OJiQeI8VyIFbnn+Pf73lPGII5bbMk8teWWuYbbzVqjPLf+vbQ2KFqJBE 97GXjVV4g8T8HJxybjU9Fps+zsVRugI/w+4bWff9zDjufnwyv/Snb4PRp9OWS+jvY55IJVURyCPh xlQNyVX5q5oCTTjTqc2DgJRcfoHynp+o3V7PI1pf3RnFvKXuGaWSNFaGCM82bm0ZfivcsfHFXz95 k0TzbrF9qnmqTRZ7awWXnJ6kYhCRlgqcQwj9QIpALKD0qab5rcuGUpGdUHqNLr8WLAMAlxSkdz0i Cd+f6mTfkz5a0u+0nWtTk+sSX9svpelbrG5aF4yxjUSVRmkpxI2I8RXDpMMTGzza/aHVTOUQ5QA+ fS/0D9rJtEudN0i2gtPMdtruiyALA/1gpPacoIRxVLu1Q8+ca7Ox5EihIbMqeLGN5POnMYjc0GO+ Y/OYvrK40fT7aODR5ZRJ8acp3CsHHqO7SVPP4q1r75gZ9Ztww2DrNRrb2j82KlTWqmm1KdR92YQl ex3cMTvY7tivffASOgQSByDQUjYUCgUAp0wmQPPmpkDuRuyz8u9W8n6XdTw6/p1s/wBbnWdNWmiR /ScKiKspYEqi+mOL/s7lqDfNnpNREgROxHJ2OlzxI4eRe6xSxSxrLE6yRuAyOpBVgdwQR1GbBzXm H58f8c3Sf+M0v/EBlmN6H2e+ufuDxrLnqnYq7FXYq9m/xbP/AMqZ+tcz9c9P9G8q715enWvWvo7/ ADynh9Tyv5Mfn+H+G+L9P3se0GC+k0S7aT1Gt7TV5W1CJVZ3EV1euQ5ROTU+r8ACP91kNsMryE8J 4ebgGYiNvqlI2m3nzzfpemaJdWsFzH9altnEMEbhW+NSi0JjlQAVqa06Zq8GmmZWQy8GcgeEchZ8 gu0nynZec/JX6UvLuefWpZAXms/QVontpZPTjCMIkakUxDeoSaE8SK5sBgiI8PR1+pxniMZ/gKH5 VWcd/ealahLm2S3hKvdcBA7icsiEFXkNTGvqU3A5KBupZsKGAcQ4JcNd1EnvuwdumzTjwxxjYLfz M0S20LQkuFmNxc2Vs3rQtA4ScsGkMqOit6TiTk7AORwryViFIpzYycvBKUaO4/nDcD5dPkyyYYTj uGAAMzxxopeSV0iiRerSSMERRWg3ZgN9swoQMjTocWMzkIjm35t0rzJoNrbzTWbRxTTek86lJAqi Nn5VUuBUqF+LLo4gASd6/Hk73szsbxM8YZfplfL3MMmYvK7E8iSTXxrkJGzb6jo8McWKMIigAswO Sr2Omtqd7Bp4Z0F1KkLyRFRIiuwVnXmVXkoNRvl2nNTBdT24R+VkD1r7w9w0TyS66vHqk9+bhYZ5 bgW0lpLABJcIyyFfWkc7+q/Y/bb6DtEV1qrsHl7h+KDxdWb/AEJ013qFnZW2kRSxpapq0NvbCOPi 6xGSCdAS5dSUaagNOgFe+bfTS4oAp0+EGUz3RP8AuSiNU1CWaxna4drpItQ+rESEGOWABjR4gBFX 4RuFy8Bnj00bA74X8WL+Z7CztPOWjJE3p3EWt2aQsuxMMkqs6MQKkLxUCvTfxx6MpQ4sRkB/Dv8A CUXsNxDbz28sFzGktvKjJNFIAyMjCjKytsVI6g5B1Tz3ybqXke18/X2ieVLmFreay9e9t4C8kQuY JQo9KUsyV9OUh0TpQdKHAIgcmUpylVm6Yz+bFvrC+Zpbi6WT9HMsYsJDvGF9NeYFNgfU5VHX8M1m uxzMtgSHWayEyRW4YQ7qjqjVDMxQChPxAEkGnT7PfMDw5Dm4Xhy6pfrs8sdsojbhzYhz3K06DcU3 OShyJek9lNJHLqeI78G9JTaaldWqsQSyuPgVt1rt8Xjhvbd7TtHsPT6vJG6jwfVw8zfJa+qX7NyM zDetBsPuGIl7vkGyPs5oQK8MfM/rRlrr8walwodT+0uxGCgfJ0naPsfjMTLTkiXceR/U95/JSxuk 0O51H1w2nX7qbKBWBVWjZxNJxB+FnY8WBoarvm40sZCHqNvL4cc4Dhn9Q+xBfnx/xz9I/wCMsv8A xFczcb03s99cvc8cy56p2KuxV2Ks7/8AKOf9vb/mXlf8Tpv+R/8AmK/5Z6joerLNYapdTafrFqnp RXlu/E3VnWhinjYSRy+iaBXdKqrAKRQ5jarPDDRmaBdN2loZYs9w5S9Q/T8vuW6h5f0KXzNd3tqZ WS1nNtGzykkzWrGGWQ8QvH94hHFdtq96ZfEmm3RznLDISNxmeX49yBub+8/L/wAxfpDRriO+gu6Q yxMG4vGvFyg6HrUK1DxJ6Gp5HhsNsdGNTjEdoThHYn+aOkvnzW3/AJ7awutV1by5C+i+tYXDCCVl lDXVvayyo6qwZVCuvFF6MoFR0Uajw8UswrnGzdkc67ufndvM/mPWYA+9MfOnntdeghsbdXijqJbp pCvqSMgAFAv2UDVr47DYVB18oR8SWQcVnqfx8t9ugDjZ9dIw4YjbvYkZJYmSeKQRTW7pPFIRyCvE wkUle4qu48MOGREtt72+bgafIYTBD1fUNCv/ADN5NtBq0VhZ3WpxRvZxtdvxWeWMtHQiKjP/AJK8 u9GPU7MaMg7HZ6aGq4SJAeqJt4FrOjajo2ozadqMLQXUDcXRvwII2II3BGa7JjMDRfRNHrIaiAnA +/yQOQcpnf5a+UjqNw9/dF47MK8ShaqZBIPSdag9KSUyrJmEfT/Ft8PUP0/Lm8123m4yMY5R3Pvr 9A+9nU/nfTfLiPb6pdCONVje0WG1ZpJVevIcfUjiRkUoWpQVJouZ+liM9k7V+Px97zGWRx0AxrUP zHtQ+n3GnXM2oW6yPcfV7xESaB0lVwVlhjgjPMx7qyvx/m6Bd1ihtQ5Of2RpZ5+OjUa387sUvT82 NOFtZW36LkVIJjPcFpQ/quaCp+FaAAdO/wCOW+GXZz7Hz+qQMbqhz/UidI1yLzj+aumvBE62EE7X UZYfEXiX1eb0rxqYwFWu3SpO5jKNRcPV6aWn0lTrjmQK7gN/vq/g9H8zXd5fQNc+gl35cika3uLR 6hbgqxSRpB+1FyqgU/CepDArSsC3S6bFCZIJo9Hhv5n6fb+UfPdtqPlhzp8Nzbw6nZiGirA7s6PG gG3D93Ur9mjFacdsXHnExNFnF5+b3mm+0qKD0YdOvGSl3NAS5JO37vl/d7e7EHo2arPrukPm63Nr OkWFSfvSWkJZieRYk1r4165rxM3bgiZu1OW2hm/vh6gG4U9B91Ml4m1ABytPrsmEk4zwE9RzSLXo uF0lKBOACKOgoThJsAvofsjqfEwSBNz47Px/sSzA9W7FXrf5A+a5LbVp/Lkxrb34ae22+zPGvxb/ AOVGv/CjNjocv8JeR9o9CBWaPXaX6D+PJlX58Kf0ZpTdhNIPvQf0za43E9n/AO8l7njWXPVuxV2K uxVnf/lHP+3t/wAy8r/idN/yP/zEJ5G8r6ppnmRptRja3mSzg1C3QUPNbmSVF5HdV4+jVgf5h9Ok 7d1BEYxA63/pa+HPvcbWa6GefDH6Ybe+9veyuOTyZqnm99Pt728tdWukE9+kUatYm4PFXozglZDy HLieJNT9rlmTg1n7mE5fx0PiXTAZcRPD9O/2PP8AzSp0/wA0X9lql06m3nMWnw3YjjPpA0SRKLGJ PV+1yG3ReqnIazJlPpiPS6rW6zUSHACeE866pfBNFPrNpZymRIbloOUsZCSosjtHQLKViq7Mg+ME inTehxMUNqoXZv4fjo3dmaTFLBknkFmJER7z+oPSNW8m2dr5Ye0s7iWS4mu0urP60KMZfS9P0mCK lAUDfs7E1oehnihxngAoV+C3HRROPw47WlGn+UNVs/NVhFeIsljY3Cz6rdQH1Iokg/eBWBCOweRV QgIdia5kYNCYT4ibcHF2bOBEjuDyZ+8H5b2DSX1vpck9yZVvYo44Lhn9SN/VD2yycVHxJ0ioD06Z sKcvwpb7cmEedPzW8ja+otrny9Lfxov7u5lkW2mjY9lKCQ0+mnthlpuMUXodF2Lqo1OMxA++/u2L y1INKn1lAHkstLcgfHSaVNzUlx6YI6fs5hZ+zagTDeXc7+f5uGO7hM9fSeX+m391PbbWTTLS1s9M 0uRngSiG4FCqleJJdxReTesH27Zy+phKfqvh9XWx/O/V9geXhMX3/gfreYfm9qEV3qdj6ZUgRu1F NaBmCiv/AAGbrsWJqciKuQ+wOv1xFgDuYZp80yysokYKIpiFBNP7pjm7px8B9Xwl/uSyTyh55sNM KWmu6Va6lpZ+F5GRI7iJN6ssvwhqVr+87bVAwXSceonA7Ej4vedO0fSPL/lGbW7Cy+p6lfwDhN6Y WeFbtkEaFWoF9IFC6gAFlJpjdsp5J5p+o2SUKNQ061JOmtJ+iZV9G70+TrGrDiGQVYU8KdDt3GTp 2UcMqAlXEOReNfm3dmTVrCxkj+KztChkKkcleeU0qftBSDkTzdfrSDksIXRbjVZ4FN0iqgUcJTUO /apX8a7fLNJqoYoy25uh1EccT5phIshMZViArVcD9ocSKfea/RmNEjcNETHcclwYEVAP0gj9eDgL Hwz5fNKNfn+BbcxqXJDpKegUH4h41IBHh3y2HCPd+l6v2a0mSUjlxzMRExifOzv5bDdJX4VHHpkD XR9Hw8deurvp3fMrcDajtD1W60nWLPUrXee0mSWNSSAxU14mnZuhyzDLhmC4XaWEZNPOJ/m/duHv H56MraLpTKaq07EH2MedFjeT9n/7yXueM5c9W7FXYq7FWd/+Uc/7e3/MvK/4nTf8j/8AMee6dqvm aXzbe3dtdSTXIgktzJO3qgIbiKOJQJGA+Av8Art8qjNdrcGLKIwydZbe+ifut5nTyIySIv7+rN/J sOo/p+6OpPbmPT7eWN5KdHuZI5AWdAD8XpM3x/1zWds6bFCAERvKQ2NkbChVcna5IwiYmPEPSbuu /nfUc2vzI8+pqEdpYWIP6JsG5WxNQ1xNxKtMwFKIodgi+/L+Wl5mI4hjHIDf8fjudRpNKdfqDjBq POR8u4Mc8q3FzfajKVkSG6FuyW7tsyvyV0lQU4syMvIAiniGFQbNHESJA22dzqeyBpcfhQNxnLis 9CAdvjf2Mvs/PmuWuuWEutxCa30+YreRxIOdGQcZoyAok4Hi1ABVainLbLIyGHJwna+rzmbUzxZO DJ82Yxz28vlKE2M8dzJqN2yXMsbB/ijYgIxHuAaHNmDZdxjyRnlJ/hjHZOoLSGTzlLZsP3VtZiGA HspiVf1O2C9mmUyMAl1Mv0vnLzHAtv5g1K2VQv1e6mhKrSgMchRgKeBGZEDs9r2VPi08D5V8jSXZ N2DOfK35m3+m6MNAvI0n09nHpTuvKSBSanjXY/Fv4jcjemYuXTxl0sPOdpdjiU/Fx/5wHXzH6vlu xzz7Z6dZXFn9QtXgW7iNyJihVHVmIVoi1Cd1New2pkCA8nqvD4vQj/JH5W+Ydf0ga6JILXS5mNpa PKS0sryy/VS3FK8UR3NefxbbCmIYYBcv82X+5L1ryT+RPl7RHS81hl1e/Qh41ZStvGRT9gk+oQa0 Lbf5NRXA1J3q/m/T7+d7bTw73el3cTKXAEUzVaIhKNyYK5puBvQioyEMkZEgHlzbYY9xxbAsP8/+ ZYrDRb3VZLcWOrBOMSqoMczS/Dz4uGFU+335AZfydhkn4eP0nij08nmdtpQDrcX00l9egf31w7SU 3rReZOw7Zos+tlLYbB5TNq5SO2wZFo/l3VNVmCW8TLGysy3EiuITx24+oFZeXtmNHHYsp0+inl35 BrUtCuNNs4ZbwmK5mlljW2YUPGGgZwa7irfxxljoWufRnFASlzukX5NfQV1Y/pj0xD6bGJ5yohDg jZ+W26k0rt9NMlijYNc27s2OMyPFz6Ib82tD0uH6rqGlxxJHUx3HpvUMT8SlIxXZQDybYdBlsoHh 5cntuwc8MWUwFAZP90Px9zzbKHsnYqqW0cklxHHGhkkZgERRUkk9BkoRsgOPq8ghhnI9In7nv351 wC38u6Lbg1EMhjB/1IqZ0mN472f/ALyXu/S8dy56t2KuxV2Ks7/8o5/29v8AmXlf8Tpv+R/+YkFn on6B0y41PUHEct/fW8ioPipBHN6gFB1YjkzU6D5Zz8daM2tjGP0w4vny/Y6KOHwgZS5mQ+VqU0l0 0SpOjW0upKuoX0Bpz4OzLbwMQPsoFZnX+Y0rTY15s4y5DkG/AeCPl/OP6A67tTUzhADkZ/d3fp+K X6tZtc2p9Mcpo/iRRxBbxWrePzG460yGM9DyLgdjdonSZxP+E7H3IyG/kt5nFnqKS3KWcUUQ9A9V YllFaBePfkO9Dvm3OQQupDaI6PUZtVDHEZJXwyJI35jbYbdP5x58vcpJNcTyNNcMGnkoXKghagAU UEmgoM1WoznJK3itXqTmyGRTnyXrWl6L5gF5qNv6trPE1vPNGpaWMVDo6lSG2ZKfDvvtmToc4iSC dm7RZuGwTSP80fmRaQa9aXmiJdwW8ZYXc00peWXkSBx5tKQihQQOQrWhApm2wTjkvh3p6fsjCNUJ wG/DXfXN5pq9++pardXzA87qV5SDu1XNd/fMyIoPcaXCMGIR6R/tQUd5p8cv+kepKgFeEJUcj/KX NePzCtkJZe50uu9oYQ9OL1S7+n7Uwg19p7e5t7DSbK3QJxFy4lluRzqAebycKih3VB8jlJkS6D85 qdRZ4z02H6gzTUYLTXfy48qJFJbwz2RvxdS3jheEqupkjBoaI5lDjYkDjv1rianVDDRMZSvpEW1Y oRnkkcgo918O/wAQfuZN+X+uaRYWEulm5tbeG4n0++jgSVAiTmeIXKpvQKVRXoP8tvHMkG90GMRO x1gfnwl7I6llKglSQRyHUV7itcDgvJ/L3kjy62mRLexw6s8fJYpZUFBETWIFCWCv6YTn7+2aaZ8O cuHay58fVEXvSIsPJnlnzJHqWizyi40tUR7A270e2uFaQSuaVUyBZIwrOPiTY1oSdlp8hkN+bi5Y gHbk811ny4vl7WLnT4NXfVLW2AUH0lQo4J5JsZGcrsK1G9RTMHVHHx0AL6/j73U6gw46AFp7pP5r eXdHudL0uWJls2g4z3ikymOViX5HiWrG3UACor0pjDTylC3aaXOBECqoMq80aS/mKK2+oXDzusP1 mCCKNOHGVQytNK5qOSbqBxpXevTL46G8e/1Nmp0/jYySaHTzLHfy/wDLEus6ndFWhSbTUWQR3UTT Req7ERiWNXhYr8Dbch07iozH0enuRMv4fvdNpMHqJl0+96dZ+V9YvDrUHmq9t9V07VPR9GyjgMSQ cIwH9Ms8jgcgGX4jRqsCOVBtSLdmCQbHN4L59/K/XfK1xJOI2u9GLfub5BXiCdllUfYbenge2ajU aYw3H0vddldtRzAQyGsn+6/b5fJhiqT0p9Jp+vMUB3k5iIs38Bf3PXPyN/L/AOvXf+KNQX/RbKUx 6fEwB9WeOlZgdxwjbYd+YPTj8Wz0mnr1F4rtntc5bxRFRB382Vfnv/xyNL/5iH/4hmzxsfZ/+8l/ V/S8Yy56tM7fSIVCNqk7WEcyK9s/pGUSK25+yRSgIP04LcaWcn6BxVz3pkVr5T8umWKyTUvrd3fo rWqvbTQkI6FhKriQx0WhLBgehG3XI2XBnrMtGXDwxjz9QPw5WwrJu3Z3/wCUc/7e3/MvK/4nTf8A I/8AzEdBompeddPtZdMEF3YQH0Ha6Vo3trmJmiL/AASD1lRvtR/CeO4boM5jBpsvjyoyBB57UQd6 7/ju6TPqANx1vvvu/AQfn6y8uWdvb6FBGLrWLcl73UlmmLW4kPJ7aGQOH+JgOQbZVA2BpxyBhjpo kXxTl5D7uX63S6/WAiq9w5sPeGSOVpbdIy0gUSBvgJoftcwGJoD0I+7KPEEhUrdOcgkKlbpLYyRy gEQvMtHaOoblx41Ljixp2pQ4jIAR1rv/AFJGUCutd/6l4lkrR4mA/acFSvSvcg0+jBwA8j96xxcR 9Jv4G3CRmYcWQ0B5IDU9qHl9/bDwCtwff+P1pli4fqEh5kfoSzW1uBE0xXlFGoYqgJIoSCeR7UI7 bb9c2fZ2aEARe5ej9nu0sWlEyd5HkO/9TGprqSWq/ZT+UdxWu575sZSJbNb2nm1B9RqPcOX496hk XXr45ZYm5xsUalKg02xZQmYmwaZb5T0C+vYrWTVZZn02/ef6iAFVKwKiuylVFSWqrf6oycZO87O1 mT1S4v3hMRe11Ur5j3PbPJulWSeSLrSpIhPZfpS3hkinVXSSOSS2LKykUZSH4mo3yB5uJmJOeRO5 Il/uSz/TdL03S7UWmnWsVnaKSUt4EEca168UWir9AyLrmHat5J1myvLqfy28bWWoNM91p00rwNFL OqhpbWYCZUHKPl6Zj+0zEH9nKMuAT36tkMhi85sdT8w6V9bh08Uvp62N81orSf3UhXnEwHLiG5cG I2VydjvmrwRyQyTxw36t2tkZ4RONcXJKLbyx5g1y8k0rTZIrK6VXM8t2XiEfAheJKq7IxZuPTY++ S02OPETk/h7/ANLotLh4pkSG4Yv5n/LbzloKLLeWQlt2mjjW6tpEnjLOwG/E81r4uozZ4dTiy3wS Eq7jbtJQI5h7R5Ts/MEOgw6HqUa2V0kayandLIJa20S8YySpbsrAiu7A02yzBqIZY8UCJDls7LDO gDL6o7AIq2W606C41TSnayGozJBEq8WdxECA7Bw8dexPHqct4Qzlp4SnR+qrJSPz/wCfvP8A5f1J 4or6IQMGhVFgSqOoBD1dXqSN/Dr8OShAFyezuy8WfaRlfPpy69Of4p59rn5h+cdctpLXUdSkktZo /Rnt0CxxyIRRg6IFVuXeuWjGA9Fh7E02OvTxHz3+zl9iVaJAbnV9PtqxIGuIgplWsQo4NJAtD6Z6 MAemV5MEKuhbDtPTCGml4dxO3IkdR0Gz6w8v3lheaLaXFhEtvasnFLZAoELISjxUT4KxupU8dqjK XgiCDRYB+e5/3EaWP+Xh/wDiGWY3f+z/APeS936XjGXPVvQfLzwX2iW8esadYXMQobe5lvUtZuEN YleWIMruiBSpIoeK96DKzzdHqQYZCccpA9Rw8Q332PQn7z0SrXPNOr2rvaadrK3GnXMQ4pBEIliQ j0/RRW5vGAijYNWnXeuSAcnT6OEvVOFSB6m7635sTyTs2d/+Uc/7e3/MvK/4nTf8j/8AMZXdfmY9 ppQstCsE9RIBGl3O/BRKEpzESq3Na7/EynNTk7QxQlwgdejzk9JOUifN5vHpN+UHpQy3DV/fOivL R3O3N6GrSGp+Ldt/fNcOLKTIWfx+h0mt7PljHFfFInk1qWm6hpk0cOo28lpJLEJ41lHEmMsyVodw QUNQfbxyWTTzgBY5uBPBKIF9WO3+ukEx2v0yEfqB/jkOED3vb9jeygIGTUfCP6/1JRLPNM3KV2c+ 5rjb22DS4sIrHERHkFqO6MGQlWG4I9t8QaZ5cMMkeGYEo+abQ60n1Fo7lPWc1QKRsyEUPImtcN7g jm8TqPZDi1N45cGLn3kHuDHJofSKhSxQjZmIJqOvQL7ds3WmznILLhdq9njS5BEGwRaizVB4mlOr HoKZkurZR5S8nJe6zaDzDJNp2jM1Z7jgWc0IAj4IGZOVftuvFRucxhq8RlwiQtu8CdXWz3b8w9L0 qDyromraJGkmnaLKkcTWrh0WxuKQuyUJ50YRkmtaBjucyAWzTZeCfv8A1o3ybJHceR4L+PlxvdTi kUMAPhjv47dSKdmWEMPnhPNukSc0r2NS+yJZ5kXBQeq6nZ2FtzuXZTJVIUjHKR3I6Io7969B1NBh AJ5IJA3LzjyboUfl/R9RvtXSN6I4qCWLLxIRCD8INKswWtP5iADk8WDwgR1Jv4OJDfly/SWP+W9f S+84xXfqVe8haCa4dFiDyIlOZCu6VkMa7ilSfs5z/auI5QY4vqIHlyIP3N+CQjnBPc9CMU6W5L/u uMkOz1WlLhO59+JzS9n6TLxzOK4jhkCOXq4dvhf03uK3o89rmmKF/gJRqcj3Oo/ojTrmIauY3a80 0V9RrRByJ2PGMiQx8eQ3BNKVY5uewjlqXiR4eXlZ3s1+mt+t0g5IQnGQ3TRZbK8u/LVrEwdLdT60 Y6pKiKSkimhV1ZfiVgCM6DvZQn6ckh1YJ+a4jvbHVLpagQ3cRRyPhYIDEwDeJ5A/LJw5h23ZVwyY x77+IJeQZkPYJn5aZo9esJwpZYJ0keiF6Kh5E8QGrsPDITOzru1MsY4JAncjYdfg+kvJU3p3Op2A mS59Mw3bzxUEYkuA6PGgAXZfQ5dOrZil4DUD1XVAsa/Pf/jj6Z/zEP8A8QyeN3Ps/wD3kvc8Xy56 tlXk5riKC4uDFYTwKypFHqsqi29QirD0ndAWK/tdvxEZOt11EgesH+gN/nX2KPm/SLO2MN/ZrBDB ds6+hbzpMgKBd0o8jcSSR16jttjEstFmlK4yskd4r9AY3knYM7/8o5/29v8AmXlf8Tpv+R/+Yx5b qSacW0hQrE6CTiGB5KQy0bl0r/TOc1GnECZC/VxV+PN53NqpjLESjUMhPCeux2+3oynQ9V16xM9t olRd3gAHBDJJ8HI7LuKfFvtXwIzG0efJGxAXdORqMUTvI8kV+b+pXth5I0rSdY9G51u6kaQzMqvJ DFGa0V+oc1VWcdaEb9c3GfJKGMA/UWfY+iGfPdfu4b/qH46PEs1b3y9I+dfiAp1rX9eEC2nNn8Po T7v1fqZP5I/LzWfN1zMllJFDbWxUXNzIwITkCVog+Jq07Zfi00p9Q6zW9tY8AHpkZHpRj9p/RbPf zL/KvR/L/wCXq3GkW7T6hYzpJd3pHKSSJwUfkB0RWKsAPs9e7V2P5WHDwvJjtjOMxyg7np0ru/G7 xmGafT7qHUL7R/rVieULw3SyxRnkjhf3oFAwbdagj/JOW4sIxig0a7Vz1E/ElEDpsEwsfIWvXekQ X6vaRwTwLOBJK6kIyBgSRGyjY+OXU1jRT4OLaqt7d5v8q6JougaZc2XIzzNHC5jlaWF6ws7SgyF3 pVNqNTfNP2jpcYgZgVJt0maZkI3snPkLTrPTPIeoahrVH02/M+oXEEwEkKWgjC/Y+JSskcXqnbfl mdpYGGOIPc42aXFMkJRqP5i3It7O10nyw9tpCTQuWeSKFo/SmWRUW3j5LR2UCquevTwpj2ngMuHi 33+wbuTg02S7rpL/AHJepQTw3EEc8LiSGVVkikXoysKqR8xmc4LEPzQvYNO0i01EJy1CG6RLM1Cg iQEzI/U8GiRu32gp7ZGWfwhxdzTnIETbzXX/ADxfalELW3U2tmOQ4g/GwbqWI7sOtPl88DV9pGdi GwdZkzbVFiGp2P16yktufp8yp5kcqcWDdKj+XMDBl8OXFVsMOTgldIGWHzilp9Rt9buPqJIHo/WJ kUCtGogJUfCSM2Q7QgeYLnjWw82b/k6mj6B5qn1DU74RtNZyQ/WbhwitI8sbUFe7BSd2PTJafVeI TezPT6jjJ6O86fmTYXvnqy1bRLmX9G20ccUlxFziMwR2YtQGJ2VS5HFtjTup32MIWC9X2Z2Z42nn KvUT6fhufnyQP5iee01izi0qymjmsxKLmVoYfRUycKDYhTX4jyyyEOrtuyuzjCfiTBBAoWbP4/Wx DSL2ys7gy3dqLtKfChNKN498lIE8nY67T5MgHAa+JH3Mgs/MdzqOo2um6bZrax3c0cciwgGRgzBS AQB47bZAwobuo1HZ4xYZTySA26d/Tfr8g978n2M0Ml7O0MdtGRHarbxHkvO3aQu3KrVNZeB36rTt lBeV1ExKWxsMV/Pf/jj6Z/zEP/xDJ43c+z/95L3PF8uerZB5YvAqT2MOnx3t3ckFRKk8ysiAkqUh ZW960P0dciXB1ePcSMuGI9w+0qOtaxFd2FvZDT4rCa2mmklSESheUgRTRXd6VEYDCn7PXc4QGenw GMjLiMgQOdefl5/akuFy2d/+Uc/7e3/MvK/4nTf8j/8AMYbEym6vGjDFy457Fd+vwswCstCNx/Zm qz5bIB2Eb83kNdr5zMIyqIxWAav5sq8qeYl0zU7PVrusMVrOI52btFJ+7diFryAV+W3h4jMHSR4M 4EeUg5eDxNRh5cUr2rr8GMfmj5jGvedL66ik9SzhYW9oQeS+nEKckI/Zdqv9OWavJxT9z2HYGm8P TiXWe/6vx5sUAJIAFSdgBmM7okAWXoHlj8n9X1GH6zqsh02FlJiiK8piSPhLJVeI8QTX5dcmIgc3 Q6ztsR9OLc955fDv/HN6L5T0HR/KumanqPlgyanqFxG8EHqSxvD6sLFSrcfS+xKpDAGvbrmdpssI GiOEvMa3U5tRXEeKvIfoSaT84NSudD1LS9SsFe8nSW3juEPopHyBikWZG5MHjPgN+h4kVOyHk6wH dBar5il0BINRijilpIY2E6l4wrxOCWVSKin0DqcnJ3PaB/d/FLLLWrJ/Lqh5I47lISslrGEVwR8J EcVYlp/LSi+BpkSLjTCGePgc96TC70KGW+sbGyuGMeswW81vc8PTdFvWMVWSrASIU+KhPQZoZaWU MkIGXFEm69zWMwlCUqo1973IWNoLH6gIl+p+l6HoU+H0uPDhTw47ZvHWvItStpord7OZz60M6QSS 9CWSYJzH+tTkM4U4vA1Uo1sBP5cBL0umnxwB7wfuZ9+Xuom68vrbvtLYO0BXwj2eJaeCIwj+anOv 0OXjxA3fT5dfjzdBnhwzKL80eU9N8w2foXacmBDI9WUqRWjKy7qdzuO2x2zOEgRwyFxcTJjvcc3k Ft5D1csws9PutRuI5OLQ3kiWtvxpNy/eRRGT4Hjj8GIcfD2zGjpcIN8LV+VjfINWn5X+cDBZehZh 7a4ijdJWlRGiRkBCzpIVcOtaNxDb5h5tCZSJB2LTl0ZlKweaYar+VPmK0sEntIze3CH/AEiBDGpK mm8fJhXjvUdSOgrsZ5OzoiHplcmH5M1XVjtv5U803Ewii0e95klR6lvJCtR/lyhEHzJpmENHkvk1 R0uS+Ty0nUbRvqlwGt57V2juLdlWqyoxEiMSK7PXvm/EiOT0un7Sz4RwwlQ7tj968X8/JiypxNOK qGFPmSzVyfil2MPaTUAURE/A/oLQvrkSVpGU/lKtX7wwx8UrL2k1BFARHwP6018vatfpei3tDOby 4K/V4rbkfUMLeuVdFDBlVYyTyFKdTsMgTfMuLDVDUyrUSI7pd3Pah37fJ6PYedbTXda0+We2NjfW 1zZ2NhZ2TllSNJUEphVuKxuzvIrAfFxAUlqZr82LOc8TH+6HP37oOhMcMpkcQvaQ5c6Zn+e//HH0 z/mIf/iGbHG5vs//AHkvc8Xy56tnXl3yjrVtqVrdWaTXNjKVW4mSGTjxp6itGyHjIhZBTi4r0biD kDJ02q1uOUDGVCQ5bj3b9x+HmLSPzqt7/iCaa8kEs9wquSEeJgAPT4vHIA6MOHQ/MbUwx5OZoDHw gIjYfHz5hIck5rO//KOf9vb/AJl5X/E6b/kf/mMNe+iuPrPppyjTkRTY7AEH275rZ6cwnE3Vn+15 vU9lzwajDZ4TOXXlZkbHypV8tXUUkMlnNR6NyQPxAo32vtGmxyPaWlmZicDwy5c6d92oYwlGUhwm Y5dxH7K+SI1ryRNJarc2SqJ1X47YGtVH2aN+01OteuDLopmIN3Pq3dm6s4bEvpkb8x+vz6+96N+U 35VaXb6bb69qvG6v7gCS1RHPG3APip3kr9qvTpktPpREXLm6rtbtiWeXBDbGPt/Hd8/KWa/daT5Z sxda1qqRQSyCG0VoiZ5XbZI0SMsZXLfyIPljLRRPI06oag9Uo1M3nlfQIJbewiS2ml4wxB3BiacP NymQr2fZqPux7ZTqcHCDMm6bMOTiIiNnkl7FqLz3F1PFyeWVpZmUihMrlmKCpNAW79suw9oYTUQW vJpcgslCxWUk3GGFnCcqqCzvDEeJ+IRluANPDLtRqoY4GV35MMWOcyI70jbfSHhaONyhiQAALUkg bdCNh9OYE+1BKB4QQe/o5MdERIWbDLvIUNzJ5v05JpnkgVv9HjkYu0SQ27lUUmvwVQUXtvv2FOkz eJmjZsxBbM+PgxmtgSHt+bx1rzf8wbT6trKygfu7/wBCUHr+8hljjk+Q4GOn05z/AGvp/WMg/mTB /wBJKv0u47Lyc4+8/Y7yTe/U/M7WxNItQj4BR/vxOUsf4CavzGVdgZ9jA9d/lQP2cP2tXaGPe/x+ Ob0jOldY7FXYqwHzX5ludRlew0y6ktrGPaS9tn4yTP1pFIv2Y17sN2P+SPi0HanbHgngx0ZdfLy9 7sNLo+McUuSt+XvmLWLi7udC1IG6NjCk0GoVJYxuxVUmLE1Y0bi1eRCnluOb7Ds7WePj4vx+Px5D H1OHw5U8y/5yH8raDp2q22t2k5i1XVmIudPCgo4iUBrnl1Rt1Ujfl2pRjmwDjF5AqsxYIpcojSMq gsQiCrNQV2UdT2woXWUF1f3K2ljbT3d0+6W8EMkkhA60RFLHAr6A/JL8qtV0K8fzHr0f1e8eJoLK wPFmjWQgtLIRXi5C8VXsCa7mgUhX0jSIbnzsQsStKurXlw8zICyrFdSy1qRUCqhAfcYejsZcI047 z+tG/nv/AMcfTP8AmIf/AIhksbsPZ/8AvJe54vlz1af+XbPSZIjcXF5dpdI5C2tnBHM3Cg+IiSRO QapBUKem+xyJcHVTmDQEa75Ej7h+OiKvfJ9iVLaZqTTSPvDDdQPbmTavBZAZIzJ/ksVOIk149dL+ ONe439nOvPdi2Sdkzv8A8o5/29v+ZeV/xOm/5H/5jFbTyxqbQM8MPGWXozuVUA+O9W6+FMpmJTmL +iP2lwdXkOp1AGQHwMZvkLlLy6gfG0zg8rS2tu5ubuONFWplarKNty1eG1ffKs2mOSVk0HXa/Rz1 GTjlIQh3Dp93xKcDUrWCFEjLvGiAK1vbTypxA24mMOO3jmVbmxyACgf9iU50vW9T0i59e1JVHP72 IVeKQUp+8TYg9KMu48aVGAhp1GnE9yKPeP0s2j13yTrtvXVxZxXZhktpbe9aMSCKanqojvxLRvwG 69aCtCKCs7OpyYpQNFIvN+mRtY6fpnlqN9Wur5WmJe9M7G0swATG9zIyn99LH+0oqevbKNTiOTGY g0SnDMRkCWASxz29y9rPG8FzGAZLadWjkUEkBqMKlSVNG6Hsc5rNgljNTFeYdvjyiX0m0RZ6TrF+ 4Wys57sk0AhSiA+DStxjX/ZMuW4dJOf0x+J/H62GTPGPM/Afj9TMdP8AytuVt3udWlJCKXXT7I/v HI34tMw25dCFWvg2bXT9lwBuZ4j9jg5dbKvSKU/Lf5d+bdO1hNUSW0t4rW6uZ7K1lead3t5xKI4Z W2KNGkwXlyfda5k49JGGWUwee1U0yzylARenwmYp+9UK/cKeQ+8gZlGujSL6sN/Na70y20K2kupC LmO6jms4EFXlMf8AeL/qiMk1JArx8RmPqcPiY5RHMg18nL0eTgyX5H7i820zzNPeyo6wi21S1dZr eMOWjfhIrJvRGPxqquCB8JOc7+RlocgmDxQ/F/ZdeYAcvxxniRyl+P0vdtPvoL+wtr6Cvo3USTR8 hQ8XUMKjsd86kF1SIxVhPmvzR9aefSdPf9whaK/ulPVh8LwxkdxuJG7H4R8VeOj7W7V8AcEP7w/Z +1ztJpOP1S+n72O2lpcXd3Dp1iq/WJR8NR8Eca0DSMBT4VqNu5oO+c32foZarJ/R6n8dS7LUZxij 59GXX+s+WfIel28d48hNy7EtHGZZ5nVQZJWVB+yKD2+FR2Gd5hwxxxEYioh0M5mRs83nP/OQNlBr um+V9W0No726u5ZLe0RXRPVhnga4ElXK/Cn1Y/KvjloWGMzNDmlHkW+0Ly95J82aB5hlFrquoRzL FEkUkjyRSWvBAksaspPLlROVR1IA3xKZ4zA0ead/lZ5b0Dy95zt/TuCbu6tLmKI3Tpyf44nKxgKg Mg49hXjywyFOVq9NHEBXV7ZkXCSK30XSdF1bUtdnuih1Bo1CzFFihqFVki2BrNIAzVJJalMUmRqm Hfnv/wAcfTP+Yh/+IZZjd/7P/wB5L3PF8uerZT+XcyprzROZONxA0YENytnIW5Ky8JGZKtVdl5Cv yqDGXJ13acbx3tseseIfJZ5ulv8ATdamtYLy9AdB65mu/XdywoeTIE24gLQjt4UxiuiEcmMSMY/C NMZyTsWd/wDlHP8At7f8y8r/AInTf8j/APMR1r/vND/qL+rFx58yoavqVtpmnTXtxvHCtQvdm/ZU e5OAtGbIIRJKU+QV1TzK899rLXE1g1Y7TS7Bjb+owPxu88Y9dUT7I4vua1oB8Udy62E8uUWZcMVT zZ5L02ee0vdDtXs721nQTxW9zdTTTwFgJE9VpC3IDcFGqdxuSKJiuXSGMeKJNj8e96H5TtLGHTTN beozTSSeo1wCs68JGRYpQQGDRAcCCK1BJ3JzS6uZMyD0RjNizuUL5Q17y7Y+bdR08apaqt1Gp0+O norBJJIzPHFzPCT6xI5kqn2nVh222GmMuEcQcPNHfZEebvIfmnVb1r+C5tJ5TAsEcUnOErxdyKyA Sch+8r9kU365XrNL40okbcLLTZjjBB3tkHl/yrPorWccEw+qQw+lJDzlcqRTiFeR25IoFN1r8umb E5ARThjGQbY359/OnS/L11NpmmQjUdUhJSZi1IIXofhYjd2U0DKKU8agjMDNqow25l3nZ/Y+XU+r 6Yd5/R3vIdZ/Nfz5qshL6rLaR8uSRWZNuFH8vKPizD/WJzAlrJnls9Ng9ntPD6rmfM19yR/4n8x+ v9YGqXQuP9/CZxJ/wYPLK/zGTvLlnsfSkVwD7UfZ+ZdU1PUdOi12/mvrS1MioLtzLxWYqZOTvydw eAqGJHhSm+bpNWTLhk6rVdiY8UvFh9ABuJ36HknM88ena1cCzKyLA3CSE70Esas0df2TR6qe23Ud cnV6YZocN11HvH3vL5SMOU8PL9b2j8sdV+s6XPZM/I27+vCd/wC6uGZiPi8JVkp4LxzG7OyXj4Tz h6f1fZXxYaiNSv8AnbpZ+Yn5nWenSNomltJcXrErf3FqVBtlHVA7FV9VunwmqdTQ0zLyiZieCuLp fJqgY36uSQ6XOl9a2y6TCZ3n+C2tx8Jqp4sGJrxCEfGe3vnCx7PzZdQccvqv1H9P6nenUQjjEhy6 PTPLvl630W1kbl617PRru5pTkVBoqAk8UWp4r9JqSTnbaXSwwwEIcvxu6TLlM5cReeee/LXmvzJr QuYjAbS1Qx20TiWN4w7cm58VlBLUUV26Zn+CR1Dh+OO4sVj/AC68zaTeJe21tZvLEWZoUYq8nJSG 3kjjCtv9rlh8E9KbcOsGOd0gp/Juu6j5kNxf20ml280Z9e5do7iAKqovpvwlWgoGYMw2PzyJxkHf Zln1IyyMo/JO7/8AL55NFtdbPmvT5LXR5o7mO9eI3CK8ciuq8opzISzKBxVyx6DIkxHXkk5MswIn 9v3J15Y/M61v9Tj0eC4uLi9lLiC/u5IbOB2FXoUBlanEHgAGYjrTc5XHVxlsAGzN2dkxC5WPxyPn 5cx1ei6Rp0Uxj1O7uf0leUpDclPThjUih+rR7hQ389SW/mK0AS1hhP57/wDHH0z/AJiH/wCIZZje g9n/AO8l7ni+XPVsg0HX7KysntJbO0eVnL/WLq2S5VgQAEev7xAKdYz/ALGu+RIcHU6aU5cQlKu4 Gv2H4/NCeYdZg1a5iniso7JkjEcgjZ3DkEnlVyT0NBXt9GECm3TYDiBBlxbpVhclnf8A5Rz/ALe3 /MvK/wCJ03/I/wDzEda/7zQ/6i/qxcefMvMfzB19r7U2soWraWBK/Cah5qUcn/V3X7/HIEuh12fj nQ5B6FH5z8qeV/LVnpNjcRFLuGBriSxkSdpdvillWPaN35hnDNWgoAcApOKWLHUr4j3UnOmfmJ5M 1DXdNt/L7STCyQySwSRPCwYn45HldRH3X9r2HbDbOGczjIbmckoS+udb8xeZEuWuJo4rqW6jm06T 0onitIIFktRbu3CaRzIil5F6fyNxzFzkRo0OLk42MESruagS1fSJ7HUXSB9at/qTaiCqpD6wduR+ wGkDFfSPEVkO3HlTHUxltLuczNA8IJ6jn9v483r3ku/uNQ8radd3DSySyxbyzqElcKxVXkUAAMyg E7dcuHJ1hYT+Zf5wQ6DdXnl/T7eR9TENJLsn01gMq1R0BB57V32FR3zHz6gQ2p2nZ/Zc9SCYmIro Tu+fp47j1mEqsZWo5JBqeQDBt/EGuamcZA783utNqcMsQMCOAbe7yWMhX7Wx7DIEORDIJbx3C3Fm qQkh6jrxb/iJyzFz+B+4sZCw+hPy88k+TNc8gaXdT6TbT3EvqNNd3EEc00kscjws7vIrM32KDfYU Gb7Dk2Bq7D5XqsJjOUCaMSR8kx1HyYdHSW50Ob9G3MkEltHNCv7pfUC/bt68NjGtCtGFKAiuXwx4 5EkDhk4cpzhVm4vIvMen2WgWUUF2Ra6hDwIZnYxTxU/eNETQHgBuKBl2rsw5RnHh5ucJ4p4rj9Ye pfl9bWPlfQYZJ45rvVdSNaIAxJesi21utaEICSx77s1FHwjwBHfay4ozXtR2TnW/MujaLHHqHmy9 S3kNHtNIj5S8d/hZkQFpH5D7bAIppSh+I0zkI8y5OLFPIaiCSwjWv+cirdWMei6SzgggXF44WjD/ AIpj5cgf+MgzEnroDlu7rB7O6if1VAef7GF3/wCeX5k3iSRC5srKOTYNaWpEqj/JaeW4X5/D8qZU deegdjD2XjfqyWP6v7T9zCby8ur28N7eTPc3hqPrMzNJLQmtObktT2rmJPPOXMu7wdl6fEKjAfHc /aiND0afWdds7C3VTd3si26ysacVc0LE0Y0UVO2WYAZnhs04Xavh6aIzRhHjuvx38nu3kb8lH8u+ YbLXLrVjPLZiQpaRRlULyxNCeUhb4lCuaDgN6GvUHY4dOMfV5PX9oy1NWAK7r/XT1LMh1z50/Mnz jca/5ovbWOSumabJ6Fog6FlqsknU8uTA0P8ALTIYMvFkI6APX9iaTgx+Iec7+QYpma7x2KuxV2Ks 7/8AKOf9vb/mXlf8Tpv+R/8AmIbzDrQ0jy59ZDUuHRYrUeMrrtSv8oBb6MBLr9bl4Ik9XjPCeOvp kSAktSQkGrGp+KjV+7K3m3es4+3EwHdlow+4fF+GKsj8leeLXy7Je3Kaf9euJlWG3lEqxFSCS6fF DNUH4Sen2fpBtuw5eA3VvWvyq8teY9e8sWep/WYtIikuryddTtgJb2f1puFwpjmjMEau8Cbt6lQg I45XkgJCigTrcc1+n+UfO2saFElvaPpVyYk9G9u6QvFcxFSsn1chn4q45UI3pSlMskQRTmz1gOPh roPmp/mD5lhtdZm8v2N59WtNHtYoobSST0rRwxUSSyzSFUZof8pjuvGqli2Y+SNmiaHls4UTSK0P yFpn5g+XdN1q51GSSSCWW2jvhSR57KGdyIjU0Uxu0iq2+3Xl1wSwCYAl0cnTa7JgJOM1xD8fLoof nR5t8sQ2L+WtMt431SNYoJb2NUJt4onVjbiQhmPJU4OAdgfGoyvU6gRBiObn9ldk5M8hM7YwevWu jyay8v61foj2djLKkiyNG0aOwcQkLJxIBqVZgCB32zWjDIi+T0+TtjBjlwmRn7hYH4+KFu9O1Czd UvLWa1kevCOeN4mPHqQrhWp9GROKQ3pycHaWDLtGQvuOx+1Si+0f9Vv+InDi5/A/cXNk95/Jnzz5 atvL9h5cuLsw6mZJBFHIrhGMrl1VZCOFWLbCvXbqRm504PhgvnXaenmM058J4OM71tz73q8/o+i/ rECHifULGgC03JJy4GnVkW8+e78i6pfW9tcepcCGQtDezwcbeGZh6SBvVAYNIsrBTSnXcbVP8oQk QNjfJrGjMQebxfzH5r1e01rUbXTJzpVvHPNbRCy/0Vwqy8SFeIh0LFQX4sOR+1WihcDU6mZkREcv J6bsrszTeGJ55j1comVeW/X5Maup7m6vPrV5LJPcheDPK7sWAFBzqfip2r0zXyzSP1bvTYuzcERe K4+cZH9ZB+NqWVOydirsVev/AJE+Q7qbUl8138Xp2loHXS+VQ0kzq0TyD/IRGZfdj2477XR4DEcR 5l4ft7tIZpDHD6I9e8/se75mvPKVzd29tGJJ3CKSFUdSzHoqqN2Y9gNzir448tyyTWKTSGskkUTu elSy1OYmi/vZ/jq+i6b+4xf1B9wTbNq3OxV2KuxVnf8A5Rz/ALe3/MvK/wCJ03/I/wDzGz+Wl554 hNrM91ot1pEQeCSeFzbySzUCkV4pNGY0b4o3qtR03U1yLzeuzjIR5XbDNW/JX8y9MLltLW/iT/d9 hKkqkeIjcxzf8JgtwKYNeW17HLNbSLNY3cLGOWGeJo3Rhv8AFHIqt3xQu0TULa0V576xg1WI/BcQ 3JeM/umKloZoTHJCzeK7dKqcUvs/ynbWVt5Z0qGxsX0y0FrE0WnykmWAMgb05CxYl1JoxJO+BKPv by2srSa8unEdvbo0k0h7KoqTtirDPLcq3t6/nPVFdZtQX0NC02nOWO2X+VF+08hqzMKhVJPLicjH fdJ7k7tJ5rH6w9p5buYVupGubhI3sg7zvRWYr9Y4VYKCTy3PvkkPGPy4/K3UNf1DUr3zELmzWzkl gb1VX1nu+JBc+oHDCMsJK0KsafaXkMw8em9ZlL4O81Xa16eGLFcaj6vx58yynycmq3U+os2urJDB fSwiyt4IYwFhCxepQ+rxS44fWE49pK71zH1AETVfF1+Ikjmt1vUNd1XUbrQLfRv0xpPNob+SBEcG Ga2eicp5IoFmim4F1LH4GBoMlh05IEhzRky70WB+dfyy13y8DrCWiwaRIxjjtxObmaA+nsZTwC8X INPibiduRqALJ6evX1o38nedj9pmR8DJvCWw8vL3fcp+XPJVvqegyalNqItLxgwsbdYy4bh8IaSR ePDkQRspp1oe+fgyXjFDameXVZog4eGMoAkSv+Lc37v0F6j5Gk8z63+WmqWt1LJcalHcT28DTuS8 qIEdomlctXmxdKk0HToMjmjYIG1h0WsGOOb0fRsa7tgSPgxK0TzBf3OraZa6dcf6VBBZfVzFOII5 Y5pxLK7rWKJ5XP70MKV5Op/mwa4oCAjvEgbco1R/s+2mq6JN87+LLtV0jyd+lvNF0iQS200cT61F ZFyxlhWR5FmSD7TsDVk3LV+Ib4dXIiUa5rhAo2xaL8u/y7i0YaZGXibk76Zd24rcSJc1ljEaIJPr XprJxHKNmoPpykmczyvy/HJyMWU4jcZGJ8vxuw3Vfyr866fYrqH6PkubIxJI8sSFJELV5K9sxadO G1TQjuSBjk0R5x+T0Gi9oon05v8ATD9I/UxEcTQ1+EioI3qKVFPnmGIm6eiyaiMcRyD1RAvZVWPj wcMQ6sr9ARsa8WVgQQe4zb6Ts+vVNw5xOrhVmGI/CUvnyj9p8hz6f5B/NPzUuu28epSy32lJEyT2 ttBCDHGqUR0jjEQojBVovY9DmTqcmPCAZGr73m+1uyseCMfD4jI/cPh7nqH/ACtXypPEy2Fxyu1K q0N6kunrEXbirTvdJHwUtsKAlv2Q2VxywlVEG3nzAjmE80izhfjqU90mo3kgIW6SnpRq3VLdQWCK e5qWb9omgpYxfKWn231Z5rfjwMRVPTAA48ajjQdKeGYuiFZZ/jq+g6PKJ4cdfwxA+NRRmbRynYq7 FXYqzv8A8o5/29v+ZeV/xOm/5H/5j1LQfNa3J0bTrezlczwD61O4MKxCKGrFUcB3/ecVrQL8QIJy uUSNy8dkmDM+9H655u0nRXVb1bhmeojW3gkuGYqvIhUiDuaD2w8G1tZyC6fPcnkXTtfWbXLiTVEu nd7q/VInass5MsgVWgLvx5lV4e2SGMkOZ/g9C5epknl+10y/8yaf+jdK0/VpNMiWe3spZzbyxUYL z9P0X5CP4eFfg5mpKsqnHhBa9TqIyoRjQDL/AMyPzbm8tR29jZWi/pm4iEs8c5Di2DDZW9MlWf5N Tod65g6jUDHt1dj2X2VLVEm+GIeT3v5s+c9SRLfU7pbqx9RHltfTSIOFatC0QR/dTXZqNvTME6sy 2lyd9m9m8YjeOR4/Pl9weoWeq3/mTy0vmbSr6LQhaTut0q1m+r2trGCsKqojDD/dpUgAg71UDNtg yCYuubocOGOHNLFkjxy5Cu8o3RL/AEkeYLK3ufM0l1eI0hKv6kayzKI1ZFdpCBVquYgvfYKoplpG 3Juz45+FIjFUdvgN/L4cXlvZc2iWWorqEvmi5ayi1Kwt7y8RbySCzLMXhm5iKRIpAIUgRixIIp45 EUD5Oo1UIiZEDsEJf+RfKd/dPb2uow3eqWsRRYDcreyxRxAIV+q3RuY+C7AqU/HLR4ctqpwyMkd+ bo9E1GW+0u41S7int9En+saVY2EH6NiR+lZCjTF/hJUqOKtU1XJ/lvNr/NeSz8xPPEc1jaaTdWMl nDcXKtfS3XpG1ltoVaR1SZWcg81U0ZA3EMeNAcpljMebn6PIJT27j/uSmTXV5aWcckH1XSbGRf8A RbURLJK8Y2UkFXJ+bUxp2kccSa3kR8AFfyRdy2umyWdo3+i2tzcy3EjpRVNxI15J8l/f1A+jLBGH DZ5um1XHHMYjkl2mwa/P+Xmr31jHI1/qV6Lp4Lc8J2g9WIX0MLVUiRgs4Q8hRjsRmuwWYE9ZEn7d vsptnQlXdX7UVpUttf2r6To9pcaXFBCnrvcWk1gtrBJyXmi3McfJqRvx4qwqPioMxselmZXJvlmi BQZhovlzRdGjK6dbiMuqq8zM0kjqleIaSQs7Ur3ObECnETLCrweXy/oeu+cPMF9Jp6x3H19LK3sQ 1IxIo4yySRoeBZ2X5Esx3OHwokgkbu7wx4McRxS4ZRMpbmuZFV8N0brH5ceV7q21CW1T6klhwhjn iLMZpywDEozFeOxNFp2y0TIcrB2hngYgSJ4t6lvt9/2vOtWs/Mnk7X9MgvfSt7OO9RVvIz+7lE/A SJLI1DX0twjUApUA05ZhdoYhmxSiR02/Q67V63JlzjJLYdPc9Fa40+2idbYRlXDTzyVHpqp3aWZy en01PyBI4Pw8k5AzsVsO/wAhEfivfzzuKIFR/HmUf5L0/QdIifzdcTpBYSuUht43EQuLkkKJLiMl IlZAlIg/2aliQTnaaDDkhC8h3PTnw/Hqe/7HS55RkaiP2vOfNR0WTzRqN1o8yS2d0UnYRhwqTyFz Oo5qhb94C9eIHxUHTNhjxETMu8PUdixywx8M4mI3IJ+HRK8yXduxV2KuxVnf/lHP+3t/zLyv+J03 /I//ADGW2/mNfKuqaONZspbvUdfQ2mjWmmK126W8EazXM7llhI5co+aANTiCK75HJk4njTj4Zy95 ZDeeevLt4qWlkRdapIwEen3Sy2hiYnjyufVQNCoJp8S1JICgkgZGMiOTGUQeaVahd+axLKJbSK40 6yDw3dtpck1rKblgrqWEyR841R+qTCvX/JEo3I82MuGI5LdD/Mjy5FLLHLHLJZWawodaS3lkiiMr mNormbieDxsq+oWNRX46cScOU77HZjiG243Sz83/AMr7vWZ5PMels9xeRRRpNpaqCZeLU5xtUGoQ /EtDXj8O/wBrB1GnE9+od12b2nPTkxH0y59a8ww7y7+UHmHzDem+1KxOiabxCrb/AN3MeACAKkgZ l6VLOu+Yul0O/wC85fb9js9X234WLgwS4539RH62faF+V8ugUt7GRbiCaVZZo7+KK5gZolHpsVjW BlkQj4ZK13oaqFC7iOPHGNRNU8ydZqDkMyfVLmRsy2DTfMCM4B0uFZC7SNHayElnA5Fh6qV5UFd8 qtkZyPMlhn5xW8On+TPXu3FzfTSCxtG9ONYYknRvXjjhIYBJIUZKklwDs2SiLLldn6cZ88YSOx5/ e8T0DzP/AIf8xabqzB5PqsySyRxBeRi5cZQKlRyaNnA3+dBluQiqd925qMEIeABctj/V/A6cn1La QaTrENprFq3q2d5Es8ZGwkWRQyMehGx3wRzECnjpYYk2h/MOh6c9jHSPj/pNqppuCHuY1OzV7NiM 0urfgwR4jW3pl/uS8681Sp5DnNuUkfTjEG0WbeRwoJD2ilgViETFeLdkICj4TWjJmEI2XadmxllI xDc/iyWEQ/m1rynUomVHs9VUxXcUhZpOLp6JkEv2vUWOg32PED4eua/89d2Kdrq/Z6VAwPFLu5D7 3t/5Z+YdI1fynaNZTAzwRr+kIDs8U8tXcEH9kuW4kbH6DmXpxEQAjyAr5POanFPHMjIKk35ohRJ7 q5vpIj5Z1KxbTtbdvtQL+8Ec1d19Kk7rKW+z8LfZDHLiGgFkWmWUVjptpZRO0sVrDHDHJIeTssah QzEUqSBviryTV/8AnJHTrTUrm1stGa9toJGjjuzciMSBCRzVRG/wtSo36YaRbzLV/wAyLu4833ev aTG+kpcPFIsSMHpIqAOzgAB+T8m6V+dclE9C7PSa3GI+HmjcO8cxf3jyV4/zZ81QNHBGLS7jWb6w VuIi0ZkoBWkLxEig33+QwZJiIJ6NmonGWYQwEy4qjZ8+7YIPzf561fXLWSJVEcaMbkW4avqTkMA8 jMybCrAbigr3zUzz+LIA7Rd/+V/K45ziRPLGNd3CO+jf28wmPljThqHkzWUub0WNxBJDPplk/pyJ eTgPJc2yRkF5n4Rjp9mob3y3SYIGXGd5DYHydL2oQMkRw8PEBKUR3/LnVJFqtxqs1/KdUlmlvkJi ma4LNLVTurl/iqCO+bqIHMPWaHBpxATxRFHr1+fNvTvsyfNf44ZORm5j4/oReRa3Yq7FXYq9R/QF 3/ypPn6bep6/6Q4d/T58OXy4fF8sqv1PO/mI/wAoc+nD+PjsyXyZq9hda59ZvJPSuIND06O2abiq 8JDcPcPGx/me3o/tGMrLzeYVOQ8yk3m78wNck89y+VLHRotbtLWa1MlisjRTPIgiuw/qVCr6RZXK kFSBRvtbGtrbhp4nAcnEOK64fLb9b0y3trOzW9mWQt9ZlNxcsx50b01SgHgERQBiAbcIyFPHNdOr /wCKLXy1pWgC906bSr4R2tvLBCjcmgRi6SNEixp6lDvU8tl23ycsuE1W1OLiiZC73t7FoVjc2Gh6 dY3U31m6tLaGCe4pT1JI4wrPT/KIrmI5iOxV2KuxVjP5ieUB5q8tSaejKl3E4ubJ3rxEyBlo1OgZ HZa9q1oemGJo25Gk1MsOQZI8w+XtS8t6tGssstrLEttM9rNKyEw+rE5R1EihlZlcFTxJFRlshxbh 2+ujg1k+PFMDIRvGW3yPK3tH5EeeEfS7fyjqBX67bCU2M6ElZY+TSmM8qHkinbtQe3xVygQ6/Wdm 5dPEGY5/Y9P13/eKL/mLs/8AqLiwBxtP9R/qy/3JYj+d+mJeeQrq49Ayy6fJHcRutf3ahuMjkA0K hGPLkCAPi2pUU548UCG7s/KMeeEiaF7+7q+cYrL1LOa49RUaAgNGx+JuR/ZFO3fNHWz309YY5446 uMxYI/G4+5nf5JWmp3Pme4jtkY27WzC6kNRGil1Kltqciy0Xv1ptyzZ9mSMZEn6XnfasY5xiAR4g P2ef6Pi9C1f8ztD8q63cabNazahbRARahcQcTxlcDjFHEf73dgr/ABihNNyDTaZcnG8jixcDzvQ/ OXn0eYdWufLKyDQJr/0l0y/SP044mIYBIBICioj8f3TgN7npVTlRxSlEyHIMHj8na3bz6bFfwPHa 3jwRNcQAXLIZD8f7pGBYogLHfj75HJMQjxSNBMtNMAGubJdS/LDT2urZNA139IRTVM4ms57drdeJ ZS5f4a1ovA8W9tjTD1XaOLDDiJvuAPNOLTSnKgl2o+X/ACtotmZdQv5ZOD8frcQCtLIuxgs4vjDk 8gsjvyVego1eOuGsz5zQiB/R7vOZ6eURufc5mIDBITjL1Dr+ofpLI/Lf5XHzJ60r6jbaTdQRI91a GMP6dseTQypMr0uEFWDOePxchsoXMzDjhlhYkTR36b9dunu/Tu3YO0summZcIMpdTZ/Tuw7zPfRW fmD6hoty5s9AmlgtLpfhMl0CEurigJX42T0wNwY0UGtWrn4oxERw8nW59RPJkM5H1u1zzmdXjtp9 RsgNUTjDcahb7LNEq0SSWLqJFoFYrXkN6CnxXwnTsuyu1Tp51L6Jc/LzVNOIKSEEEHiQQagggkEE ZeS9rOYlwyibBH6kXgYuxV2Ks+/L78s7/WbqK/1WF7fR0Iej1V56bhVB34Hu33e0JTp0vaXascUT GBuf3fte6+hB6H1f019Dj6fpUHHhSnGnSlNsoeP4jd9Xl+g+WfKHmb8ttMtdaFs19Hbzx211KVSe AvI/2SGDcelVOzjqCDTJSG7m67FLx50D9R+9L9R0XWrHR47S216z0jVL6SGy0y08vxxQWcJD83ub uRx6kvGNWqCVU/ZALNXBu4hxS7izKCKLS9Da2uNaj1O6llDPPSKIlQoHHghIpUVzJxSJlZcbLppR jQifklfk65g/x3r13cSRrbRWNhbWc8kigcme4kuFjqe/7rn8lyGc3Jnp8MxHkfkzv9LaX/y2Qf8A IxP65TTf4U+4/J36W0v/AJbIP+Rif1xpfCn3H5O/S2l/8tkH/IxP640vhT7j8nfpbS/+WyD/AJGJ /XGl8Kfcfkk2vea4Y1+oaNNDcatcDjHIXX0LYHYzTv8AZ+AHkI68n6DapDS+FLuKV67oWiL5LOl6 bLb3VzZJBLbrPLGWuZbSVLjjMxNGM7xUct15GuGzVdGP5eV3wm/civLdv+XTNFrulW1naXUqGhdV hnh5gc4zG1DC3ZlAGDdmY5JcwSmet6ppjWUYW7hJ+tWZoJEOwuoie/hiA24MU+Lkfpl/uSmH6V0o 7G8gp/xkT+uNNPhT7j8mC6z+Vv5XanKsyGPT5A/N/qdwkaMNvgMT+pEF2/ZUEdiMqlgjLmHJxZ9R jNxMhtXXkyuxk8saHpItNNktLWztUJjiEqKuwrVmJqST9pmNT1OWCNOPKGQmyDb5kga8vLmCa4SV 5ZImuZZHUhmuJD+8Z9hR6sfvOSDX4cu4q0un3zSSSQXN1bF0ACwu8ah15cZKLT4hyH3DDSQJgVvS e/4hee60GO0iaOUSh7yCSJx6ahfRkXkQFXiJGYGu4XaoOYPamMT08o+X2jl9rthmJMBEe/b4Jze3 txqci2djVYWk9MuW9P1Qv2mLg8khXuw+J+i7Gp5zszsmZmOIerz5R/XLuH8PM77MtVnIjsDX3/s+ 9mOj+TvKVnpVwdaurW4jmi4XasUUeig+GJEUn040/ZRd6715b512LDDDDggL7yep73Syx5ckuKQI 8nkFlocOow6rpt494dDtrp/0NKH9G8ntJn5vYyqCOcbcUY1NK9eLIQul1HiRzDwBcp7Hbbylfl9o +DsceImH7wGo8v1JJ548r6npXme4H1fnbaiq31vJbkzRhpVBmiZ1FA6S8tj2IObbBiOOAgTZiKtw skZSPFwkWkn6O1D/AJZZf+Rbf0y6mHBLuL038hPLVlfa7qVtq9l6tstt6kME6kKHMo5MoNP5t/n7 4bIcvDqc2KBESYi3t3/KvfJX/Vnt/wDgT/XBxFP8paj+eXf8q98lf9We3/4E/wBceIr/AClqP55R dj5R8r2EgltNLtopV3WQRKXHyYgkYDIteTWZpipSkR702wOM7FX/2Q== uuid:3dbed6f1-9d50-914f-96a5-32dc5103b059 xmp.did:fde04f98-d756-493c-aa16-aa764ce25936 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 xmp.iid:6229a3a2-5d0e-4260-a053-019e84482476 xmp.did:6229a3a2-5d0e-4260-a053-019e84482476 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:9eeb8828-6dcd-4786-a099-ab23f428b955 2017-11-10T16:19:46+01:00 Adobe Illustrator CC 22.0 (Macintosh) / saved xmp.iid:fde04f98-d756-493c-aa16-aa764ce25936 2017-11-10T16:40:55+01:00 Adobe Illustrator CC 22.0 (Macintosh) / Print False False 1 210.000000 297.000000 Millimeters bromello bromello Regular TrueType Version 1.000 False bromello.ttf Cyan Magenta Yellow Black LETT Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 PANTONE 707 C 2 SPOT 100.000000 LAB 80.784317 27 3 LETT SPOT 100.000000 CMYK 0.000000 89.999998 0.000000 0.000000 PANTONE 707 C SPOT 100.000000 LAB 80.784317 27 3 PANTONE 186 C SPOT 100.000000 LAB 44.705883 68 40 PANTONE 186 C 2 SPOT 100.000000 LAB 44.705883 68 40 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 6 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 7 0 obj <>stream Hd[%*jUV |mt3sR%JOiW^uWўW>[\w{+=/1?.ZZs]@o?j;?Ϋ񬾮Z˳Ҽ_~TDL˚uםgqmWgrٞulJ_?_Si%g\>_ bjR>O NX]Q#=͏X6ոV::ޚlǬ%FmW{*2k>j'[V cDy>SEW"/\ [!wcHeyJpn<->fF98뵞2Z`.S [4AKf"yͲaڝrp_ _lq \^׏Wƶ,dC!σD>\ Bk >}K\{*'RZ2ʞ- ;; Q&AOE'g +'gV no֓zo!1`:|: uT"0=3X=#/ز / IvtPGpuU[UإcNn+"Z[kQ?9*YAg[%cORHlʎ8lt04 R4ml8XFp@$))EQڹۦO}`S,E .;hWuTL(R&KGN)P'~W"2aq"oQI1Đ&?.%PCkӆ%8Í 9 l `c҃d|_TP:t?2a҇pnyRF M&r)%:"*xI ++`m=3t r}6RsS״O] w,T\ZsM@pSyViGk4Ն/4@*"սCxB^Cu B61^Rci&5t'@,,jJ_urGtEFB bPOQIb_+ .4_ PsI{Veߛ>$R7qq#IR2F|oХ 28 &UdF3OFL bb.zzIhLp%J`#(q].28ш~ Bhb|"<\d#9/;*d pO*?JfĤ)HdZ\EYHnZkTW0$B})P52@oP]ԿW=5=3F\aksC׎UM [ +n龃ݙ曕#ѮAj9 R wc[apMIdw = 0AD1&`ۘ{ddP iޡ.y. 0ZQӞD~ MIDQAۄEyEYVL{3~='h 5 25Ul@g%69ͦW*(hcN|y,з{x)v}]+{ƬMAJ{]W?d=32x-" JKPᮤȚEA2숿]P˄^ WkMNzz6LEfs)s0珹C$'ͳn]ު'0KX ч{//L)nA&wvo.ӠQL7xHk71e)"0V*wW gJ`fFn[ .7/jFk@\g2 ݺ;#4LӵBCXFQ->FÄ%gDH"Ww%gaQ,Qmp[2_QoԨoK]H}n!&?0M치UL3&IG4O887[֐r mbfkɐ:TPœ>sCZ W:I1= LdӑukaSP=$YQdK04r|2bwXBbY#vMaw6I"#шeTA4k'>^!g)!1%ϩ6/v]AFl.EK$~1r>Nj䈎gjG ;TzSoCÞ4||rJs|3I6X){qHG1EԄaӒV `Iujz;6@`ogddb–dѲäA=7 UL\z2I~@:Id S\DTYBO`$,s x(@ YYXiPPP*6Ѥd4L;]*X+Un瘨UUXbgщ ]U~5lM`pM6EKl*B1עʭ,\VF'`ߢE҇MoCT>WlS9oJ]w'Oʛ=Г@SVFPw+6Rκs.G#CPR ^ƋL 1t1"QE5̃`+ D=GY뾬NrY1ŗA  vpDF8Qhu0mW,l86b*{$Σ95!m]8F{vFlw#ax,|7x 03Řj6*Uaxط4v#/V㽩])3}J|Xd?8L~ʫ}& =kjd"49UmhamUO M՜bQWj4cj"K<^5)TG^\Aw[ldzPh+Nzţ_w+7AUU5j:).j  He,*'2qho d?0ؗBHqEXW43Ԩ6Nomf،P}!(-=WjG;܇$XqS} ԂI (Com( #ꩲWLu$ &&,#iʖ ѽ4|,.h84%i.YSA&1fg]u0$~QD fFaDj]~Bj*yFPR|OU&~V9 Xu)ڲAS}<|N{?허]C⪡/>`k}akVŭsp+ݮak׬I7r-Ճ\ehcOjZ\"׺ r;E=U+kj;\m'.8 ]GkkEײص] |׶k+X=x̐Zvp \[}~.PmWn [`kѯO[JMӜ)X/Zwf53Hcs]նѼXIyUlAHQsUjQ]β]xoZ7^]jUSwXU EvX Xբƪ~˪Ū#XU8NX QO='n8;jwYWXu3:jbvVj/U=\ U-P:AUU$]U<~P@ )v!U6TH-R2b}j V XV*=@̲4ҴouZ@I/U- n\Е40U;'oE  }enrU`ֶu[fd~g8Z}Ck2k|bVǬY/fY?ĩ`yqx%V;k%֍p7^Tj X뚯oO`T|Y~>=Y5n@7Ov5yVm[^x5uԿe".2qui!+cuǭ㇡azE(zַٓقe4Bެ SJ:r3j˪GfʖD3{kʖi*>*bżh'z楦B(yP০JZ?٥m4.*,7` λɢG~}vGЫp<JuCxf+x֏Y5,Z >d[WZ*q&ܩ>8"L TFf( |9q\V[~/kԉ6dRs1+rhXLsśolG\Ҵq0ׯӁ(TqaG qv7 ņE} 8_}wh8DDColLGZ\\ F/jQ)r[X4.Ṯ-S0c4ꏖ_f[MP*hNT\ yjɏ_DI2 ^x(qnt/"V>SQ gm*s_pD&1@ix} C|(b0F~ͪiO;}ٱP|G26Qui/Q u1T\=4]Ak:@C7Saa Rw cNA10 P~ϴF!Ξ`]ZkBH~.S*!>T%Cߊ< Z: ̛x2w1s\f:1+"Y z(ޫ ;t I>1 emSO č.DPSt϶ 1Ǵ+cTDJTP*iX,yNz0qzjvqvK4PL$; Jȸ;f VJ,JΞȄ_gE*3%&Qxtʞ6.eVG0 d_Rݥ'`ٿT`^A/z:3<[: ,$CkuPL! (^͵1wH#cAh.g_q|-kinHƃǾΐ t 󴖢0]>;ȁIemc&熡- M.m7 eg~kd"?)T)#w7K*k4h)h,vBɢ JB`S7#s g*VT4d:oCWpZ,, =B.૰۲_HX}`_QDrC7!vv"7<,7w*^Q >(q> qgG14)(K dwݏ1[ZUꀒ5Sb\FIo.S34[dUyjďa򖺃B irjJѠ tsCT^^qmB5QS֡jeIOFR3_0r7i9YGR.\ ceV LHR邛-K8qZ6vׂFK] 43|KACf3u,\&eHcuk&;tIcO vȼ3XLTm Rs[Þs<=3r181L;wW #U*raePpMWg/]Z5l}O EB;.@Ћ4ܭЏ:Cmgei hKTC#d_Z/b٦v{AA}u.1T>n8ms)L줅8n@>_S7:m.EE`RW@-;0j>Ycmft>+Ed㴞_bAZzu~@5Z%n{>!J#<7ŝ{;% MH<{{.C1)|6 e4N%X,L[r%96cY3~b˦yŽ9b [[)Z^q? N oV @Np +Ȭ)HȹjDΠCP?B])ֆV@ 4x:%$=^,ܹLb4dk?2&7)LA\=J4Е&xXWqVj 3V> B;w0/&|m&za3 7ˢƔEpeq/U%с)8//}t(?Ǐh&$.T~Z50}Pig,աV]6Oȉju9`s!TF{e x-^6D ^׹!u쪤UFbB fl(M 9lT2)F jNknp -$`@.,uÝ/X/!m33r1 stbt\5n|{~9b]qA_ 9Va޵IK~M>],~m)ƽL5/((2M_:.zՉO/Ot_ꆫ,;dfs1p'U0AsqZYpH$E_@ʇj 2p]lyQ55O/ ÝTM65ak` fp{-g-id&i.:}ag%BiκH$$ϭg2UEʁ7K\VMP>yv\)?|ըʚDz >)Kb~ {la>qՖ,c! m1GE_'E \chzSZmz1i-Bu="}eF  }S " 8U*꾌g1pWYW HىÜ!<μ2ӤL"Ciq *3TΙjESA .Q-ޫT8Lfgԫ}ylEAL{Zs<.~ ǛY^bc;l:WCskR%]lÆڠ3^*yQ48p eH"?oѺ-[xxuipVK*ѿ:KXJ ^OQk a-fD_Vs1'{pB~.u_U; 3l35Ts ufH5oҁ#$Wx6W1 6Y0N.2^!G\iGu29])ۆʏR҆ S 8<*oϰGp^G]PxϺwPiK(›v~:а&#O:NTz>y(۶At1M{dp\j}<”Ę!jv GaZPЛ]?|tUr+kEfhχ~g3sG۽šŧ$%a_xZ{>8Lt6ǽ.]̟εBV6% cca"zN>qJz%/ؔw4vYtyŹh{g.boh*76 3Ƕ?lֹv3nB@E8`{=ph(9lU٨GI;3Wgb'f] 3t[*L3r̐3n07TnQ\XJr u0=ztod,OfT̰#7E|u\YQaO[o,p=x J5p| B^h|b/`r OP$%e2%wUR(.0#Հ!cH *K}UP+B1-KBG̒ N΅\^?+ֱuXu$ս@S=A븦5R`KeBNUUz'b 3FӡӅSFSY qPfyvGskzwJA{|H;‹1]PX&ƬV6}U,JHfR-CT63<T荺d.$ {H]C]+`,4VDǀ͚gMsI$(K6OM'l-E^Dr]N:wXtb*TnF#8b6:1|u -]C_4MA4O)Up)zS UҢ'jwkX JlTC.\PT6p|X !`H?, +Gk7|(FI֊(!b6I<g:R|R%F(,œlhi^ 3|?{3rp<9ڦ,CŵV9-:&VTuB4N~h>lR)!fq^L.nC2+11֌n7 }F[:DmekZV8>scZo@A7}:F(RbYZè >WzQ)&QQ[NfHt|g&CEj֦dnk П6*ƂnMRPٞ%wTXFG_4RPMzfђ|*w? 9tyt/ Ve9[-1[|fY~Fs̒ 5mCUqgǨ6u~*^kz~ђݰvOpzLSÂ[w+1GOR@?qZ֚. \>(@ ߤR/GewnsXKpc Prkƾ7htgY x Sd uHFw_tiydv~"+ZBp"€LtS DTjfaL/m⋎|?  lK }$@Z'*c0Opfx|u#S eR18OUhA ToTQ4GQƨR:KšBԪh'By~JjF&2Ww3y\*F+ l'҉`VyڭH>'ԌWeމ|ZSsIX"tER )h:Z+M_ӣ ЋFm.FeLQH]Firn3t>)D 'h*F=|6D< E=D $rtLDDrQP͹s0X#盅r`C^Cnӂ^jL/Th&Svr"׃Q%OGI\dHdS v E]SSUizZjvAaUq(ڑ7Kjp\,‰5`HIw]e$-O4%8UD >A,{}-~-.&̒}IIlAg _݇kbM`e2WdKZCߜ»l)5y Ki ԁc=s4yVj3ylcX4ẝ>EW?j킐c9X`*뢷TX0[}m35 #&wp{^v+bTßtenoȡ[otqHqf/e7(\řRVZ wnSxi6>,&r+ p&4v;Eev7%Zzp[5MtB@lSdfmZN:{a CFJ\rlhmɎW+#P$ˢI# \>r;Y zf+ c WB؎,Q,aU#,V"~PR>GִZ e MR]``,ʥ HBv5MOKA~ҍǠ@aC 5eyHalCv٘ӨiG*aY,ݧYXrcJRWSQ_AkMȸeUhʈi i?Y-J߳KHcMwadV0mnb">^Mz)VkV4"mg&*Z%B›X |>i5eWb~a/eI}B8ݨZRUU p`[,0 o,),Q-k4H=E)j 6<|\O+UK Hj]^D"}Ae(*|]X 3?S]D Ui*2 4/)xY+9q_bљRod"zB>p)waûYX0DeEhmSD'Y.OuCK2IYupCz2~8ܼ9F$g2}ip>쌈YA&8vw1Ez2#4@ԖP X Jt>RAl*.RLmx)7X؎V9lqXOW+LLY6H䏪}qaԒ8]s+xʹOXHl=6 @7kMN_7YEcz<]e] s?3fzOG1V ]hGar~Qw=v߁Q8t<>6?&5Yrn|\ +`&X1?p ަ>}jpmVhM'^u^΢b;NB*{as?"y@,ᙰ {_)ertz~teℚ3G_b䆌b0xQM&/b\W!dy:O;m;6A4^1- @k5lse1ZϪF.f_ixHѮ@ s7K;վpw:יX*"U}rɈNv~zL>՚> !,j2 y6 } ;$u7>ՎѰWe!ph0ym !ʨer"5M#G]4{u㢹;.xY>ne QQn1 v% Ed qzQ r>^oV?g0hgyj()~tm0Skcyݖ6?Dg of>O\hU +}0 xN5O ާSi{dZs.ӻ[ 8{ߘxZ]`@Z1Хޭz[!O1ʆOefNk\椇hh=+9G*GQқKKO]V~(F׎P!ʹ><䔖9?/1>r\Y7`P&J h{jMpl1蘿 8dEhʒh}rm7ն]wvd2-ed0~FVcǿðh@*MtAq]+mo#sɗ| ]݄o섂n868.ۀxЬ!ߪ/2#%#ms8<;aQv"oV9O{i%&@jZr? |YSCݏ4Wk5JIaׯ .^nJ|'~/eH˚vE%I"8Ub8g7P}i$\MqôIp&T:v4W](tt׭A.?qqШwtarN8 =*#ωl6T=sD9aJof2Tlt:]w/ /+ ?&]e2_EҔH{ cƩ Ae8Nzoӝ(hU1Ƕi+C0=Dқ2i,6^@[H K7%^j6{X2hs_#qQpɪX`^}N?-du tW2F/8nW[SIi'3 aeja>/#K"iu2`dÂ:Pl-{FPff:0sëNavIL2] z#0x3B9vKbxkVk;/MȆ(`u~5_*Vƹu*03UoY{4RӰ~1ͱ, ߼[@I?礎msgO]l6?$8mcﶕͼ.g_0d?D,C )؏U ]*HCdv unjTbJt{7&WTaH$Qs`c#)b]nu: '^4 *GI/g,ZidTk>ʠzQQpcUO)\a=zEaKMEb]nQ̟`&JLLUeIWy@rȡڰ2U_,NMә9,[M"+6K*Tht>5*^fL 9'l7j[5R Bj!Fz[6lN.'j3p:|e}$%f]"-uRcm0vz7l.ooOYSl9|JCN-w´jU3{-=UGi? )HS+z~yxvS5$ir?OlY(%uM\Oy&|&aR -;)jjK zIYtϦ BW~uB[]߫D 64a yrrrTI3谅{Xvrh2Z@j(Nr877Lӯ^N;(1QN0nJj=h聫t7 \X@x*!\ƝSKc֖ф:afͅcFտg<~VXQ4OWG)B C}gշOgӯ']~ZRs>޶3yӫtV )E{0[ GDj^Ӫٗ Eq^IY\NMW[QZrշ#!Hд5i%fSsf3]:G[%52~S)Qݳe]7~>s:qxJ=JfpEb;!Y7Or/ I~W%OFOGT.J4j}ޣg-_ed'g\D8l(We'I̼rIn„vH ۵\.䍄ؙ4V)زjRq?]Ouv # sH06n%@rX̘1* .*_>~59hEU>m^@fT+ߛϜ ߤW 1!搅H˜xR %$nջ(GeOkI #_ !p+ƛk2>3nZfpAPա 25ԅV܏<~Ș; 4&yY\zutO&cI(ry\N7ёFX@D^|8{T+&T^ɑ *?Y͖Zoڃf!#K¸#>@Y$D$zJ(`ؠ% Eň* eܐv_E(F%ȋ5uv%*=˳XP!]⻏{Guj ;~zMuC,,lJ>}Mˎ* XOGc$Mk՞HĀ/JF%ž8%̆Pscs< i W'm[Hǫl ʂJ\ iR9[8@=qbrʕt_3ȕNUI i6*]`0CSU(GD%hS 4HȎYinГR$yLX&ܙI^ҥOeFeD xRCqK)#eog@*# `@l,;<% HҽtJdƌqmu3bAQ!+U#ꔨGZ6[4H!8|% +m*O( C~7D74 |rx G?U%5<+g9/ ~[Mk xI%P~Hp/VT~[)LitEt^MAгcuUbv;q'5;ϾD;3g%CYAՂ-R&S,5wӲw|cP4 wt@;+uץEf̑awLg =J̋p=IHC>l־<MVdqCNҠ uwzx.ޕ [[g0ʯdBH7eޠ=z JDelܝ.y;]_,Ơ\O{E 督"WF{ry?adQM o *+1Ҡ־V7ye#]Iz۠`8 d&e@һש_H[qHD=ɽD'idYVj\i`dEW##aޞ/!׽J)%iw /<_ #h _Ȃ='>&V,H򕌣?|,){1uҲjX"ds3FIְUf ֌\\17eSnqo)gV~NkB_B=.5V$TMC)bKPDgHYM%}n5m g̎$u$J+m$Cs |U';ܺVKĮ!5~*5jGlYAy,}RCLebmuQ1Oދ$ w5o hګe$rdDN'mu{R_ KD|G<- @ #UZ$%8t{&=%uDyi )tgD|w|aZ%hpT#D.xQj N3pf}(|V XXX 9oܝ K|;YK7,HvTgV[u(ԒQ]Lf?4i%z3\b,3{Ct;t d*_s|-}q:ӯw+w/]O=>^"? !Y @u?3PBStר"a3scb @4'ԖϠ(x"qˮq<砿ug^La⑫sc]ItYP֊BlS"Rþ5qnE32}Hʯw %h< 3|Cɿ.qWc,7nVZ; C->T˕ Y8hPY*UebRYU#d9M-^łޘdJ#xt#L9MRެXq4ܻyRԢߑ( ) /:~Xwk ᡝ n~[ަ zL[a~6En2}P`^l5 UՕX07Im2G$.mSϢxNYF1c#8aQü$呺1o.G3YRW;}j AIV G !`n[ `1iCSIN[}~[̬BpgU?X0Hfym2߹vORM$ iȹDO-1qP6 O֓7'욣ryƕf]꿣ך5"@:CTw EL@#,?"EߧO(ڔP=rmzȸtkS2}Wjw3v}4[u],[r7ߊ o^MC#QZp+b̛gOsV[Z_RN3z+kGQRIc`S&zM<ۈ }h˘(]z=,ZޖU`aZ"V!D32Eh BN P]O,/rUlmeʁM0f>4fY(:k~ тRDK,-IȅM@dI DŽ{;6vŞ%r1?cnfđQj!LWCŃ79 >xŪQV*bL@Jriܣϝ6*@ˏV0IxY2C aC.4gYpeć韟).@p 3b w<mΐҎ)1G^ A0=HM8NT!7Wd?+{b A2CaKטĢ5B와Y&/;4y|ĐC-}ž8 6=pgǓ_j>,Ŗr!ܨ7u;2&x~ GSzx<6sLSV!Jrydb7΂K6" Y3y{;čcz$zm_v!J>p3{] $$W!+sGϻ݂^.E O 0A=O*AxXS [ĭOAWq 1ƻ 2ǀ<*= ="IXʻa:лrvsg)y|b(={ACxW\*9q^?hU&jѡ4uF^> ̐q.9gT_revYT@Bm8"U.XO .ZBuB8,A(k-}T-JGWmJ>"QIVIYl oa=D M'b HeD1\k*Z\jBD#n9S ߞ@=A>va?c#_(qF?xk} zwETzlQEEenwՌ H Q߲8 ŇUgKmJF`W=xjgp>2 ́5'tR'CsL ilJTF'Ւ;,!Z6g={j X)+@Ez"2۝\Ѱ'E~yY+tQP'I9wUbٱ6'}zҝ+z^NQjVuid_Ϣx;NѫZ=y)5.μ:Drk"5=D7TdPoLY{ a,j4W&՞%tQh-'3V湻E%%cmI @*h4˦[6dG40̅'WICWX؍V -nBjfšd. on8 awVA!mX߇Wk]:kR걻=:CUe(J!vYN!5 $Ԕ(gK$ߘP'aQ Wkuīړo^֟Ʒ6bNȤl-Jjl]%AȠ)Le͑;\ClQ]-ѯP04JO<ף3D%X},i:d60X?< (3Th#yj\qiO&2fwzk;Ch< H]x|J<*11W N3Hֻ?CL}*SB")6tvvN#ԧTz ]V"NxЄ0ۿ=K2LcRaF-*9z;TsRT)mPtk@ڍB LQ_d7l;(!YB,Џ}sxݖA~.Gw/啩6p9%Xu"j`5 㮯Z)uuK^Gq}s:-&`|d%z2xn}TXnhG'ٿs{A{iJ㾊9'pT4ҟΏD6\+Tʶg/r` Sf޾C$MhSr dXN?&%Pit&>ݖ;"^W41542t.)i0|0$E,USǜáiN'Hi|V ՝bk:%`r]|$k=z*ܸ~dȒ4g2-챼XF핗D؃c^0.Q?*W7ERH1aD-@_vVmҷ9C߳۸4]3AxU-Wd WҕX83G@0@j@hQXltc;H*ɶ*a[aq0ed;<4nd)m{3K?HU/ 7A@\P'F0x]6:lY 2*AxT?C;BuaN:)[B麞=Ih1rDjx$M׫z#^0zVX-BpK ?3q_p0IGa%$B6fd)oƒ@ g !_T٠!"O8yeX `Kxzf3lPTMAԱc|\!DOWhZO>Tb@)}YA.8e>Ƿq"Ax<5'#B'/aƄ6C8 ?) 啉?ۋ+d#j!SA+Π>Y_bix *:t 8,+'lVY0''wF4 r7GU`>B-++ab#c~ALg-pEp:mZ8T2^Dӂ@;皡pM=_dNIp S Jz> 6#FN%j˒NpXoVOȎQFUVTņL0)pu;BXqG(O 2D0pJ{䇊\%x y {!ʏ6_u~6YPdeup*0<Ꚃr>cm~B-ZYBP)z{Oy 牬5 {jnƌDA ,0GStP|Ι$CeڋP&25˥ɨ*w/Ƅ#w*y `Pc%Y1S 3_7C"  mu81gDL"7܎۪ցxعT_ u-bji>bMX|<H@wyT92TzR;Gq"r:;~,hmّJI{GOQYV1fQ5{a^%եQݨVOLVT5jrP҃%Teh2u ZnJʢnZ.(a~C kBV},e>%jBa`щs1v%jIA9E}]-ǠXn3k Q8vv{oLC^hNŕ KRlݢ!E ҲmCR ZTT240}!K:qU'(ͦ:FdmuG 2tFw0Ql&D_Ą"v5nTy-تPx>,8ALmNn.Ǎ ] B ]>"B*A*=lU0JY7Fg)-\W9d;y<TQVupsqTl ӄJ/kMq7-@[|bYLRR.!*CؐЬ\|BCyR1[|?츬ҁ=HBv8+{pLOS_W@ق &YוoPtto1/c48UeU;Q( SXcrKsW2J56pldAM^}-йQOxN{nǡzKF2l&؊jb<9 ޭ)"UL }gL~EqTRj$L&vP7"ӡ*`JW{癲qvnodæ0۞Z l=nFyCIH&7FH%rԹ(Зukd3E=oFU%(V5<8@CTPVWAB؋br^ a aV45Ρ l&Fze ϜhCѭyvNhI.u_2gyS!mv?3˝2c1iBs<' o\C*o/Zg$ŝwZQq?ȴ\1QYFk}D @>يxYRciTy  hмqܪCNH%Fo2OO*EzP1`݇0>Wjlh̝ b;j@iaJh$RXb@kJq[WЃAa$|rH;M|{-A v~Aб@A&h[gu%Љ/[}LzG0}S9w&T=4/C`OO}I`G t]i\RF%"556SUQzFXmy?}eb9*ƪW*OwJa7UleEBݠ|qS UH\HL!)SǤ/m1Fg-U$dp-h&_KLI/$ǓIȀW,"uΫh|KB>RfX&9-"ڬj,KycaL5m 軄VKmmXAfz{Qi\ 2!ƆDI !NP|h(/h ;Sw= $EP >.LJW͌`H$0%t6ՃߛV)R@IړǼrۼ+ 5 -$TQ;D^jkX'<2̋~Dw@5Lbng3(5PBDhĪ"CcFAOn9Pba{:b`{ȢZB;]?ă-gBWc([B̆Qj5>A1YB)%E`[߸}wG#ǔi^7#d!1zXxSj"k gya'`S{)7=E6.47`  !y-v"z.Q CZY M' +U>.|>U({?"|01cE "@gHOCTdң踖P:m1!^F'::lE=ʦ 8P笄Zz%>>:Cv:Fj1~()>[Қ*?b ( bXsc?cȎ͋!?o B%pFZЩ)-"t@P7C7WeBfP| de [ (I4CA1YV i EԄXƝc#Le{Q2j_xÔیѳ[ƍ.iq/^jUI6nըprnH-Wo^A5 JEcFi'J*:T۾Fca8leťSCSnP_; m޽ wYôoEgQ0"@%$Qk6Cf 5A/3@aԖddTǞ;M"C]3_>/0L)/B_U66,N>< %0^|F!;^H-tKL%5^jZjb"m8`BT*{ Cn !g~}֒/jC ZHJ aa:3`m}"3bmw'VB+p0ji9 b +.-da\&+[;7Orj29Q2~&@ k| 'sM=>Ȉ }QGNVȖ#BZk]!65/OTWPpP-h3'@;$v.[@̠:Uذ "ptUĎ3Z}ۑJՉp#Sq͔ҝ9 AkR օ [ݘJ\d-!݅].G?wSea.v9*0}s s]ב-I ݏtI-i}Y_U7/Ea'oN8oc_-o; q嵳s:}}7t0iFT'<$K= tW[@5[ 2;#*l+ es){u4#pV5 hܨX)Bn DyUH/XOq64 _k0 Y3GaLͩUMDn-_GHXNdK'-Yl =gnS쑒u6^Cl%YhiLRt!Ņ>rIhhDwCoۜb삕e^"KG، )0m 8&ʟEw׎0/ĩW N,Q;$"䔚5ZYq8_eu0*%ȑFD",r~XZ\GF(n!M/´ik}ۢlіbR/߷\AX ( LH:H}ub4dC"  nڽߞ u" ,ݔx@A[5MN p-لj`QZ>`.vK"!/y-q^'}I@~#9lKgzLCZ2׷-思Y[?&<2:Dh̭($r摂iR<%n;Y[$-Y@W*ikfZ=9Hw %Wo;'.{тKR&SZsKVݹ6=% `eE]/4on NFj[(CM7mQ̢>xbf Y@=?B#j'd+iEؑs})Ð^kHT".>w`%A^cH%!:T;ѮLUB6>ujHdur,ZQQ˦@Cd\v,jU<$>o Om5F 2qۊlS+{(jCWyQ`#cEG3@8]>a HN- &?_oF =14oː \s}~zdוr»?؜V~-j>N;9 1_uzI9kN֓|sQ*bjuH|vbt(e"͛[s'cFyTag~A+ f9le5?iqE=Mf_5 ]?UԆZb}VQWC<k0VFx82Wi5)M2RN:UZHݙ!M[Q`uJ~ې7'X[ʹX4 n}fMn (DJ\qDܘ1FDEE2FH:nFo 4aJ rˋϾۮEj[3ݗ- 0{sb K1UUh EJ>8àRCk?1;:T„,ƜAq!V,Rmfy^ 1=czCL<۰C59O|,$ȍ#J>LSDuf/W 8h_G+o '=Auݒ !S kUśkX| `t)6g&(uNP:sURS\}g{7nx/]SIHa[JQϝ}| C?uv V5.3@ ġ']:ߜa)Mƕh)VkDvtLqfG:!:Y3bi)9=Wpyl\J trբ}>T9l{ɌwJC]Z{-[xti9x57Ո7@Ik֢D7sp1VVXԀiǧ랙I4Hkn0(ҭ(|'ʽwwv&׳Hch-Ac`-C8ɞ>OquYa布;[ڕh5 w~'jYaurQeF\{e @.R.zk1-7h%:p'A3 F>xφj@Jk-BlAZDlgf4ʮ؍\r2/pG֨ ϣIF3Ys.:ߗ`C\nsNĪePȱ̝j-"CWP+Y=5w7?%Ri@R4ʴ1jȃ̉DW,#BŇk*e~D0w a}>?^(ee۸hϋTƇ aA)z$Z.-c&jZk4\3^*-] SU5&fic p FJs5JM2Hiib0;j"L ȅ{fBXD3V-j~{wϢ\l3HE \m͵w QKщMoW !pϖf{SFF<UH2̑gЃK7VP^fTہ̄& XUke5:J zR]/D>lz3T!N ^7\DPbO; @3̖T.F"#%1u7'YbLO5+@fj8wuW%9ۉ6Th%m+g)ZɞR4WP6Fj6>%7!)C^1TH{ cde+eުzIC0YT70A~ еj8r\)+둬pP*A$Wc#8?5F*ve0Ih,\X4eF\D +,k"㌭: a55j,0םͥ4'ƨտV*1T Z/^d`1b&&ic.Lv3º1?>F䭤Q?w@O,DV=A^kug*݃_˔gle{*(;Db7Uȭ`aV'TG׃k7YRW%vl <~NZbgNMHjv;hOnw`, EN|OZ,-1ܟ\db3q*yO8zt7M+]{A.Ȍ‹;m|oFmSr?\%kF Ȭ3'w -vDأjzUp!~:Eyf@7rWΗnc7:Z4X3FSڃ8mFgl;cRp-1XEH%fd>ɽ+?6c Q]7JW&.%DkLUo |/]00q玌nj{It:xĂyщ@vL!\6532sQbume!d&D@ =G6K"M!9$xG"SXZ:{>hȰ6@= X%"ǩڈ[6gVKF0~mhhdj_y9f2R,4缷@v5Q}&ybg-㻵X4+gVۙT\LN""RljҲ(ټhox!+;nװIt#.$=]kn(S-hxUkb6=q~;GO"$HmVMJ3KLǵպZ]YaFC2FND^C@N@κg>lyX'J!7y1 η*߷j顷o5O6UIJ\`ʼ\uo+}p i#;$NϫcϰnXSz-1(s Ȫ:&_6 v^ǎ2ׁAv4hwR'{ܽzuHVOAq G^ XsaR`gc$%4뀞w5"-Uղ/Ig'bkĸH@V)zFB }_ڧ JO\>\!+eVd(\.2 e9Եf rA!6z 7'sbq-v:aӃ&:#.2لV k{So@ңN'C5ć1M|k 7퍄,ئL)\@ʿ+"X2i%񤒫DܯgbӔb #RՃ$1zwnx# ;} d#WAؿ =sm4.uO! 'Z4M6vr Ȳo@^We'Y}S,VPk!.KA.YUW40_m}5N=# W⬸,p!QN2c%w^m r;d1!>@QA4WƋu23-mjE‘λI:-{ E' {v**{(cۯfǮzvlJgj~٧)t*5&kMAO~Dv{(m4<4m>^6O0c>|RBsrd%0 &ۺ}aJ̵h h(JtWR{I),~lGVg{&N&ǐǸGdGN5͑f.+wA#o5Lv_)4t U[(S uTpjQQۂ]b>oOGi}[l2r7yZC-\OTZ4 RАZ(-Ųo Q!f~jQMJ/i }C!Zuhd6k*^ĘP,V`prj!\8B%]LEԧnxHzS[&N\:*/uiՈVC'%Aߛ2']ۓ7?殗#+weMl|O"( CȠYd?-ϯăD`ebO}iQ$mwʧ\n "T"V8SbX6]0@\bj9?8|Yw8T~{- 9`Ѧ֘4|& Zz#뽜x@aK7t-#_p)ppe_8BR?xӞH>YC:>W2l)+hѪ0WjۇzlaLO2߭1(Ŵc: _\-0|ZqxgN߲mED qw-Azƀ@q]+FE V~a϶w_<'9'ɗ/q#*BHuiaO_|VG}0g0`°fgTl@EoG[V#͸m)Va "iLWodC>yNi!](n_:Y˽r47) ם5j9Fݲ^7TX\c:vh/ar4gxx@co=G-;wߺޛڬnFEa}$$+.öM[0OHk۶RJ ۦP@$9N4p>Gu Ҿ!o}!f}w s-rp| CW#eb 2}=4iĨfuqA͂{:y(9@*~1Hd9߾j4AФ$5U=I$g .^{WnϨHX_vEtq,P U)1 slTg[t[W&*3mA9^ }5j\$pM** kMxU3o8V=Va00hSf59Lr:A>DH(PexT&7(nD,d'+4b9 [@ǜTIuއDto%B,.Cf24@iZʳ,BLh->ؖޮjNrbY~h }Vue=lU}B+%"KWy>ZaEPHBS浌yÚ$.4˒~J<"F`1 #dV&g EX5xz%V.}q_etTq{l,XH;^c՚V4ZǶaRFuB bM;J{U.E$k.XUu9AXva edekWw6q=RXF'886rJRaq @sO)^1U 5X8XQw{4uvw+=MIx2Ԫ{NZZS9},E7{U]=c<(݃\ \8R䙺f?UMÑh?$ɮs _ ]xuLϦ( 052Ȗ:{—k0UE҈ǖmNI <`{ުA-đ\u?i^#Cp[ $I\0[YlS@\36AN>PTq!s][df˧>tfZ|3۷WH"ӊ@8HYcGz4o#ΡU% bGg.xIaih;0dDuf$;vI8W~[?KɎ!y[ yx}c>9s-4Pק|>ak5daXۆ,8}ټ$3U`2%njeԚc 3}kq|w "<걱)zI RN~ uPgG DPl^uMl.IY#6*dpJEdպtd / =5} t[ /+kbFǤO,Ucadj^9lEW,EF޹'vmK+,-SϏεgױ.%_ }۩nT/oy!uȫz1-Ke MKyA1Ͷ|B@f.e zpN?էV6&cz^mTk0 LG'I8jN+At˩D74X-UG@uw^cFiFw#]g'4w>_(V7h܅h Ђ^ꏽk@#A.*t zu2S#i3RF&Q3퇏Ab=\.Ǫ$ )$ V•<\5"u|g >]yz޿Vj#zOH@l7):=>S{Ղ-p+zHpΏdi7.9lJMk)mBke? 2|ǞXY!=zڋ޲k u zrjt+ 41I`8 *ޅ{)d-gDՖ&r3ׯpzoYFmyӔvM:vZdExt%Aj`1^O:EyS$13B<71" |ja"#hଫ|M;d)N|(xw!Ss;U~WF YۉMP5Eb@U )q$ \t+оeGVumeq Yl;XUNh ݱUfXαm.uL]Lہ^wI5|U?nꢥ[}ns3vR)Џ M漺eg~1kG~!!<#85Ai♺Zf Cw1~U5x),dojp4vp75lR)^jUШ '$dL:zC N:t{@0 KDW3* K>u9ꖅo>}Th.SL@!G %lhܓw+-vztwv6mS;l3+{2ײXU&A^NDW:r״eh( Щ~KN-*]nYR*bt"^T|17_r}T6$PC:ǢndҖe~Du^UJ@zu~e*}P؄f5굦d^]b(m@l 5qdP(Nfܺ(8 c;W E/[]9NCؖ-0=nUwv.>|ݡ˄F wceK͗+L K mEXq4 )NՊ MpqrQP6"a| 2X]eeS\ɝXy[ҜBksIv}WD$2ms.ntvݵ8n)]$]rv&IeҕqkWh yAyM#018DZ``ގyUWv[^۴E n{z:ට578I.;r2;ȸ]K(0x5 KD3K»]k\N'Sp>e ףטIz3P`XjmF1 S˝Q*s<828:7;ھ t"rl/ܮp,:bΑЫ~+GmJPy-?sm9 p5\Wud9 LE h-@[lIhZ(X].ĆؚݪšˆM)yPPXs}n)~#ߴ$ ղXH&1ͫGbFZz`gA}' G*DDw'{}ر"KYOo<೸BcU @qmh:* qKYew?u IqviX9dWzn~@ԣ,]u.z|]\)WWs3&Z@$f4GHFÑY*1 KJrNBuo儙<6Y}!bd+޼\:ə\ 4Vo,Nڤ [" 肑)$m L6&UJpuBUߨDRQ%dQUVgXJIjhk"H&G-s?{3,I։"J8hGZ58`(*f~t(hUe{PEi{4a Ў](9J8 -Պ7mܑ:C}ب/* nCXNϴEu`xMs׉Rs8ut}V+$uB"dmGpSzi%\TT+ISjB&OQOCָ agpjIJ 3c_!q")ƾ$O%3B2= )IO#xH#%dP"tKbp Γ&%P,K ^WnV┣vZ|x퓐𡤳4$/UBߢ#]E2[[*Hp7GK ΩYNV>8d/yM!@- :\BjQ0CM QGV&͡]AJB*CIdBhsklsWN C(8^$& Q.7o p'8tϢ!0iHlDzx-@Uq#=9vM/3S-o\id ܠ -[)guRܞp.'{J*[:^>;{"m*0ݚ1m*X, !sΔN1K11-=&Uܼ350Ϥlp+ӜD%@j8Q-?u-0uy,Uc٦ tu<=`YE$*Ȝ!rݏY&(@+0I{Ӏނ#jB 9> <ĤNȩjeS5ZI-5^uu7TOzƤ{F-]?pB9| .iseƾ!ᲨA+|&lXO"]Ÿ Ԉm;+BFeU2?J;!$EaVva'495ZQ~Un56a(Bud)0:g# \e3X>|h[s`xR *Q T1TWZ/%E)ҤaTZYIx.9݆/6v-=gPbqC Fɞi9Da(l1~sR8kT@aZ9j6|SSp4=*R=шQBde@;}KMvad`/Rv*zE_/+5@]p @ۺks}L@ y܋6 %@@CuFϱ|Spz S)쯬Jl93>< /vzq#!],U!+[L9:/ ed`a 67Pʂ->:$h!!Fbp =i)`ׇj,VE3J>-[?+@&apEOX35M`O{! JpN !k*j¨x %c!RP38 }/'&6=W7G1В%ܑaZIjzAAȝv~_0i[ISrcI,CѲ&Eb*xbޝHfT6Za9sRH X2+JF_~!8E_/$0$raY݁Kށ.=!&!SvA؀ S.MxK T^QeT\N nmE>/K7X~YP=";"?C:HքS#<0e>r7ƪ*NG׭9(ZA@q>I+8xKID&>2YzIvi:eʺc|nR"hY>LYL;oV)$syTvXi++`1\#dZ<MH2zipz7Śd jenڮԒ2d htI^ kpKk:g=Y`!j"iҍTWf&MtԘY!]٩Il !OA' $uVaa[k* dN]zh|)J&+]D &_PVҏTgu$ו@tUhvYF"jҪAyl2K2\FЬ%f {'5s4S`+{r4+:q4暑^[^^Qc{|Vno|op/v;xfny.=r: <:v^ 61I\p2B~oVJ [S1aŌUY`cA0ӱ7eIA[ {-xYcBiYVCHLr# `HV%Q_;W+)MYGF~X2]Wkkٜٿ\|e?ez̓svn}N" ψ=ra{TA# WX$'g;+KMi%e)NUNǻz@ei<D]3oݍ{F wնb$١|RueV-D|P}r2ю{F~/=9 #La+ewdyf2gPŇ3h!!$ކa=ʄW y$΂|:Ysг Rn]G)mߞд %yQRDNEZTlG߸!MꔩK"abWMJb_N@3H7cCtBFb=& +Db>:~_&]c54i [VMbM@RF1ZrEW QE{.Q+y^ӂubL*kyFRfG@A5քp1Wf5Fmeikht䏌liRY)ᬤLJ%\JH8%lЛw7n@d\;S2żИQ/ "̯OwahL9zh8{- Dʌ?p~ݟ^v>R=Xnn1S&qAdʼ^,H4'kt~%Ι.(%9XH||iBE!S J6OFMI @rIe5UnKE#tRZ ,Ϫ:MdJǐ#`m=(fƮVJ 7M3PTד7CP$1b~%Tg^%IG4"A1SᏇ)ͮk ִhĊپ_% yҮ1J /{œٓqNj QcO΂D&qZQu]y3ꥀU>%0bz8*mĶZ6bYׯY8T0ڠ& ybS/hE"x} 2Xq5r9bO(TPb QhwUZ G$gDeZ4(wRzaUf$v:`Z;e1['ǞoC<>G'QCfwm0# |Rק(WTzgcSsyXL:ik-'Ǵ.Y)mJnqwe6JD]?n]f׃ \3 `Xa4TU[S;Zn*pp5 bcYyj{b}SLؖbȠaZ 7Jv]jSjǏ\Tj8ՉBjlnpU-Ϊ&+B CmJ'C-x3@M[Jk\jMdj:c[IVev䌀?ݵjڕ݌ 9`D-ңP]_Gm |X_[o,!R7)<a>Eft~} SEuBzC+B嫊Ύ*ή<@Z]e.@Uc^9On)2vNrl[g-UsȜFh^hiwabL;#6iLx2\b/1D')?"RT f:gfsPSϒ)9LpgbP1r(aRd;fm:y.TVJݚK|X'@HD9\n1S6從i"֋}NjXR vOQo 3<v8d!ժ(kؾlGLIz;rܺA 0 *AcpQވJd ǟֳa,c0>;?كrgB._vO.lFB>1^ ?Wij2}ٱb#-24r]cUTМ![} WZ`vL;.s$;n :/ؗБʗ!rȩn|4PK.;G*͠E#(jcY #uIp9"hK ' )6R]KiP_O̿X/wk{',)X X ߿hu?i>>Qt=KG^T}3`ݥ BތVxюk@W;ߜaJ  /S"mΎ/D@v/2eւ"JB|l ªǬ sggz6=$fEM_ZDfXլ`nsֱ\mʺ ʊothBh>59BgP<6Qd 6-o O _Ek{(Oƃ G::Qa ҙδS fʰ߲V}ohN''' rզ*-C5ң5q$ዂAbGu}E7 <44'Ѩyb@@Ak,%,Sg62] y5oyrEF*bJ&Q.]:X(y?[$5`D0*2@Ҽ_&Њ㪈^"ڪThw'ʚ.rE&:@yz4Kʍj5A7v>D 0gMTAmީC")_vM[!G;4Fݦ qv#05͍ڸXbw2-'Nb1-ԑj`HA\ϡPp8uL] [QZ]/'Px ʇ|6z#O[xWavQ29.habR:7Yԥtw"Y:Lxg4!/Cn8 ¶#@FĮ{V:q _"Wjt[FJ̿b=i:Ԡ#%jHDWZ"S _ XߊV|xqTQcSzE6q%(uX!JkxDԨh*O4[{R0 Wi@`Kf]1Ļ2am*N U!wl*va_Y<'J߬R+θ^./)b >+dL u/xS\z;xy.cWg *F &{ J`t&%6TLp,">J]@O^~6 J55a; Xҫp70gc47NLS;.Pn܎_Ur A@ :Bq>XY)[W2Z)\i:8#@:{AnC5.yMHQ-9}|ǃтo]q̲mk*yg¢.!$jGp{|,Es?*܃LTFo)^AlXFuF)\50FFF>u}^{2 %">Rì EK-NM=xٻ*nNU`#kIN$j awӞWa[*!_ qc؁PMtL( k_`̉F D}DAHUk#m_bѮKG} =걅}_'֐vXfZ>6NOHA6rb q:M?% 9gH&D晉taϠcV77W:T{NWxUMm=`; z!/R p`@鏶S OQXdUX6M(r_t8/4vf0]T*3Ӑ)*lSnH")0lw7C) A}̧n7Al:靛=^Ŧmz`uzkPQJCIR0,ɔqa7h\ְx w!@,*ЀSZ^0=Imv s,PwJ.ɀQ ,/{'2LÆZ1m_w,پu-HC5ak ^SѨ`'< } lӌJ?gO[ l#\ߴw(:ٷk,`!IaQb% N>~S_BwK?q"^^_7 aԸzM1~yД}c\m"a'b1^z<aH|MQ-\XtSlRXaUwvFƣH_;$[:݄d-9f[~OT,t8»>pB+i+(y̑}A2 _4iv :ӍO@H}' 2>yĶl@:h$gY%ҐK,X߉wȿ7`Ԉ~d053 fH\)nh(ߢЦ_)֊L$miFOTV#@Pj4pB\yjXz)&Psh=Cchv#IG i"<3%džYgR Ly{?Qˑfec}Pv 4u=-7Id]* j•KSmY5͘;j{Ԏn6Y'/˿;Hm 6OdFc9Tt_=h!uGi [cԝb@#V+c衎#Lm )t8ΓN? J+[މ=o/q,r+Qi5D/}?5@h=*j81CIS<$5L(1"CjL 5Mf[ ps =)~;\iS18ܨQQ`Ll,۔ӛ#lGCn9MCᾖ~l"{wDjK,/vwQddm@h/:\O6YW䴩[UKoKVsݬ+ŇŘ#6܌8/|8<IeUqȞBo}q;8W;Q{o~k-bvb1ӂr<k_B_C2PnLdUϷEbuLhdp8YG,]h#Jd 0^|mVtxNO0*BJ>f=*_A2!|zf#ZeNVYş@ԉS9?N^|Ir[H} r|Z1+RH0k(I- 1*pcv+`RR)'\Oܸ"~V.3%cKGGdE%+<xJJ4=lۡȦrt'U$}b09o]w}Ҧ7o#x` d뛦pPw"E+S] ph†Zk<,[Xl;XbQeiv I7KgݬU#d%h(p˪oGkl3igNg;6&jL6#%,Bi-ʇ.[/W͢ n[vuSͭ.|~Fs=9L:U^21՟N_)-j%ѦWYtlƥ[}4J[4CzoJlo屖+y:r@Nf"thTkʛxP6 lK !ނ>Z`~!`?0~Q D\

D\i;,P|o %UX*2&DW _\uς LFn:/N=XI h *yO]2$Vo6e>?ү!2ʔj#6pɁw`: ]aU0}rwzrfAxO@ upAh|l@=/]*73 Nb;R1?j5XњLNGӒw?Li^xDŔ꼋HFDDz68pm8|.M?."Fi1)+l^^ (/̆u|RscXSyo8s2H[W_an3m_" m?,gPh(7<9$AKwd/K#/v7k`;XVAl@ <nEvQVn,=owi04Tp-Q7ݚ9KS16zXk?&]9aՖl(I, .S{4kV25{QyJ 5jIMζ`n ED8ahXV%Hc6Z-;Ҡ a/8EeZQr4d)ë"=CX{e 6#hV [Jh֯͢"6|d3 ڝ@4Bj歛dyX.05sj7tq0 vu5iv)pm=b֝AEMlv2oBb+6mZu5y[qndApסrTpZU<Õ+ZQYo!D<5a\C̏׵1"|1Umj yM5p@ k%u zonfGl)Q}I%, y1Qfyr̺'_JfohZ!FPfyh:C/ .ml>󊡢aB}sS7MdX. ⠈  bO6'_))|1ּwWYdˉ&:-)GzmJcMre18&-7/Va/5w,po~_g'^.o~^7yq|u:gTO>Shᖾ~;|A}lf;_&ա7y:-n6,Ƕ6/3jv {}LN==xYYtm:ntv1t0pFط-;Zh#v`pTxGV8- uQZTV̩w_[`~ynM{kgN gEYm}C#IѪoM%tuCՓ0w(EcO~kq&=!c䄝I7k!R4yvyBֲz9eGEQ{m C G@IcVzZ\2R)QQB)#s4ru%r# Uh`e8N$K4 *ֽdfd<'SD*8&2d/hgR.T쫵e,uZc[p&dzԚOHr\Ji /]. uӪ9Ke:Z XtEtQnm glx9FD^.X:T"Bh3̪4 B]K>ҏvk[~r?lȂtAa )CPnuu?Q]]; w!{9-+ 楆_ [.=ۇڜŦVjK4F͎kDBIʠ~욈qr +!$6VWhVWIڧV0)9N=Eow%*Lq T{KA|? NxTS>>bZ-cg ivB/Dߴ(_ -S&u^?]jdPn}g5 MzQx-ޮ fvǣc"W)χXEŵ꧕4X⫦y= QG6Z-jKk}[͙U·?PO7(Ͻ4 R_eY:Z"mKa|`uQ❷>Axڿ@bH8lREp]u wN @{M7MQe{7Ŷ 踆0.lx` .rl*[A23=s :nS,|kiovM  ]| nB0`_v)*)z~43ls 9_VZܹ(NQQ)/p\ ԓ0k \7O݃L<UnP +m$eNM{:VH=!]@z_T\n`c%ԛcV~G='lUVfٳ=[8C)t`::OO{>VNL}1lfh1Z 0ǮM4y@$t$shz-鈙6˓wAhNO1ɯٯn+ru^rB.4&'?(.O: jj&1WrztKd sA3h6YZiO `M+ 7B88g+iƲ|U]DF6T I;)*'BԃV<\T.[TsX[7{26UXȚ7!g`v[#NNQτB͑μ\8hɚ O~c̴9~ d7!M~sV<-b&ZA׬#`o'}pn^3K9&7QK ʷ>*FKL  hdD:y]VqZm\iw{ f*N88[-0<3^vO8NKNj?5zN)iXWzYué:$dzA0p;ITKՑgm)5VrUrGԐlU綞Z:kd:j0Y 2+[HI6W5~p)>90pQ(ym)hY .}99l[@]YȄOF"M,N|"Qάi .+!2쵸Es:Q:Zku9'm&s$W+[ו}|& b<-Z60;F 볠Tw5g^8$C:*( .NEUx<c5zesMʤE@نX8,Y-N.L&SXgF.oXw[Пmpk<<SySϸ :*X3(i1w]U.9q[ G⡒ lg9Qږ XkVs5'Z觺^ )k(LMTd uW=~!1T8,ЌOy@Yu=m}5v̆Q\ҙ6y| ^*B14ҏHjPw}z| ;m*Y-d-m.W 46bӜ@o C}%6QxYխVdIy?H2;(B]6*.>>l$qR3E3⎴W2rycڼOB<;ڷ&qb4U Hc=k*Ԟ39>)cyȡ8Tyi>O}`XL(;"vD'}ZLȨXQA3yy匇do| I^vx'jO5-R @7.O0/;YiԹ]!_58K ~Pq73eqWқ V &֫/V,@0cwƹӐ*,X q+r Ķ+o SQCQ1[/ECNUǪi^u$;*a=7TKUA"C[ݨS( l[Nz)}6τK[Q͎V n%)}.Ķn_97tZE%wΪRCZ^9Rhߩ|d 58jQڔaHXsQG>hnѴHӐnäϲ!է(Yb+JZ-jZdZ  2VX@Ј| AjpE D&DOz ?GV ZxckݶK9n!^#`NHGRoϵգ)CL+SK>Ft@{B "Cݾpyt贺c DOkX/OY갳7Oq90LJ)4a J?0#Hh? MocǣWQvH ;YtanGiۆiZ$.| ``k^QhuhȮ\\;&GZ{NJxh;er aA!}ɨ˘lZאC?ä TFIJqŧc&YJe)U7XLm?Yd!'Va錎\x=ʂ;4RQE=Ϫ \* A_m 3t$SK #`ծȝݮIϲS"nwk뽫8PLi^Adu8K+4H]`o#ϛ2%LܮHthReI`?ӀL8^a]9jش?bcft-nKi)oH@wXO#4\Y&-t`d-6~q,5fkYZN .56 KJk#JwFLN1'k?l|pۦV/̘xAZMm W/hҜlF~X&ۦe<TF@o"@T Dx~ژ6vs痋1Yկ۳1WmY0Wjv~7JKj.f&E xgϝxv]SwQ48ۣaR-V6rs?jV&㿿["6\Ux/׳ 5:L+( t'ۗǰs{ei=4cܻ3SJ3}&݈oM?Վ&DQ\p-!Jz6R]DFBnk(,2Hˍ]m"'R|aT-j{C zKOLUP`-`K4WB{ԄPBB8ǽl(uQ:Z,w+1͑Z h9X5mxu\H?U"Nfg_6_߳\nP6Bf#w`5PpƒMgyٗUn%/|S qz9[C}J\oVߦk; >fkǪV@\:./EVǹ-{BBě%HRTJ\[UKQFq Uב5݄/E-6M ˪,XkzRD Q Fo ٝF)U=Pڬpq0'셽[Ȍb VɃrjx|\$3h1B7/@ĨG/i밳  Ki|Q?=ն n#5޷3-Ӎ?N`zxRiƏFWڵߊB ҦG^;=cvPv]SP^M4+`ŕ5l; viHA,ʵ1)zPPqeZ0n@v6=$8cTLPD*]Nv~n`D}5:B8(u%U܄J6SFNOd{)Cxqm `t7E@Ps)0K4'JQ5=굜#Q5XwJTW'U&0> |ڐtQIoTuQC^j襣BeUb/Vӂ !_{ 2.XI[ZGF$z[6ѱ,7ƕ]z+\i2E%TJ$Ģ뤥ѱa5wku*R:-=7 SGq%tUAh 9l{*U 4)Uz*qĵpi/ߙv!GE,ϙuNA<= |N-̈́n5 ,-Ţ_7Rg+Ͳj/-_/zEZ9{?,`1E,»de)ѵ/حQV1@9mQ9Pm\VuxCrvs'jN\5^F|IRds}`Qiw0!5X;E% |)cbo:izG[B<&+Q` x5 ZmVIu|Ǩ +cAޖ:8eƗô>"K}H2˜قYg; j.[M+6" PF?"bwRvjv??,.k.K}^NP2`$RCM_wyvhWZ؈hwpmb eF u4)| vӚӠ5hS^>9S&OMXm y8=å}>z'L/QF[rG]K%@8r㎣:NH*׺;>$+],"Mq֦+C愍NN2*)|ΒDG$, 2 +ڞgIݬμ*I dn>*Ε,Y^!vA 5j撚pI{@NO>VP`%ښp ;|!5 uvg'q^p_[2CBsЩ^ sRnPA=nPv:c`Rn |'JS+g;EȾ&I< k`| 2Qb!g.4[6JMˌ6 ٕo ۠L0]xOce«⌲8WE&匦>)ut-bXg*CҜf;GOt]ff6AP Rޅơ:zZA0Ԝ7cHDi 6EPwu0S6V`f(t6,53r3B7c ݊ުNhl\ѭb%9 5cDBT7id/G5$T(4d:zTIzտ9p⚊`:BR.S/2P%.~C3 ? =)I'o9;fQ-jfF5SY>~<zo[Xv m}J=bMݵp:ھSD7T[^\e}-,hIm.iL@tC[*rC<q30mbC:xdiΩua\eѩtaVaB.;+KT lV`\`2~{{zB ag j03yR1m:#LH`m D=zc@6xRGd6p-#졻qQ.fo<"?9z5ClA;/][b·5p7TtW1*wfх\U3m^_`2ںaLW["ѸgVآ$ 2yV_a)($s} &)mr6va͠0d'0FISvM !iu~)>w$O68O,CID*i d0ΪFp*h2xHxw7V8۱K__+ke-fi' )4Ytu: @b\SXw\x4P)ב_}O#&F@Մam:Txi÷hdm-ñ3w3Cv2X ɫ7mM^ϫްX2۴jmh}t6Bt@Lp(mgۺݕ7"m8lKH2J md 7mYKsߨq6r4Ҽ?1aۃ f[ tmpպi9+Y"eO `<8 @%$tÇ/USnxe7()ye`N UFM ŦU~*߆̻8'rnنd84pX-̂Sj9XkU5<f1 o{ 2ćpPa& 3nWRޚQXbPh΄r͟ާ9Yd \PLN礑τM9RlX{gW+im:Xؒ> m~Lk#4|OhLGؗ ޻` pVY;;?Kz&7EYE6Jؓ?=r 2jүB.֖x}G}y9LN27F:Bb(cɴP_dm:1 ^V $Cʡ/CN\ݬ!i"F+r1_<^:pR"-KxB:PPGBږ]FW٤5FUgAn@50U73|(jT#V@bF\eW5H`a \HOs 1\ڗ4`.E-fbeVf^t~r(N_[q/U[LQXE?M'O6+J|f,|ڎz@YR]Ey:E1+K@W?Ma\o#Y&F?6<=n='Lv^WΌ:"LR r}!U]}C}@x>+0xY hYޓ:_FSo5HdPa90i-SNt`Jz Mطa3M$P)UhS3H.m{0),%Uz,zLagIbtgۿaړ"}|pO1PUz߇9W~x?,pH?O9Gsy$SË !]f}x`#Èo_}?; 0CK~DuЦ-Sk?dC5y<LC>8Og\{yՆD(&EUnM[]iT/+?Ѐēx).L"pC.f:Jkt;ݴM&׺IR%H$eSr2!oo#pCצtOnA{P0_ g2xT_=qlk{xT>˝&J @6Dl$0Gj}/ШP,/Ak떚QT^;^O~kIg*ed!?vW"ӂxWy <*L@&"I t!aⲔhejtd)rI7kyy x1ۍ2i+۫WKS(^m^=aZ5eB%Ni<\^ZJĘ=q[|d_`ۿV*YBH5 }oP$I=>H+5MȖd@w5T#F+X0$FԳl)YN*r,,F1\vq2nC<ǠJ$$wNTq'#nUB]ݫkY~ۚު>A߼X}3JV^=.wǩS21ANDEhzT™2O1uMf<{i[sOvݧqV5^ ~`}TZQ7}fzPٽ<.Ń.&cA]jI:O<omUFme]_zyL厂x<]Xx V^ <#^{{4x$l锫 F%*c"SP=.HK]8nZTtF/PG!#bȓLZ-SHf5#!%fŲZ 3:Fʙػ rLi^`Ge|йUɈvޞ(B >J lq0dGr!rtYud~=۪b~2}ThemERC@Rrs `,:T I7lMxޑ~PqmCy^^WDtnaMJ뵉5씶|['-C>_,&8}ٝiٖ}ː~*HCVvX55W)3UȺqiB{F[¢ 8WZgJ%A;A.oi4 jR7ɍ 6Zx! \Gvaח/L)ͧ1:P0r7W^ I-QF慓qukc:ѵzN6̧kX"nˍj##)uˑ٢5M_cBpqZJtkXp&H ~$XgQlp kY<2h&/&{@gX<6 ^P%{$dWӰ2wa}lCiB\ڝ\p`{»Q໼|C2&sty$tAĂ8HDEY |H7 (qiT+iz~"LA>/8r#_hHqB$lH(Tdd<f;C}s)۲=G828G|e(Fu&<GbQ:LāQ#աi{%*`pKÖN `I}qDc-I,ǐHmp\]0hyFUPCeDow&*tm_WW1h`<5V{"֝ }+ o32tGF#,gQ0<|"')Q*0&yQ W>K@ӭZ ܬj{\K0Eޠϧ;h*$FU#i҇h]N-prY Ë.~Drы,IcZ T `%Svo ptzxQ3TҌF6&u-'{ w$ *J~qSpЍNW9 Mz~*MUʬ2.ugB3^_v >={ -! FCAڇÌ(FՐ[ @@օp_E vn R3kP+hV@DkM\N"k'.Q9hErWSSM[Zv\n XQ.B600u׸/~W1 .X~X@eLzZu}&nCѱNw W>rbٶYH"d*t؃N@؎(R=To7=)oֵm&v3aBHM&gç۳1Wqr3lЋV$05EIL"\i u9c;_B,EkjCOZR&=<#}+vq"=FO3lF|uf:lծ^Z"[O:'+v8%1ܖS}4xq. \ׯ*oZL2&akՓVƟ5SujcFZg2ExE8CuYWywzM]Q墖M FB ݬY:O-e Sc}uf$% ͙? \#<)d7,,o(JS7"ɵ߿3sa2C?)oFSm|GS4}ڬ;%[ D+imNjPk^Zh{@:S_p{23k=h(%ok ܧ^$޹p͉tշu>X^8y*N17\".t^[yv.OgLa(#vre'ֽ@{㥸ß`#X>Y0ر醡Щ?hpՉwٵ fzB4>ev& ,'.ˉF];terp w41.oMU,'ftzk0:?;lH0f(vĄ9[:JVN^YˏE۫4FUH")rk1<,EYWg^ÿtOvn8eeug/~5*Qmݡ#]Oi96?xA֓lZq-ެ.feWcK͆ILr, z (wx,zQ| E[~@"ڝh91 vt`UgTf~/ mZ0;kt1iMk_ g3NiN!(oj< L-X9^u fvߍхmh/_i5ZaWp6r/r1Qt@{}¼PPL 7 )LuȄ3Gcm4sr.X:F3k?'cT϶)!ꥮ:z3o7{blu\Z.VNu$On4n|e:mz*PǦXÄj nrKӖ ŚVA.Q3v;j6(83R'_pm=V 2bme[?4hi2E}۔[߶mG-l{s闿a=ֲȵ@ҫ:pwV[Y{'ez p͔jm׾Bn7|a W} 뾡\ro\C;[S5rqů7T.C28J$ #ezHw2\ b]oZ3umfPo^UwNԿu޾7)ض>Y4EZrHN6CMVٛlWl_NľAi>fG*%0fcG٪-8!OɏtF'n:?t0݂ E}ڋeGnO C"7^kYE-?7 !!,`a1a[́R4"np@ JBJXfRv73 o  >ekUWgHQyp?ƽЛ 4:J5v=>pQmvv3#gZ7vFJbB!WAubDP$qdZT_(aeO$VqLAZ!0Jע&t z,<HᾺuuEi&ԮxA͡}^؈jE?i M`۬ei׸ D<@a?M=jIASF3y"Ч9o gCE;ô~h>aꆕ lm=rmm$2mj%TsR)A\zc>(E4zPEV{mHU0%uq9#j0rᰆ?J-@Y2 ߅=ӄ y]ھb;{e)w2gS[e񆥁eaPAG-z<`u׶Ն[jy߁hԎ MUڞR6^5sQp 7D1pW!{_E{>Kf6vP̒]i|2,,;ǃkRN$I8o>@oIgGwc;|Ļ5Қc$6gkFaCIPGCjVͅDM(x3hgڊl.Ǣ@Ds++Jd)Ip]MϢknaVӶ*7Ӿ "7y CsZVMF)-p-F/n@09o1du%2us6kTnY -\ja#8OQr>_Vt[&Ӳ_%S~DWUfVFzD8p[X1Ҽzg=/OؖvT)Z %1ƨ5 8>vD?? y+;.C0M -ALkw' x* 0br0d GVP[s}ēKصb!\.C;9$U9wN#P1:Y bG+.p Tj,)cO~4*ZϝnG\CߦNpm4iaR#\I%)E絊@YOMcq`~ֺ7T#$Z#SƞJk4߹j(O3޷hX7TvjЬyukNiQXڕ*#\ cDRł &ǁ!٪F:c^KuY~f<}e(P˶vBQW?&ݴ):ksN_?Ѳ.DS4T,H.# ;YD1sa>ώM;Y0t1|{<qO1lޡ/]sߝhQjM@YnR{~r^ni3Q&䫥x2p±@̲U<6֍rRvn%s{.,QVE0}^g2; lxci_#eԔY{LV˝\\E<^jEbb۴zx8*efwQQ*{ܳGc^s5whKؒ$Uah:wP+=x[d#jJ}:lHo?uO!Jп!p8bs'5;Z2!6ujH{w)CBϔ7]'HG< <7c͌oey#ߠOT K(+[5̧rsnVƆgj?)['sI )s3[[hI4gKaGGIs*Y?؂'O[PVTWOuk.~zJjQ]̶)>~ZOlGL9;jkRqfGԘ;Dne7>H}7֯d$֚*#yԥhUֽ\7U;e} jf]s7| qiKk!Qer&L>\@ĩW.zӐb> \r"c?tCW͠#hVHN(*RR SK#$BP CmG:hruҍ7F`ĀQ41F12}6%~ Hce$(EpnA NIn/卿'Z$T5hJ$c-Mh&ڢQoJJc ^bqQ6.O+xkh%zoYEyj* ~m4 '><rᤖK#u|8"˝J#l IsEW\egUmPS2 t9 E97rѷuE1\Z^Bl=E! FvC=7{\C6?0]"%5كYO&{ qg0W=߫+p:ˢ$Ǐp3Of>BIv{wl糴{5]Qߊg8{Ў#ulq»K8={8ԙ;-ݓb%~dK$>0H+wq]H L줤nܜz鲙L9wKrȖu Zu W&ܠ/ ӓm.50Z}>< U{/-C 9$ɶEpT/b|4LYHMA1iF *ݴ+ew\WF3 ~{9c\tdj,;I[o'(((+p5:^Y{G7%K??O=1_r"xkf336| pם}n ;el e+灛n? ϻLny'5{CzyϰQ2XQLL犞u9wSay@uAU/̹A{1dVwrt{+  OVBW¡n%峪[aR^j唹-қ;K'l^ WvCӌ]=Pg>HHa26˒p7XrzBu'Ux|khg;Cj`:@GGuƃ'fh2>r5)|)'`q˳ܔsQp ;AtuWr#w3_i(.w E[oJg#hNzrݻŝB$+A)ԽJ!蕍oɀHn HwJ?<g@R 䯘 yeAI ut^K^aoD'E{ۭEБ[ ^ǁS~]&fD0ƻy/) 9$vx`=r/yIȾpFܽKE޺ÜP9.w~vKGOZxǭ[P|58a/.+[XHڬa(ybѺxJzXwx_Cqk{H?KDn{ѵq^Wh1,+w,IY]jߨ kA &gZ[|&[Y1ϦZn6q,?E(LlDPg*\;ԑ3|C.5GfFsʱM9=oExFD[S--3FnOtHu9Jm()e~I`r@~tz }jL׮*u]&v 7N5'{dw͈B^a~@(-BgS%#)V:7rG=MIyGc=3ќ]'"+50uWz2գ>Yηvk&'dSVVܵsG ENq ϟ@Q@q/LC,.i3qzق h1>2NXך>[< qS_v9"+9턞/^ ݎCKYf I>~q3aۧڋ|E+.qUFPY?p-*p0VUY+ے4g b7.+lQarԧE!˟WhvÙiv(._ \1L u>R躞lo>["@4"- EC:WO\lK/MWH5;b{<|>kM!? 1Y!w^>$9;y qխsIO_ql#}GRuǹi+O''3[k*D4nr'ڽs tu|*BvNͻ\\ pe;7^o|Y':u"1 V]L% LHRmaġNj({4v#ɢ#~Ct0q$x]k9oJA<,q&~W?Ыٞ6S>j?AL'*V6㶦OyF#6*J2aF y,dt&f/qn CHS&PjϽ0tA#ݜIYXXY(Yienj,]\lxguȺn&TUtʽu)Gz [jNR#R~CZCVWŷXf'>&&=ƿޫ鄦)0tv` ƓԒ.,(Z>1/1u?x^Q_뉮mj|]fjL ̅&B]qO1Ed˹,"nhAi#٥ s{rg{rO*\Nm[z̞ X08.GOsOp}kD|̵}IR* 7Φ!Q[r$]&ԂnaS&=_&X6X5PaEF]=k-/qX`e/% 8&bC7M(f%iOpUpy'UO=FΆ8|<D82cꪪkGG>@BSEJE/]k SreG}Pxl{}B2GVHY4~ >=߷?ϒQI;QLJh17giqOD):ylOx1/Lzo>' '_i &CrGƴ bECdq ^:kjxC<l#n-&ĉtVYe=z'ֵqCS,̋Tn=s ƍ=-頨\* ̈́j00"ƖrJ@lM|(/SmcHF'qx"Vd jS6\: P{ {cRR=3C܈*?OMFw h=~Q#Z 7ln uF?)_Wmr726e af<{J_(Cm|78mO>iIGJ{2*< .a'*b%ZDĹ"v2mwAe bq$J[)`s1Ww`M}v^E + NRG*d̵ktS2bY).-Ң*2R2sGˌރ`'=Fpf/y]=3Lwh172m|!6/cg*6_c5ux`NÌćew 5ZĝdE#>iv9T-XVT~i٫7WM[-|TQDž3Kp,S](6l`@ZkT{{u;#wCAeq*60Z{-yxS헥>v$n_+l%F@ulEѺq+ :dҠU"7,Rj@r*! 疿9?,ucD /X%P(;'wDR%K[bg‰8n4g*ȩ(E0v`]V0^5+]z%i] zn33W~i8]ܒe8 G^"['Is]לq-7ImZ-uVT|fsK(}.+?oIoÔޠn/:UK=, ?cx#sam o*O6ztW|n!NϬ勵KBe\FK.Jh2T2zS.=r*jFIylϔXvi};|nʟE/NA!j̸VF6pzd=3Dô+6+p 2m4uFcGM^Jәwsuo۟yIݚ'u&a%XtI{*gL4 ZcZcJ} @J"Z0; xd½͵p_ ؽڼQ Ӷ1X2Nz:jiա\b_#$m)^2CFyi_-6Fj[OX]֨RIN.)ljv_#פ\ia1Yi5(8Wo Y¨!)OxM!RB&eG: zLa^_Xo\&{uI&0-oG껵.<ב!v(GI`c?~\z6*E8TxSJ+jƒ%F0o[7my+[F8w6ÏmZ$ޭ,vXJsC/:*MtZچjFnGٚN g;ϑ,w4Xl1cJo l[شK' Y]-+0!rzmM hma\:*2q\eK;[|U-aY-"}q/oFy|C؍A6sQͻpDj< 5eJ<ڃHp-(]uiX)^Xu~u2=#35JpLWyHUnFכZ޹|Yu1دF]E]{ >dק~@1`8;1JxvtuԋuALH m݈b=VHf*bk-Js'^8ZnkdD5@a PFB&aC(X*4sr"1GeH=2ꦣ5[bw\6kxfضۡ9N@uM ݺ4βꞡwL$ja.HyϏdtž՝O?#'fh,?ꧫ#@c:ϣz@’{|z,3;p4290XE\)+աKm:Mm6ȃ[[VtcfYAiq(JsPugGK49ՄY;طd.!>u1uV.5ȦdM3Gbj^YHI'\e!og[a==4+ǻ3* bӎlHaJKfqRM3u#G `JTgYx%(:"ԧ"܉3k^\wTַXm$mw `{, 6r;Is_Vv̈́ Ilu)agr]fð]\jΎJMayԋ>5/BlGٟL!Ͳyg,-O'iFNԬ>oĕM7b^M| E П+n|dڄI77KeC)6[&#B]%dL2K6` j&&pgg:N^l tf<;xj$샹TfQ.̆`_)濏}`4lp;J&mjc˒YgWҥ~ʋK)io]N]{[xlvlM5moϥ-%uΪkɪV&}5&XBD#)I]z/fd:ס=B6tS R/ ćKBCw$9(mZ#ǹz,d T!A]cGH`%uJS[t"-eɟnjb @U,?rFK3M L3 Up.hQ8E/<" f45֏@SZف=u9}3k=V3#Uq=븡&*1^%R|I ,;z8T8ΰ&yNr$λq[JB].͓E7Y-q8CЌvT4 "m%h-d% {-|1ZH,.ׄ?rZor |.m8⻃ns}u/D (3k[AqUȖ %hpkE2Aڡ6[/:_.R:gմaͦ=W@wxf’r+ Ҽ=]e~04sgpmU/Ԇ֗q$9˫oUu=jɕ1cd@iVVFԼ6rݨ-˰LD󡁕Rt.%oh^447ތÒH ]}9j=*eRmڶ0.c\H~n"8Lg'soV22;Eڸ}O'3M$@=IRˆM/FږSҨ`7@M\wm<5CLd 3Y>lN):c `el*Md\a1ףViGqZ5"M;`vcQDP Xn= 4(}5mP(ӥwKH>wxܫ'RṬzÈXfIm;27/WXXUE( 9WW1n2Ɏ#G^17mLR|ڈB[PAI4¾A܈۠=цAFt&$2a`e•ǰ?)Hﴗ$lY l)fymlj?NvIoOm3M)>ulqϴrb^d$Ui98@GXmwf9*h3_)ȭ6ovՆ,g5It/k&\"h%#N{)cK.p?wKEl&nHQS*ҼDc*]r͂Eӹ|u}@3BO@4Ȓl۬Vn&*^{nVkx=Ԅ G0G{Oܮ=1ji9QzRmrwz5-Q=XDizivX̓ڤd7>:wJObsyWU_i9|k¾)~=ż!XB2IhDo EƜgXPdcÎ ʚ+!":t<ޢ٧:sմLgBÝyC0;Q ¨p8ftTJD.?''M}>Jn׌S9:N+/߹ A$D*Du=UdwaC QYXOͧpk&Hx+X֗ jW 2^dY;-3z/;fM2%^{ZFĐb9kZhzm`3?/Lj nAH Қ)f$六]H;>DyGn#AԶe]޷ A*SK}zse ^Qn9 "UZmY[J 7 #*;CA8X +f)ZH]V)+{[X U N-l+6!NME4K!SeD{Q+M3uVCi罼* :۫U1Uȣ~|2VOgTm儲 sItKJ^-'ٖ*úcW!ɃwnH0ߐtڒ a.Z7㥏_Ĩ̦޾rOasNuP0:?)uP^}cMjKVBiDM窦fZK<^lzυv9n% rg^rQVxZgol']_!ߚ=OMlE5,G5"3|AU5:JWK0 J]$^y(NVơ׌jByfvZ !FXDьk k^ p[je=6lA>!Qe?v+E|'?)bR!d"嗹` cCdžSzMHnmM,S[_VcwAF7rep"tvՠ"hЋ673ַ !zk\y?w;,ٴbCLzNCP]ekim|| Zj]٩J|⁠ԖᏄ5G=|oyߙLmn' 6 !t_"Y4ՋɌgI?{*e#s\?f{vB[8ڰӯ13R]$/3twOЁ<"^O5Vo;R,gLsa |3DQ|ߩ,@ V$XKTrبCW/yp}c5utפW"vq=n>="m0 Rq3(+vH涷+8a+׆P,@.dqGEZctRֳݽ ãK"VθلKW2x]+hH+ZvU-k ^8]pJA!4-=R{<Ex5,JnQ&4Bȳ>+cXdst릘链,ouXnrQqCvr ;\,BKD~Bpn]ЋeѴJuϲ=Mo&k*Kxާc ͸̙&4/;佺jAYJu juiNIՋY+LyeG/6g8Sa>ƶwMaj|ٵ,\oe㹠Typ6~tӬ엞J. 1a-SQ!͛[<3nDw2dlXdDQvBەݾݹa r*sΉ.%^S[!2T41FvZɳn)sUd8))cJPÈg9nU .ljDquqooӆ0Ӡ ApFnt/ZQS<,6UB@8z! Ϻnw| | pr+첽YTY@|4kTpdjhl'6&՗ntKaJIgCAv2%ڣ S Sq5rOmv Atad]ebŤbOK6lk岠ܐbQI'M"…PW8277.1Z_O"zZh<[cSn j#FCĬ._9l>Tg4Ԟ2'q Yq#ǶW]t+q]5ʙt5s3SG b/[h1:6smm*|J $Y, Թ%5.H츾WH ۾<O[ˏ4W 0arM^RSxK蟬Y$;ua)wWuC]]6uwqO:G4!_zj@OKlM}VSnFR՛pl:iϪFZjl@v͆ri"`kilog%"6Bѣv&ũJԠ9s8@UE-; hq=)%2uYy])iSwu-kuSz}mXQO0\nRIﭗܣO낊3l6XX%jDs<`9ÖH7D\OiP|jGZ\2zkhU| <ӂwx3eJ.1nsƵǁK{6 8rCyAGA:՝LlYNl 6l!jT c1LGX.H[2|1M&,p͋*Ll1.tω$jbeuԏG<8E =?y-(B'\| KP.[|0-`L{mbT%OCJs >J8v0$h9nϩnvqG E n`U|C^3vF(@d5MBUn2/·6!H^Sd%px.-]O~v@D;]InQ i=="aG`}^q :2t(n;Rtӭ& ,iF S=N,tm&mѭ|h}"Hs &SR;6ѻ/G -0QRʢSEwd":&~m&1\rv@ p_źr@>7~wqmcٰ=Wwx5&1.1M?JY4e/!7_i ױ+{u(LipfMn{pEӿ-$$|6[0A@ u m׻&*yİp58o?p؟ߖ/mX&6NSY]-1ϺܯE+JŠU&wBYv˜Vvm Q.wAơm9ðTk÷zsD BM\q<S 5AdX;:DHeNɛL[ Rnb;̌"L$qS&j8Omj7>()^m"2D `MI$1ZA+W/[T C?h15,wߖCfZkmcBZGm**q@4,)I!ؚ8+#|0Jz+ko5jzorL7|N2`XPhyIy6߫,"EJ7aWg r.m%74p7'vч):g \o[2Psh˄ȷ0顀~dSÖ΁/xy cȺ9#M_(9{R)pf{r,yaW鬶*@S8v 5]|9h/Ixs 9LnQְdKZ?y}87)|G39ՏF+HUHiߑ\hwI/۴zgXIdPҒ3%A=)G2bWQG6Q#:Q,Q%_ ~g[xIkGBgh;7w W8+Rs A:u޵#m~طBz=]7O*5z%uL)5`WԒZ"B6:@gyLM3Pr=5_М'kYj$wW"[x kp O6VndpEДT;JRNa(˕>z+U"l[,NlN,ޖŹǶ6r(a`~YC k2J Yce7vHmNvQg=y3@xlQu^K?KOl]7TT~5~|a%T9+nC׭tdg0 gcX|l++O:7ZM/ma\B!=SuL>)0.X.Г+9RGY$E<.";e .cA!C*)5V z64 |(S9?rYfuRg1oȐˢ<ͣLd[P,iG'jhOt渺_Ǵ au`6F #|=OqެLB\)rfn6Zvbkz(t @dSF qH aML!xy, Sce{U=vWZ{(n15f^D36gjΖV6;2D${ 6Put7 mڋd,C)X{CIٳ X`:.f=Q]bV x*E=Na-C=7btSf4lf~ELOJhlޒ|Ϲw2gu_d4оcn~JJmIB ^~e'-&($ Gߞ̚>%V*&mj`_6jo߇BvoNdqM_XCN0U'%v!E[-4@x'`y'\j?`T<Íڼx;K2؆Qt?9nbOe)`9>%<6mEȆO$ ;F>v@eVݺ!˒V19zȘۊ.d2I^󈗭b}MFzy}fʺd\v+Щ~_(i AtI%lR%Ucj_ld>! 6zCC: cpvFo$b+}[7 :rUѸ_mGV'yZ Wk >ݙ IkY@:N%W -/ 3*(߽JII(RLk^~޹޺ax%cҡf|"^-A{֝͢c? ><'`w !y1=i0ih35) ӮV!Vhta*VV= CudVsVAK@Г|nal'Lڟu}YN_#*&9fM4mːf #eTw F<}8p:*}lPe|0ϩ\jCNh-EgW Όp=VDa-O0L$bV?=}a݉hH׉rk1BF:6ys!M5.޷(r9-a׎[q)-nYUO윛:ejyqso$x۫o<8T+6Jx'eJ}gn`[]E'9wxW{e2jO,`LIh3n͉ eimy騥֪]124h̷S)jS! W>pa3;㏭yN_ՕT*D}:eK5 _8^gLBE?pc)x-]lm0f^z~F\5n1d?Wj4CvV>Cܨ>5VOQ5oKj֏6K _Yա'@# QX2%*G*+t7bwӓЌv0tAnq _PgAʺYz6.ֽ*~Uu!1Z Y$zRcth:,PŎ,w[ I`ս40kݏGoڠGa[4^&kw tvҘPpeꊢ4.(+U;^Ӿ&C7{jNoϟmv]\ Ց ^rt'Q*Ɂm* +Dvep;O'Wz7w)n'l>(ޟs_DO=>(&ͩ[j([euB?Vnu׾ze:%M_vpȏ6S,.ج vQq OU6sO[^:B*DQ @ᆇ׮ryF901ULx+UNM7 eLFX>n@:I⊦ HץEu_'oYJQۆC p)  Qspszl>&v?͜1W9o/0[@W\^WQ+a/^͚)zr\lKdXO:f9dB՛n`V6&n%UJ-/*}iøp*)b8?8kV^ "{,Ӆ>Lݸu7;A(l|NO{J}RU:c6TJ+qJ1`~^m'[]d$RWޏ uQ ] oZL::IYRNlVAN.8.du.8z}SR[}@3uj/wZk({]#qDD_?Z]Jp6oӼ_W[(~$ '\(˵!Li긋@]1O&tт#|m֢)  5! rjM p/ݙl=/yFYT77Xx+8'z$& T:lkO$h/UptkeL㸁 )xϣ#dӤ$*C HO3u20ՙԑJQmUЎtU^9WHɢe-"L,g.^x>(H #meۛu2E {-{yvX\L4E NOvbbJ*RgDw](P~Ⱥ <=~Im6|3.,c3]YH 4pmPNob^ C8vCn||Ѕa]e5`4e?4#흞"@r5a'Ť3yYk 4k\D2N!:ãtz828aΔL4"1K1qKiC)tp0zGR85DK@ GsqǑ[Z%E"mhyL A]e}|:j^bC4AM㲞<-_˒(2Y2TFSP0ycxDsYEhI>vP#mj \ +NqQHf`f4NoPbtfK ܨ;SRb. HfgqX(ʨC!tqcٛ  B& vCo64DZP2A!V$Uk;^JO|G '`;q™F1Ul9Plnbv9۞ZT[6zgwzR pcnVtCCUF4~)0mlk[ZekN;6p ,.so{@@ժT5FXOmfH*4U\4,]~8& t;Vlt텢(zR |<;:Ձ.UH ȏ˩n!J Vu:X4_H,GH~쩔 [@xўAr,)X5leom jF#D=24TYbA==IiiȻ̪ GRDbU`퓒QBa|uY?x, uzKYb'?Yb"LؖcA(zMCWM_m,Ec &qӚe3LpcΪ zyT:@,@~^w& ^_K.s}m%vmf$ߣ^Ė6;:_w.Zvs!jg=@&x&YZ4Rk;mir'fTjnſ \̳@jS7ܰw{Pko`+1ijM+,_13,ke#W)|w&C+xw^{s6& .n-o;W6I]2]L] Re/M3_}ga}ICT4Q'#k,${+b Lgf7ϜKIue#8؄e+ۻfpfe]P&Sy{@II, ךÿPwui`/|]Puͻ^AB 0hh!7-#n_c5cZ KD($0S iVk&-޹2ݸW2{:|r. jԾPQW۳^! N`r )F \g)׹_B7-u;'JZP9,s=g:Lhcf`T tȄBP`.3LeMw~4 io֗Tp lrC5ڒKw > <.Y2VhWޥ:GXņvdSYy*IK@#UcB]Esﺭ<~r)x2+IuK+oznOz\V#M`MpwzRS%[j|K?r?S?Yxˁ j T'K?\TհStTvA\X]jW6cݛޡqvfzDG2Ma՜¢2wy!i6TuhQ )|~ #*ߣWU\JbI*$`Q,2O(t쀦}2oh43[=Q]^]LNlϕ]2lKs#E k& COfnʭ'}esWsĩ KHp"eC\Ktcm`MxwK ɵ3Вqu%4Zxu~ͳZU& +5]-{ ciɎUe|Y[G @4tq8ł[tC"t<˜Xg*zɩuT{kfxLT|MN~^Ƃ!axƏK]z2}lkiO[vnp@E;bEvV)^V:P5yz9xb\Sl' FoBh5X0_h8Wnh ZQWM$)I4US;Nen4ܚ=5%Iyx#Qw^0ڝC8S6b/7 (:^3sõBjϔ[L-(/ ۧ}PR4/ K@h+F?:%eKV髕^\q_X%-J;)%0\I֘N =(x}coB;BgAgSsĢ9\%QRbW5hRFF*[yq@4,Dw8U}FZ9{R,)5rʆªyy\!\1TXvY٫Np.G X4nϔ/Q:E;J}QMx1Ѧklz338݊dz8SI3ܜMnQF-Qw{7`3B'ɾ='/nNeإeT| .[M3$*jIgT*Cr; /Yiu;>B#v|>.Nʽh)=P GeҏMsG<)0w x IPI!t2U O Y0';qsr/y]Sc ev?oIwe2 98njD? 3E`Zt"K`rV~`Д0Y r U,1T7jN[G:pw=%PRL>A,T#"|Nz G;o$v0U+4fpƒUʇxz/u&^m퓺O;lEKɓR59b/6m XZ}3QÌhƵ#hd%iB>k-7his5ADrxb Η0o+r!nj\U tAQpu)ˮĩNmqgznzM?ă`V.$e< UhMԣm`RzF;FJ^bgD;#XQ[v2P*/&M[;/ȉT' e{)}VŚ 8(7!a1*6x/8uu#qɩO}GGJhh y* W&Gfe!$6L+u=_@U/?40*:AeeAɿaS#Q"VVHxԜd[ 6aY5E:2؟3o# NI"K5d4SR]К:>eʭ|f(Wbhmoj %IJ6pKNfYlT(v .ãqɧ1/1#:bZ @jB]\Voםelf&[twu;-G{}PYULWe2&R [wȮ>|n{M"$e|$G~:.^&۬:sC5Ͳ9v7k&x,ka.!iK#`Q^|9w0ţ͸z>\ZDcsd`Ŕ^+351;c9T$w5_|j<fy,'8] •(բV}i^ {7+AML%n'W:r}8HT]Bܗr lg N61#XoVcӊXA5Mm9f3TL?I52 ϫI/*7% {W,5@GœZN#d+FU!םil:[T[i"j:]`mKQoPU&4 siX8Sy"Z!hw਽~obL.lemWR4\n.x_Te(p2q@&\#Ɨ>fOHN/Y-JR;Ž'7J0zga\nu`ǰ"?ǝ-ClD/ƽY^[~4 B>5kSxe3FlЂt;IV'l9m<{[,[O5@ MF!|rFa}XM?iA9ґڸ+S N Ei仵IL_˨1>L.fNI~_G `<{m{}ZU/jjc1a;7%[)oGS a.b?FYB9)>Z\Ō꧐&@ڲ*Zz{%GB tбNDvDqCO+Ιz31jhu*MAgr&X 2:1XLjU@nJ$UcTdK΁i?b5dz*KG};FSf,nXݙa4.FXЕT1LEz#"GEeI]qRU! Pd 8xf$FZ7hYN H>.tg%nhd0ɯwW%N27HiuKCZ{% 5 h2EqtaJ*ᖌSԖ{a*IRKZf RI*\D(' qZg@[a[$IIQfd; ܟNNwl6DU3icEUV!DȀK.ZRґiEMIUfubZ8eƙxBrX!;*@K7I}EE4=q|xg4w-G3e,D P}a`ѱ: 4 )2nQ|ZuYZJF)U+Hjemyq2;_3Bln>=*1jV{i>7N>}]1;Y0t,΃Re;`{=-aAvP6T:fV-ȶ ǭB7 pf_p."62h5욞+}2 3V7"EѬ.kfh!zN9e)uqW604/چmڹmNZVGdrӶm|FŒu>^WThHu] @QVý+ !s)F+&c_O`{r``f3(:\gڒadPT'tmF+c8ADg@+Zgb:bVbۚ+` "#L#q SQ3ԲoАUz#t: 6@~C:R^:Dfg1p4Hb@_Cż#b $i| j4J8[%d:{/!$hg~ߴfaN101?OE[}0.{/ՁW<Fѓ5d"@5LSO)^^jd!3 /eB`NƒZdɡ|a:-*D Vc=١[7ӔRyUDNgʵkPG BNB"=0w 6QmJo;Kɔ魿Z!+0/@4liw y;׃['Ů_%ACFNc0'ֿk%B7X<"k Y` W73gW#'^DM6a{ ›]$a WKeB@x{ۓŻ7ʼ~OxZOԭUA+ un:4 7B\"Jaʚhd ݗ4mͩ/OYS9L5wpRM*zub. <*YS䬡Mҧ:q*>SHk i6L*|$F 4*Rqts3&LpPyL-= {1Lk;+5ʸ^͑ʻι$Es24 2|l%}i@#N35rjMۆnNNQd{kdSQ\%z_0/-[!?klӌӪz{̵q4t˸7UMbP@ Dnje,;_2Rd_cU%%>q?^ܴD,o7C/oq;Dp.f@r5K[ l^_QKޥǦjᅬ5]s~0dQf˱wh߇jY pt{a?."uC^r(èsے+ (5KYyR8k#mۏi!z_X. aoJER)ڏٜ Juu&$~(T8eLceL==+f%[]_VM]t7oo%zYC4 bJ,)- Bk1-m0OiT` ?yRTPi~Y75H?Z t6mɔ;mR6탫 +ԓ.֝>lL a)T/S}o7NOg6~  * nv, ,?"]ߗ2,HtgZk2Yw:֓Vc{VЁio) `޿%oIQ] n$p.?$4u,!G˺`I~rvFTö9o5|kvyS"2CK;}jqXZҽ=^8#tB:lQ젟a* U6i,^ } \F %92 (^]tR׏s¼ڵNF`#qw փm}DXfOH VA <}0=rksEAX!QB|6a _T'NO%Zs+?,iM<3 oB4UXaHo:@6fTjU-M;L&Q{.ZWu{ ?ijW` @ ;)3dWXn q!VVǧn2Ɏ,|kNڌ=T.v֕,3Պ6E N,#Z<ԍ^x4ʆ*T)/>A^ɎXhML"z#ij|kpc $Ip~9w:Qz/@؍?"}/p/@=LI-醬&UR/T%}ɨ6`0qAck:+nM]H W>BG"%WĦ]y]kȧ}<}jwiG﷎khŽ4 8a`3:V <)K *϶>sv? YIZVasI2S!2ooDb|/}#JY&k/k4بΠ@}M:-\ Š-_&t~?ލskßz L [6L-BN751:/z <@A bSinHWS:ӊ_7qj:S`HKE@cO bBQѧ0k'MS\Ԁڅ " =|PeX/n>\.FuHN#u-̆vbDMFJ]b.̥A|yjkpFwZ.c*q*W!%ȽDɣ,0\ E7DBWlum({㝆w2'0`c[2&Thnø.%:P[d({UO ΅ePME6|*D*h DӰH8G cS -w-F:КQwYQ92j V:Kuj,0߿UTOvߚV.]؍@<㌡?TvB25G dj^X T*,w#<’9EC#Ѥ )nz]Ϻ5 RuamS^QѲ:哩 " hXt{$\MVWvLՁl kS}V_Pzo9l0bnFPv`>`SP `E9nhϱ-8w;G]vԈ€GUT-jFLH+UTKbڙy+m۬);Ŋ픠jIԾz^-jt.VcӹKLfg^9p dc,4UbWMoTZQ&P-cn)+Ԁ;Z_xMNعP\ư-j>>V&4Xz$F ܖװ-Opٶ_hF$F-},Mm+qfgG\yMhN@݃dIYDeJGヒgQfCzDY< +HnflWha]!@VxXxP, ⧽2,4a?J@jf 4>H$8(8[O3GՓ"Pa9W ;R7J>^r-^,3W/s_V@ m^ RF= ո i' מzMGx#`cđˣdƱFGıˋ~1W5=Ué73v*mFA]0 ̶gw' UfzR?ǔTԊMaC bW;Lxt#Rtq8rZ,E~Wir*ͨ2:ir8B&xf^3TiTKj tj|vcDE{e Vwe$DY(ӣαtPSP ÞgYN&#+mI+~GPSԏ)ļ j^6i瓺/C~r%F*M-Ʃh=kqRP.p2kYTʤ+dN+@521 f\JifoQw^6SJXgVTQt*?Rbr|AQrxh_~U';CN@9,s2ߣԕH3MҺf]A\/KjTCAH=t恤/Y@}Tz׹,4ofyU7ߎi'q! ]T`iU!洟kL5Vw?tj&5<#iD!M5' t٠IPa}$=~L+ͦ7hgBS`^xtmˉc]eJGs'~}fljzVs(efPB%Ǡ_&Ǎ횙\*t ~ ⫬,õX]u(WBpX;#!"互Ԏm|a\CiAmdW͚W8T&Yto֣d~1YKQ^L\&5^M5oc9涟z4ChɅ c =JɌ>Zs q@C!= FՌ P,eQҫԅ@m +&CP7{!s8U4j-5 S(<'פSH4ݕ/n!Җ@oZk| )8`Ԅ%3宸YmejZ ,WO>@/ b"+М %T߫'+!tIr%9D} ]@i@ػe}t|տ]/N$Z{y4k5R;Zzٓ #*G`yio$j;5ۀ!1zlH*t[9"#ϧFWzgz&@^6riQukkRk` ڭ!s}]HE#O *UŦI 'a̪a0q],M3^=Ix_ھET:\XH is<5$#"&,eq؍M7`ijQ CUZ, uO6,/Al ^.'ڽ5fR؊$ .) 1ƦVi0vd-8lqjؓ3P%mH ۺu8/R]V8s9!BAvˌ xm8OaBB \E.`}~-ԡh?ڣθ!ÐՖ2 'ĥ L4|LFOAh Tq0[ۆw[%Thw0):EB<݂y}g.vWP;.KRuaAOx(B)UҙG6!3+ 5@e7yx.K܊io^`nY$ I'H&&I :Էyj/ţ&${}8EUfYbk6I+g7s;Ҿ02iJ.æox&sABz80?! }ll'H|n[Bܚ9M0WPxuD1KǢh :3ZZYE:.niNS,܃~vY˯1-?|+j,+jAtzTg!}O]IYy' D鹲dsU|E7T<i9S6W׳5\;oTOKX̊ó-=TsFi^z3&'zK)9@~t&#!6S`Ċ{߬>8Aa%ǹ΃lmi#-)D_pL"&ԫ0F Vpj^!=f Z %7\=jJCΰO*̬aMp3^?:P_y=QEʓ jm]3t>j(_ ZAfEj});[Y*A),%N*[4gߘ/ PWXD;VpZdž&2tWn:\=jgV DEP+ dY }dg%EquaOu9?5J5RtղEHixnPF G{@ -j*wcCgW>b`XPP?Rz^/v@N @~HHfUҝJ~8+Kp0IU: D.TD7vYGNSPqRH$VRX ej6N(Rշ !MU^|t5kVO a9}qъ1*ڂ Mi<5+vkB i[6NMÔ8EWR^o`.agjpZ|^s %G U 8rUh3 v/շxNO7\tpY!z@G_yޕMr.SVM_W@RKڴxk<4^c@0i-.yvM!muqj\.]3g9 ? \unմC['$œGWq SA8Yt<&ݫ";t ]ltq|szFXB}ٺV6H,J_JsM0tQ}_cDMC&!yP oz܀-4-4X\(AB*`*8vSr,zj^0w5E[_,5MWQӨFa#]Ca~JԪw67q-z^jw9hҖ/Na߻K*hM̺>EstW?^!@pNhz.r _8̈Ԗ9}VMIEuXk5wA_#BXƩ ㉽i8p|/5SOa#e`wK<}Ocp-m{d:`#܎Ǹ27MЊh lBFeGѫGz;~)]Tf R_7 L a*:ν< tцKYb`vvB溓x gau|$I_ՂJ-y$p6i\k$$͘\@O̓M$Z2|Q,@ZgsN脧BGCe5LWۦ y?*e@@;' oC'ZD 3hp+̓CyxR{<%m: 4}Pz0I=Y[mT󴶇9, - y1~&FV#+VM#`xyEO|ABFF| g1ͽؙL6=RɕMyuVRXcsb:ԋefYO"֐nF8č,.&'USW8&68`u< ܖw7S !B_Ek/Lw|c# VIb*p9j}u,DOPEm;n?9Tڴz+E־aXR+q&Cyg7f5 q{8MJԋxXDLk DOs'biǰۃO '_=7 s,MIYrxϱ|@VF8){HqDۻD[;88Ls4]:~t Z?Z"fhՑO>"xmYՍ+j7)UNȭy _%ֶw=Bk 7c|y}y\oѤ&H x.uqէQjT+;ᴃv0Wp ؎u6|. CVy"S> Rue3D:ZXڛ(Պ. $]3,{u|ZV?[wfGϳ/ *t*IR-wfW_bGot/ c.}GC lqh#˗aXdghQ3y+1uιdF0Q7~ c㇣1nuϫ4_rbH1a78t&Z/~9(JEXil[ҌwIU]M̽AN'dm ]8b;Wteop1U7+c%ltcŀܸB+Lgoz/\)ؿX-P8{Jr^#xb'M;fA=m[]v5OrdJukއZ[qg!B I'n*7rRGR17u@1ҵfQX㰊iC yXV;ufU/w/cv3@52N_]PS(38ac.4.8]BZA<۶@+>Ǥ:/x-=@ RM5jCaKş;E[Dcq*Q>C2tpHpSVM5 ja/2Gb};qUV_x-oTZN|7 Bvԡ781Kuo_6 4/Cc*'H 1w#F4_:QI2n=O f|<&P9E_w7 GT!.LW }QJ*k|fy9G^K/k$թ<<otBNbglmy: " A,U8{}ֹlo)] E[ȐE,]"LJz TnvMɽ7lA3(+5m7XxxG#?,w{ִ꺏h5;r1g-/LXK{Jz[{!7O)':ސIV\0kU+l#~2q4G_,4R!3X~.@74qל^(h>tI[emur.[Px0M0=8`dUFM+=Lۉ%'W]gs=[5P Gej6`*cO{d[`TXa:q?4Uo9>&b8yխNI)jsi)r3XhU'R` JLk%@L+s" ٘X'cDb|9w"B(X6QGwH7 _gc EHh7"$oT=kPjȊz>48sJ鉔i\ZI*FA'c\cǿ/D(A:è.l8jbj^ t_RSKV"QJ$$Yvp~c |7^*"m_tH@]ӧ¥_LdۋOr1IWHwß|}%˧Ub5ѓÔ0'[c=k㷽Q}6M7-6VK]Z)=IE]zBtQRU۾7u#Ľ*E`?!ȯ,6 p~ˏEF \OCQ+ح9rp3FH8$Eܐb0u5Dj[s@20,MWe zK$.>*SAdJQy3?Un 5{)iBqݣosK::F}FQ?צR!]3^Qe3L@8PZ I%|*l 卖m YhW4} >3O~o ?g8ס.‹$T6XY.W V@Y ϋruڋ(y@D-]x5 u"fakp|VҾZ+h[\3bz3ʼn!S3"ZָZ;j-A9wD&ѵ jhL* DoQoϜE!B*Q 2Xh)`[^'jQKh\Lck\XPYyM,c PTO鿰<"W~jF NSN?q$I]v Y},[2kvwD-ӡzRTjc(\ѫ9)kTrKtQ 1n܀E"(U:ƟezIpY% L0fn1 `=IxS7C[]l%QGS(SޥM-0(L^m:,}鞸~:9^!. 8Hf،0`<4]•7K0'u\pACn"V_va9$hۊhi_|F?,/'u5AF~FqM)ɉjT|PGw+]^K-#n F:/[@c{EyNjF /ծP !;7zQNx\x?祈CPiWXj<64EŨJsQ(f} |:uX"nvWX)H[@QoXY͚7ҙsrnI*ԃRyupH6*ޚkW~%Ӿ.7䜵!<l Q4q"lԈaqlo;um˫ k=[1@J=aȞ0^=LK,t' o=Kj]dԹ)l&4 9JoWǸHZ򧧒>J4Ƶ|1!Ͳm-Ym2~I*f7Q*q&:KxPi4!@N@0De>ycmFQ'iӊ~ޔ ZTQ>VzDtm["5wq+dhޟ'TV.Ke]E,n<~R47Gt#m>Jo2N+{P|%T ȪTC,;},܍GrR+MSѠQ^ %& kS4P$"]zB?,pQY ]~D_'_ztrF۴ Քa*m&;⪸bu>F*âwEkI[Utrfr병]F^ `E~w*@40385 t! 'A|a1f>uWziF,] .|YCI($BBKp3^[`WcrQUlVK2?ܚ-QR{W4 gI3.5s"C(1v[l9b6p` ȴpuj C b6M?M~@r8za+ ^g;RvnZk烘A}Zc_gFj@>z%xh9zԼPE\ Q060=#un-~R[ {!ۢ}0橝'JA;vDoYH85kA:žKRm{fյ`:y7a d9ہ'6֩Bw)86H!iPsڃDqHXcӟP@`C(玕UqW{;+: {1 *Ey@umR]1S4S/GoX(h_#kޕ[PȌdXR_lzbN*!f"آS3kn6hFdILFb3:Fˎa] &/r+xܖ?l(˰]嵨ƔK&G1=滿C kQx$_6q+hNZ 8`_b;asG>;1'#ӞÃk3eMٺWBv<٘b#sG3idCO7*IWK?-ivSnU B8>3 6ԍ5ȯ@`C!| JS[Тknޯr^. FѺk溱-ݯpoq[Tf&W8'9r<A evbʛ1 ԓ-̔ 4j>lV>Eq3Js c6Y$(^KFbBB8cZпP=u{|>' X[j3eߝvtgOÿio?nlz&?<.0/1@/wvÿ'MVwFֶ>2Y} fOL$YϜ]9yZ긪tH"aՈc%G"SZS,wguġ$yQ\.4YJ\o ]Y)VuJV{4h6ޤ~qjo9I\yftAӪ39׬CR5Prnp"f9ݏ7Fv+I|VTWҬ^k^ 9>y%/g>L-y";97IwF>u@m u4L׹sqo ÆPƟ}"VѾc߈+4(PO2Cfʭ04gmӴW+%Ch.NlXΒ&輵I1ISV|ShD>4Is s!δZ.5ȄPi^:-2 prkt@dbRH&,njk? w~ETf뙙K/L%T?tӀ׋Vvy5_fFUڟ=XޜnZyJK聖زw]w< _"[?`VJ[ 0{(eBS5|nH v(r̺{\ӱە&PBFʬߚV}-v#_F%o*]I ӅOnpJjw -t:ajMU3"~9VWjDjB*Q}&%(;efw/I&,Ru eVכi-2gڹ#4O2e`˶W43rkl);#/f9^kŊ+3|Z0yH6IiɋGH߿f5H]4];G醩c@`PjDRj&2]ڠוgJ&ԾJ[Z"}1qI\NW_rj&R&] ޯXsV(Atiɡg%6[ תIK$׎ sBf^CO~ljSFu_2mɢ!$@+ꇒsu0Z %ܤ|\j)RRj~"0Ե_7h_8*Z!GA[ }|Ml(=~֍OEKmwyPI!խk)K-)"ux!**Eא>5X[\YZbQR*DF1L8Y:պ{i-nbҖEɠ'cz):1Iq>HGJ"} P,\nQ~Q wKάy$)c;ZZ+IESZRĩ4U滦1|qjo>aiUヶ:сv仞ekӺZn##/c®so*uli&j YՅp!;,;`_>HcԖ\ݠLS HjۺeS1ƴ$5~4:Nu_#ڣޑL 3O- HLT-^؇ h@/jA.1Zh(cz|~՘7X!acD#a/Y-%~3|[\շW9έ {3iÃN˸Nc>w5ҽY]GQ-WЎBc(jBmXo!=ʼ%KZdySֲL'N;Y|E}\gdlĖ"5Bxb= 6:MnüiLs^ިPqu]!2QlRne<6Q_CGީ9i=5|\tݎV&iQ*pB6:1_~F ~arIJ 6Qnk! X`AJ2d_FE۟[߫Oq5BB /nA}7/Կop/b 2[ϪjpePerPJeA#C:tF)EJc(+'¬G| [XRe]G~s z\ 5S^z$t#|}h;sUӼNYa On殃 ZF8|.7P/Ut~pJiI.U:4KSCBC܆~ViQ Q;|\Q{NnGja&bصS/lY~k0$E.اO+Ҋ*A밵RO+s}FjGoF[+o(7dEch1qV& 7KC]#W2ItJ? L u[V|@ ei`*jVb3% k歪Z+Z.lIX.Q[ l3&9na@y<\iNWt BY{ 32쩟JG/+`Onab=EtP,wC}.UT5Xa DiR Th!x Ȍ5>61h`y!+FW/w8Su[.G*R;:I[}H1(FM+r{Bm8o R 0_ .hƅ VӰsP\ri _$OIapa'p @':7nw;fͶȀ5 2V\Ȫ1o>_H_ s tqx#/P{x/,4HcAVO;7|I希Hcs47P;j!ij^J/k m&TI>m;x㳆 9/*PYCN{TOD,ב&%FHjb3e~a5!f5CgJ'NH7Ioޢ\hگIK<|i.c\|őFt'*e'օ_[5Y 5c!T7TΓXhiMlTRKQ:GNq#Eq` Z8l=]U$3,[wK-cIK9 ܆fsEå*V<לG/SUv} T?H<]ou&"mP5gA)>;ɎZ:8MxsG/i[7pw8"`B~hFdZa+,nN/%@K 4с׀ Hzj|B#@$ !E77H sO n#Z԰DGG4iaeD0DyۨU%ã{v(=ZhF 3g` -K*_Ld9Նe:w.0zpSӪ܆i9HfİȉGwM E ~ǛkQ1q[YI+.'cOG=%MY=^ַ#CM`*]b9_;Is2/.c!F=Y{c"3G:$ (:ҁI\4YW,'@N3-kʰѧ8PpCHQk9ںR!Llnu 6z<|`#@ ~!{xR2mv\aΨtQ:w5ЋT?Tr^Ծ1 ltTo}6ύ>*O=TP mXF("ngFMAUU,7C'Fɥ6' b$L+Qݥ힡%=e&7Ĩ`?E|_, QB q.eS]Xe !\=zVf75S:uuCl/cBp-FO3p_q~##VV:%W9|Պ/m@& קuG1T\7A;Z&Dܮ23HU& W_̈́՝PK+B5Alz#P 3$@ a8!G{Z[c>{\8lvk=tSudmBT}XVYWh+ Q(Y[Y +2_Uq*>g-@7gT|%Ċ^Jvvp! ;TǵZO4p/#{ ǰ;W5~}Njet~r$W1xe ;| ˔gڲ7yh\~ vqn9%+Hb-hлi8V_x )nOێGieu=_{I(߶MT]=dF;$K#5pqa-c7W-Zbw V)FP|mC])_ke ˶W6cSjͱY!;uqʌ@[-Q %?G*[EKAm4˂E[t-jY6diWO ,)7[ʩ[lZ0$#YBx(U֣,x wnS~6c -YŪulo2m(6!>D}4N7w_ u(*Ik x-vFǷ<$ г;rPr}DGw++~Dd !ƑI8!PpeHygێ ˀYE,ZctGIZT1:v0bw<jǘq\[1֦, sV Պ>=AJoZxdjх\Čc]y|/f_o9DAS-NSTNWta&B%BE.ojA']BG'dFBp ]7MBnZ׷_wRn]!䖧6/ هՊ qx3('Eƚ8ubTKɽ#H+j]DUAv+Fl{q‰6, T}So+׌PbCtWb^ԝcku8B=!ʜKKg-ym^to7bTB+TX{C7[w>sI VYS*jBd. e Uׯ_ N gZeM0HhJ>G[{q2ϸ: []ݡ;I YVsXTH]}pWuH =^۲FD˟DF:FuwV M:ɦY=s=珃eK?j";>^$fX/U/ S-Rx"m5g0 j&aîv'9 FG-S#6kZb@1S .E}_nz|8bcyNtZP&o9D.~@$Ҩve55"nm=wF_l;=wyذ3]-2^\ jrȘndA&Q5h푢^H$`JKs\ ia>Hs{TO qqliH#b̰-^Gn .[uRW.4Fa$(X;ᣔ0<$*iJu!aIhο$t;A% ^9뺴d֋ ۬J5J0#z9°a&PgC5'8qTmxM m bL o;΁8X&E{N'OjdS#gK©i1Ԓn38Hw[&KZFkKՇ@1Q23PINT (r]HG sF7HЉP#Eh1/` c[^j򒖆Yj|GuP*3h~0 vSj^Ow7Jզ‡uvlZqbiw)VǕ P3¨l31UB;L ߾ƽ-W M$tV5z8oW.6_IV_h+Z޻Z3QCPT;jo@Uf,JDUl }SNM]n"db/F*АZk/X5r {ۦR+:jC٥ ]̹i#5{bi-WtnE4$" 0꾗 8`;:0]e穦֭Q}7xKý8: Y`tZ'V%JRCQâq\2qXoE)*wy( CMVTpw;Ik9hyL]Mr4 IH?[8.ģG-"li%NWl{[qUK !PpMd oDUJE8R(s{qrۼR=E9$<(D#GELG1M9d8,[Ӊ|[y>dYˉk-+һ)"qv ч}ꑓ)afp#tVOdZT]Pf;>\2$<N|ͣc 3нMI9˼Y̎zia8tH;<4`|0+Nцir=+p)2:i'ҟXv 3& _)ʹ:NveEifhmb-8H׶ι1 CK|RI*pm ->bƸ4aε4Lor2 J}G]g])ݔnX:LP%<Ԫ/v'ֽskJ1$8TIORmDsbnؗl'7 ^4o_U/beǶ;~S-_ %=w&[?֌D~}A0gsY6; Bv߾+*"n;h܇S]d"c%1}`zQǜ~]e&T)f"†DI-cCQ)lU18AŁ3eWݞipտ}13Z{; EvOvLBr{i Y %Ke?N%bNFBxOɅ]3sڃ7@c5^ jN\ibuZ2H`#voj~6RgLe:pSŭɶ2&| _C}Tq.<ϕeb@q~.);Ӑ |~gt=?cܺxQ[.rsֲB@K ݙ`q0*Vlmd*ix{,lڈ $uepްv֗/V XGVJk1]N'pD1Dۗ+/Qz 52LOm&J#W A.-q!SZۅ>텛K-{)S,?9E5KwK=6<,D`."]f7V>Ĩ>8T ei @TC'9Dբ=ݵi-J 7%ݻl0Mu㏖l^y=d'>3O;=,`ަ9! D} ?3p'iyݏ_ ٥%'rR^!h ۍ6)Rs: )eǶ ay G1\|Co#8~ks#'.#Qtɾݶvai{_HFͧJ_|bϘcN/e8h)WrInti&G?F/MQA/]a(iZ)X }k^>~#AE}?}i卵wsu,3]#\p;ߪ联 n$DWFs zf`Mz tI3Y]˟U0TFm:OG >uO &Z36۶`N L5';2ml[w-F펅ԑ߻7BҲ2(L?&\2UA֕$gM`#[]_ZY꣧m!R3,Kdt*.ᑦ㿄I9Du|^m!6p`C)N$vX X;G vV*qPqE7DrJl RE,6nUŷZ-Z[_:`O]DCaTirUYĬ׾Brޘ.[RVD% ߻eW1!Z)cT9ހ䒼̀u=m~S^k}}[t桭I$tvo1YƤ4 $1@oUkoX}D*R¦[tPPUaR]5T@%ݹ>\ù ̇[}KͿJ~4]~5R||E}ԠؙQ)|p>ԧHp: mhW.4oeD :?lI^ӳ8Ϲhwfם&) {|gu͇B2hv^P2>|=̵⧇%ix֥˓=֤Dد WMnFMjPML8}]@b-ѓa=XduQAjAbܟSR}̰Mpg\HUѵTfᷤt+얭jr4ݦ8Ic z_IXb"{/G.T6ds$P_.Vb-7oG@u\)j4VJք XExa?\k]p)Gsr+ȴ;B|ЍH|?g}i0}FoH(HJh Spta2U'ҡoLV_=JN;)61ڦic!ؔ85d/YYF"9ŔR6-m:щmv"Аj'qeAJ%g}#FE1V vM6?]OrEQ!aA1ì^2WtRsގF6ш(A$^>Ce=,D 7ܝ'ͨki:֐Ǭn A@n!ؖxaoj460a[YTT7PN4 +M :h\[FٗfӦHYzSxGI6+r ?m}|ˌpHcĬ8,I,ʹ)dc۬c@]u 8@e&]/]O(^i~t?="HEGztc^OhLLrs-?:B;۩[?u:Wlea!mbɢX \ v״̆A5[YucԠ`5l8e>Ը_޸[{%Dʜa[KX"AD,%pL t%4cBeB;2M1\X(DZ^F1ʍAcCm`Myed-v3(cT.&[aË][F#GpA>b&5(gi&ԣ:+g1uݦ1_k%P3%lVAJR.gvY#V^w+@V]ѴU]*?9FW;j:(:4€څwk=3XC4M )ѧR|{ҠzUVm$Ht_;azՇë-BX s̩u U3+Zghv穁!.Tֳ[wIp$!v>u9oRruI@q2%V#VyN7y݅iKdedV 3ݺ QYXZGK[x 6fA= nDpߚL>~4$K"Pxz5BqA6"`N R& m~[PXNE4Q Nw:@Z$t;05a?I/= y~&+x”6C\]N53u]b6yr15\ǯN} m&MMQ^`[HzJoY2=-9GUY&*%G7s" K2F)M6LX,+0, %upRxuVDC,O7!!ੁ`@72V< "ip*ETemoi ˏ&-.RAHMݟ8ZXc8*e'$ePdeN+\KHa/v f1cccA&JU!эf{}Xi˺p;Psp\/k2?*hQr1&PwC꩕nfz`DNe2rBE{Ol񥾎QxGu0<Sdu=|ILًfx?z, hC\a/_ VN3ʺ񔐣G]Vbs3<Li:9LͿk*&!mja>Iz31Ǫ i;qa uM-nz2d?`"gmoA}vK#+)YoI ^%Y^qR mN>^Öu %1U@RKumU®?`/+|/IWs!Uut_,Lr0yLHJ5vo'0lS tLӜAce5p4-ԜRʔ4t9aʺHkZ]& 6->ur`siUs6w*@Ʉfͤc2h͆nfw_✦Y./;Q $:R4ib2;0KdMo[ހ8YoDoěq>m*k| Xy ,1g~RnŠZe˿R.%G` |U3Lmj"긇i-J_M['쫞BQдN`oێK[Ty1"agu3N1߉RCF]ʶ2Ʒ"K_Lɀ~S`sW}ǝ1c9A3ח9!.+&wᛅS%ZmմќG3"ȧ͞GqJ*8tIw´; S%woYxL !E&.H¾@Nlu릆YxM6+""07V~ 5[:6'J{x)0xC¼chXEi(mږѮrձozE֤ TC5X%MxS]댆UpLuLLIQ#G{Ըg ǜݝYx/S:atɄ{G; ¾\,=PeV5?vO#,,x!D~u͛Q ijϹ|_ADo1=[#/zsa ^Tgmȝ;yKP==\K "Ḡbw>3kihDNbҠoljxjŲ2.Ӿd`&qz?ʩ@ٚ((Go+x& ɍmY1M$ř}cڶC.@2Ab("örHm,ޖ }|ML/ºĵBB9O]&_r{NJDQs 6*,kꪘl|@% 0nngH1@' rZâi?`9dz@r~fZFnady>®2J~)dhN0#3"Z΀ꨠrNޖ//#{@592wm='^uɗC wXX$\" -YO9+&I,;c g KS2܏9~@9tOLА@NZ-[~O _qO|!6xmAmO/>o-3Z $u^=E֏KyCeU_uo ȼZWWK2^=\#!Kg:'CNvq M<\}yN gO O4є]5 ^ B3CM:;|]'̻kY翴)塞Y=p2*|e;qQe7[qQ 8t fѴ}{. B*yƀGTJAWg|k!+]Z 3Bbd3򠆉M9Fk48ń1<7zL&ٗT בd_  yzQKsXjX`"Ϛ~tx=Cގ;wҹWT68|I Z WkXuRw b[:^$ݠvtW%0[7щ8+t4T>T(y0+ v$ E ֨`r}UB\` _8%FkHzO#B\I9459-CliS:k\\ؙY آGɓAk :۩ 9(㲮ΐku]:b _|eҶX{"v^>mdb[ JeM2%^'<68h=Ts3@!˩h9[9gh^ !4`#`ʺ>6oY#zb ;2^!WM09^06 K}q,@AX9Uȼl$,-@HMZ*EO/|HSzl$1Iysٙc4,:9X4S. (1R40, >S.74}iO{=Sn_yF _r}6/q'oSyXz8_`9/r+'O2)yB\GF;cpĀ5QwLa_މ ₦nMa'd3` ]qtY{` B`m6g~WH jI.1]Mz0kK!M}>L?t2p--v0~dJzj>9|$]"h6Q TmwyzD+M\iɋ njH~fafp$VQZۤ右 &|e_V67 )\W]Wz -cKE#$Cl\!tN0rk_գVo˸=_wP`Rǃgb ~܅mJ$#;rQ:E0Nߑ&I]0+ `$R~'س QM+h! <~K4=VFH,x omZߜC iga&6`#ƂYuİd$ [_%1L-Pv]tj)jBb8;cuWɧn)e[캏sx1qa)D"6j1OʷSWr[A*mMW0\^`ƣ4:3 f1jR +|vZfR׾y u!SM[ʾZ@VV#N+Bٱm04O9yߠrVo=q0@Ǡ;)E=0nt Jζ|сɯwG@jHD\%搳T:+n>+G) =~n(`ԘDTÄ0H9,pFM Г@؆ПQkIӗ5KoZs,гÚ%Wi*tH6U#@|G)w~J5kѓױ!1Ya`gHv1հw?v+ %rc+_ij̇ѵֻ >.%!Q"3u X./{Bt 50Yݚ!Fv:Y2X}]4k`gQFӈlj@5P4ȫ){ ~Ү汥idh>k.I ߂>R.,ƸxH4ZcoEw} /bTGEgee;?`CȟKj{wk 2i4P*E* ~]#n$`QӪ@&:&̺6'㛢z!s_# ^ .>*V{Dot%fї^4bz=>M <pJt oȔRhwh,OիWJY0 &xk|& o"G>1|0z zȓlT) xQrn{}՞XI0HZ. +%|Q iԪiHm6!+,`Ay҄mZlVG^1)T$F1ELelTV)smPNIeH f#t[4!}V*laeƠiGoiX (T,^uJI*X eũ1e :;z/[sܯ(t Xg-A~&Oi~^nqǀ•'Kݵ2nnlߵ0t=L 6H}%s |#GΚhc1梞I쾦9PcL^Б^hsށd^Cae4zHn!Z\lK1j\ℽ^AkzmiKX{ 6: ׌՝ĵ+\a#w)ۨ^4@AYiƸU[ Ƅ5/8Pax-H]*q?M&&DaR|}PTC('n 䴲ߕ@zw_Y>-"M׹/3,U!UJgYY(Y`yGĄ$@a[rT@ͦbQl`Ÿ J_R_lXNo:tqƣuJbFY7J[M[jagל&Mor~)8ەaNQ_طVwDTpkS߇K2 V;]M^:|jvGu䥑DHȡ^)||dΌj׍.iz%zCkjy[XvXsq8`'-i*\%sxaE;qRZ01>_Z՛M1 p5_ >XZbl-!DxPGY+ʥpoAlm ۪*`Z+-:nrFvHO>a?Jhk>z::4>;B4zbkifNE5#LN=i,P閞adV+$"=ᆔIհg6 )y㓀Ζrup{2FaT-'0nE1~5hKK@4̆{mt@Rtϊ2#Z"P{V[r*T}H5ZF;NVw島/6\6/V@$kT/&IOل9 _^iVR3ȑ4+FX{VfY_;9D}zij+m^vAD͏Zf*ǵ :KqrKǫi߭ADԱd(F+τ$Ѡ~zi{=]6Y[ݨIv6I)|@]ZHsmYx4 w^dDS[XYLF̫m,f /$G[ge #UpdSc 8L2jC{ `G?vl^5]G(H4"a}8RL~p_jSpjA\u_пD>I<i,1WAoƔdB mwga, Ƴ*Q䠥j=B!S J@E.-RBhݽRWCiu[*eS"YKvAtߧZ(Yh<U,y1[OOҩ* \5l`~x?$Z&a4nM,ۢ-1jE i%c\Ɖs_!jaS(iCCdշLM 4/ Z(kHJ}r hVF~n'X0BR^m15VpQoDr5`֏*{}{|&Ny+*'XV>füQ22x|x{.nqE9uVQ:{2 ̓Eηe ,Uܶ7g|BpݑP>%m*tzLEs# ԰rބedw(Nr,M6\Z UaNTCw{},UK͗!-˵KB%/5Ƞ=Fv:ɲ 8mb%Y"S]dӪ2b-~ۡWQ/j61F\tk4]V|n0 , C_(xG#1Mfy%U-f,Ik6߬ MطJڽLqCY4ek`X ³w| .VeST:wۦ-[lA*sDJNfEPˆaq&#^rv0&Q1mTe=-{[ӑCvvRk]78J> 1.͖8,Bͫmb̛ÍE5!la,6L5!y#~ D Њn@+iJOTӊ AJt8NϺБ L"Zex W[͌u=ω~p ـiVÅIq9NN(̊=W&5Q:n{jrShr4FIٮMB9UXZ+Kϸy"8T@Ǟr)}0OދWz)bs^$pGUos?R[~ehl٭g)3y+ϞvG#9GZqs%SҌ2o#p,kMˣxgAWS*oR1m$ݷ6 Kyz`$:QQG+]kuoi;>K6yZ)vcف'œ,lE݈qȩqGV3 }UMdF/:M dbS𳺄#$ȿTI.GGϏ$($-WJ~x.<5EB1?>Yl J*C6jx[fSĦSYzŞHGMr53МL}SF t`RłWW^+0)f=FV_ 78u#˖a %|ڻp~Gyc&dutZ$%E'p L#ޘu5 t25f.q?{4w_?/6?΁gQ.ET!C_ć *LD`+*k*6OV@4v .x xπHY>4Ds0F(u_mk:^Ӳ d?!nˎPLJ=eyw 盳ҏZhTo|Ъ M%cLZ e'>-?>i8hbZo,l!ymqViwk`5lG]MS׾lw"b5tVwGC"jgjd,rj+q?c%dD1˜Dh&ZT<9ezt3JQ]}刔'w&=8P1G2'$.Y{O>@Z  dOJ&X%EWYYb~@Z&Nv5R_bXKr⿧Fܭ9V孨jo :6;RWJsC2"EDF f0P  ͝J< ٞ_B gSc4\GAI"WaD s|$ wهIDL(I21U<.-6CҤ[V|u\wzLQ ֡OOPFbRU\7ӎ\N,P gS<>mI16k$7%gn϶mT<@)[SטGZ bEKUEm^U!Ldna_B^_4J[KK^Hܱ9l1aiF۔ёL8Kԋ5>[Y"*Mcfa!HTFOIK@щn?RԘfKFn- ýFJ˳I][^݊qXH#_e̕zp+y%M;uGu-kq>ʧFv-LxWBu8_#>tz(롊阈R ]iQ{=Җ3 M+7 bl:lw nHZzHJ0_7|B5L L%r G Ccat!Ya@ԌcW0Q}L f*ѿ(G&&^y\@OHeeM^~-yЛ U(wc!S5Q1pe&I ghNQ&1WH>M?2ƒ5![J~ukKl 8t,6.M$&bͫOkpOi}f0A 6?\t08to%(mO%B09HyV?öcM{w132^hiH]XIhD7=Kٰ=+qV+I;? BJ8%f!6o0*JI n=]xpȉgR4 'Gզ*Kw7}__nϨ{G)Nw&pY EYMq[=x4/tl^N;sRAjSO\ޣX4,K#VGkYLUkxL})[l:1D!e7 /!9SK>)J6ml;bxDri4M:M ӎIA7YytT-^ 'VVMux:$X$6ugjLBk^Ǧ@1l \8Mݽ1NM[֧M;t֗F+q 2w?D(l{ jЯ@e&9uU( xIs'5ܶEulylH%εmtXDŽz;|e. |oo~M8 m   =qѳA8[}OL;4 AӣFݲ8ԺrqQj=3f7^A-68f}#$^u87^h&xTW4w5_-r3NQOLPrX ZeQeY^L4dhGDIu :n>4x ikNV&lcvIT@xcs&eNͬ81ߖPYRqI@6-rE7otYa$6 ߾jCS"$r`]>o3Tln-aD1fu ٢676\Bku@@gϽ澛wSng+0 &j.n(fҚ 5~'[CCs{Ps2A8]8-IC2}Y9z!uLD_޶ՙk;V.|*?PŚ꺮7"wz7ܪ88<ijr[g @V5ba4wSլfM&0̇t=Z;v\LoCO(-ZPQ.הtaU^7kZEs.7tB͇wiȬPPgB!W90nYiC0cW@oHC7@rAzi!1X:?-B1ںXV5`^ʏ; ~HIg}5XL5; O]Qz__AG9¤KD!.4>ƩmgK+PB+$yJ/n!Pam5Se 5*Z/$!Ffh40`)xB*!hT mh:)g^{4|c32,<.-L$p(B QsxDg'k58C=~c_Ngq@\l A>Þ|]46zELOێI9,(=4tX!ړ<"Hgy^:NJjM Ѫ`¡EsYlڴ&|)I]9|㔥Oc$aHoh|J4 xHâB|6B˶cX8CF#|fD,xS@f~Z!Ϝ, V0DRz(|]][gL-6 :H=`O:o,氼CU Bm(Vdij9B4kmMI8AXEU]n,T7Ùj"-4NArwj iWS>&rJ#J-ڢ]hHLjj|F~:e)IxJҍ7@' ҩ_=Hsaɝ)t_3ĒO%r |^ĀY"ŚSY7xc@`Ly]byb/٩Dl}TÛpieYe3Iq ;_9$#ߍߡ.W>2;ޓ{ڃ_Q5??2hYj'(;"qS j|tID1x/I`RÄ"&P:e#=D°fCˢuGҋ= uo{=ii|ӤB_6"6*Vf.Q(Li_(#"^<dj=KmFA"tNam [IWmg^C$!^❻+/LÇ A:/_KN# <3 DoҚfM/ x{']?KO N1 x~"i 9t}D ;Բ;n<LA '?jfLC}:nרR1F,U1O*$0~lޛer΀耔/FR )k"ƚ\AZ#gyn, MTʶO؝f|3L c`K.ߌ>Jw!g%hYS]{X Jӂ5`in)MDlQu1cqoh|o|y}vveu;th״*:vgM(&Y=S>f|g.)")L!;KCPMޘrGȸہFr#B`Bfk`[ t ]SSI&~ѿc /Lu ]~goF͜V{p*+3I 8(0Nxq^kq]Ÿh@<-1|<(>R[5<y6aߪn H*cvWӮnA$ Qp7z4R4?? (.ƶw鰋 99XFk6Tqvy ^s8k[{6jk4q?\ŲEkYb]:L]>'GEY1d"|ȴz]N`](`~xP ƍԫg[FJUJ[SnxT.7ʧNv֓ȫSHŲ"z'HG!T3a XiMI{^5 F {%ds}tܖ8#"Y\_A& Nhc[?~S5W7Z]4WwR,\>!-,DdMFF4cQiЃ髨ƹ}=UUiLIx$<ԯxP߈H|?|m+,{jٷpMsv@CEGY-D0+uVɁ)ўNKbN㊠l)4;Zkx7TeG]~9;GQ20,}@T< kJDDm_@əl>d٧\]0W ho1#=vv~3E;K\Q_*@txu쥞XAkhK*,$Ucm9~bٵǾ@p.GOndF: Oj"ӝzΤPF0b#-ʃq$y#R*γ{(vGRǍLw١ŋI>&APΧ#3=('mA"B 8Oפw~#'*G 4jac=i2`1H.4. OB>ၭ.حZ}%F{&D>,<qգoz*`veQ LFK:و)3J&^n^-!sM oχlƵӬMҌ=Y74A}D  q_%WE샪n!:ԮKMa MΉw{[E1D_TyVD:s+]CiJ*ɜ;DȤeKy0 jո;JPleXp ! cL VոJ~kjiM粀o^qŪ'l0V#U E3ʌ1[8HRI1;U,7xo=S,-\cy/zD h`6 i5b*#DR@V1'c^(D+Θ1FKSu[zj0g֊Ascۢ۟oĐ&{"ZcnH+_ͣkxQ.W12Uzá<'&W$,w6:d~~:#ߜo_8`kbvYQ*c9<dG#) Cν9Sۗ$Ԯ\Βq6;z2@"?3dx{N:Sȡ@3%}ߟk:38W ߸Xb3#/I\%@@|T+STr(w 7q S 'C79fh#!sՋv& :!+iEve+<Ow7Ӥ oՃ!|ÇλO LWb&9 od|||F3bS4Ӯ`x(قpf-{gХfM]A7oLkmx0\4(hܟ@W<ӧvߣ52l ]qq PC0nXRƍz0B:v#[4:ePpn5Cp?Bpܯ }D2`wЂ&a躖UQU&SE7*G|DjϝH4 zEj%I4oߖc̜[+9 Jqn(+KIHEy8hDZ!dh>}8#\FlB8lH=bRr6f < X2 3|] 6L"ղy %U,%*U MѝJހR f ;٭["4l!4TI8ֳׄM?R:WR #3fRѴNp@֮e:K=1VM3s7V+UǶ6* jTpo©Y,\`g/Wzd,_Lx'8ˆeT@ףlwVSf<.CR`-F7 }N1p>=(:O6Y=m'̘]Uz =Myz5 'SUC8C5=t0/Ŝ}n1|ZR'5' , Q.,1.O6O'_>Uw'& \| j>1+u=v{&TCEbqlٳ Cz:2=UĐ?o@h:B>.䫬%M^76ı4[Cys Bi&Ë~ ;Q Z*v0H: 1Jog6oѪ{hdKeO|fR%tRLaxd~4k{$1XIr5RabDwFXKto;POݽ%4Kwvf .r=s<4+n>,Ѫlk 4*.(}mJɃC@uP ]W(0Ϡ{ؾ?=;k̨ ~\Y ,wo!sfjb`q͵PY'{ 8Nf@1Њ"m;mCx<ʅ4&h!d( <u>2EOKIi{[7M36^557vSa~{qMSlW](m-whY49(D1hP܎߾"L@C=VJs^#kr ] cFDLcpSB5SZlS}{kE|.AfUIdZ.O **> 1Z@!= 3UZ.oxob+gI=Sc5L`YD|۝jQ/ T=^j=>LZMjP;ġ|a4;+Kc Lť;緭pNmۡA9Rؘ\_>E~L@il3y1J"PҖ=m"(F,xjV$f x%׷(L Hx0Ze8w@ZFd()Bqx|xx̛hTIm`e#^FӯWH Y' ?צe=WjzՉ8+"J)ixR IQJ|aT-q*zbHi]ֳsM^EV{N$?ĂêḬF:]z5FRG3] &hp124H m3jUA ܷPO~ Lg+hz^l*⧾Ca&fwOe}$ȆnsODh&ۣ~jVoo H吚Ms9ꎌ,݈Fo8]ZK:ۧݫP}tlQ+/3)_H Qd;Ab$E+*t%%MZn])cxhIώ8A-L5rEG[ѧr$.r-,ܛBv  ]ck`{܂1M7Czc7JPuӣ@0Q]uq<=.@Y-G1QMTCh8X禙j8%͓puɲx+3ҲaDN"of<<ՑNݎW#/RF:`9bR>R,:!jJ^ 5=)Z2V Q^@(cR!V6ne`דL:[opщ5t屰kbۣs=jg B&м :3|tW.|P|2ݚ*hUL䑖Ht~ HmQ@i{/Rw4J1S٠f-vƶN$MCwJgn4#s60YX)¦\+Y{˕9, :mW [S!VB!qQoӶhtL\2DNsp J:(jDlM==mqs^J?=7tKTp:UeN@ccpjuiTvYB~§l ld"RkGQ;sKX`٢{68}iA!aEVәIvu.O/uA}i:n$ TQBMJeHnѽN _phQk_̓L^7 D`2ApqWݚS:AtCc9^!a C9CPaEǾɩj^X5S8Ҳ$>k d'IsܳVAN7-a;sÔsI˪o:,?xul{.(e{NEY 3-_֎:&a8^rzJ$µ!! h$dւa*fsav^/3|E9@9աp׹&Bv'7KFyۗږn!6='B.iԵ:(HRi~"LDe//{llQUH OiFv9Kāza*.0wYXA`*erXLuU Ǒף%{hۇl2': jQz29H@2kЭͮK,>w=g5^wׇǷ5]N1(\ /}^8wKf9&sH\ozf)lD}-jOɺoO\6 u{}2\8L+6MCqyfJ<_\qx|g?-$Fn#>N+UM}٭4zO֕']:F,T=K/XVqJN.jRLY_>kخS8_7̘(y@=y2=TMsDyxv `./"{U!x'l+|q0.TuL,afQ⒪'ٰݥ=S3lGe5A3,3-f{)b O[0۹ D|}]ۈfc'hGy=: OƭEsi)ŰٜbJAkBEt_'lkYmk2v14˅m0L M*4QlbG=eQ06M-ʘh϶= 1GHiBa*+M;imǸ&Jgbvқ{Ctueց"-h(pN#Xudj N ^϶MrU~{Np)mZ;΄gnkv$& wGޏߦ !1,.G2!MfieYiZtDi/l_R1}D_(DEYO!2wP6 g};Uz/gU=H6B烰s|~onBV pk tc(.Kqs[%iZ[}B.WՁVViǣ֓Ձf~4H~Yrr_y ݋>ifr-Lb0- k1EE< >&i8M`'yJO׽ϣ r<9qm"lU6y5@0)J9$L|iRpHx>@5( @^w)Ae p_t>%vVk8D ^;ZE?(`6_p^E/ e{Iz5M+ɟ2QZs_lsiede=9.9'Qt>MV˜x|{%hpvzJ+l\r.`29u:MF/} {X5ZNuj|]tF>JbYAV&%`t dD86ZwdTjD؉`1'qũ5'VnhUuڥNV V#ΙwNH"|3V `PAͯFˍ!! 6ujAbT%ej=yK O{XNi:|.cb$nN4ڛ p|6. ^9E`/wۉl*ja~V|/Jr$y(t:䦁۞y(%U#H > rUB]D3-EOBkWW s$EkuUjH{KTްGaQX1!jh"Cv '])xM(\mQW[) fZ4HajpdiT{ q~1S%f# ̛ AnmW)u Hk:S(Tx:|+otZiQ!¿ |+vO53k/2:{9;s;ۺp4h׷CPȤx;lrU'Vj+d|zq'=Je': u ëiV6EAV~#Al& āĨntՑ?Q[2Z sR\2w.:S[X_aXQhXjA#,MT^D΄,!lK=ڄZiv\sfNsmr7 ҲT+Vn0t{@~D\aH(TJu͊yK|i}H _; jlj;>^.zCǟX[x0M{ E7c˼.cзQ'xI J[4 FGͬU #Omt% 6,[l{Q2j;^D(t4ea'G\CAT !Z%M5~ȫ金2Ҋ)P3v.<>C.^MbA˩PÇŤh"Qj&wL􆝔55x[[M…}y%%=;̚ !~0 ]lVL Ӻf[nh%6kHV:V(=Oĵ>~)WE۶Mz,O ?Nji$/VZ6 ez'caWjlV4o}EE{khB-cLT}CH-xb)G632GGJ=x(dq3=dh_g^r$/TrOM)aQˤ0`n-CݼֱZR,Prϟd*k+}3wiOK{QWYp f7w^+ECpgz K( !0PPg`y՛e[!^7o4Z@P$-|)t, Lv5x*Llv srÉgbaCևat!]p>V֠S0q+ 4=@ro+6#+RthI4ura-P)bj+k/SUB"ZQ´=nݚ8B 6傑 3{;A+(AԺ-ԔiB5~6O"!mDS7 4;J_xMH"Dtl+pFZZ3;y(4oG Bgq&ySZ9E=uj~ Z)\-(X \G zݪOi  tٻlv@e"BV:i־O=@܉@P&]y]ĭMkY_f= K67`~9؂烵2Z船ζ^7a@!W4d@ÕR1RtZyt (|jpeCoh@aBp';- ™-Xjϕ"uLe4vdHܕ`, 20>. 7L#N)4:Ͱ.}%Way++=zp;Ș>+/*%!z{`ܤnZKYvWLT49م=k89QpU=5WBjifUlɮZ9imon-5f(xH\_UbA8# ;A r[-,W I$Y4k.dIQoDoJFN`ĬP:)R! nEaڃ ?s<˟_O}J񷑞7 IVf^}n42S٫RIYR^F4 ܏ Vf1fUGКm~D\t#h{rˡh\R&HY[UQMfIA9PnSg؆a k1*[zVӿ 21ئ}weV Ib{mnB5i.h/CuKw:,x:d1[O+']nr;YFA2n5t&V|w[ڄ0|7Cvz`J ")@VYh7U KC'-ĎuڵS Wqh51ojF;ճ$@Fc<̎,A )j[ GBj0'Ӂ S',M+_Q2[Pɨupݒ˞JADF!`@٬64O׀Z+tQHڭ=J㔮 =8S+!fٯi[ _7[blі xQnʦPG:tq?9o}xﶪa8)hx[l*U^+q֬\ΑH1')DŪ! vH&xҪM.m Gs?8ѡm5ZzS-n75)k1ƒH+f3GkHv3iISе,lۖf 4m1ʴ*fpzI4:7q˔Q6  +VHgKa0Zyʵnp)BݫOAu2ݲquVE/OW"h  i̢_aZvgJPy-)v?>;P#N/jN1و a oOحmF`[5A10pP g~Ø58Ǩ*ƟR W;FH`F)nQ oR!6mVa[qт:G%L#PYDB?>ӊu~Iۺ0^h4I_LI3Ĭ g8k1*&4*՘C4+"}&,Cg]؎~*(5Ɗ쇑NO_$ٿ3%5 eҢ8׼ܞTZq1%: Vh*UO˶dXWi# XA* gOM3t۴ʃKRl=C*9*ϐvE:ˋ0- :L \h)j+1IߋY*fa3w[L6D( FT҃8Fkꓣ~5ͯM<.;;'YS9fSHD:(b;[>tNѧ^\M6T_˯Q?T"/\!Gzϟsµ7K㦣^*7']c3VnSUfVsLĠׯF.P>s[V*8ZrKaPRX]怞QM蚂nê\/U#ZlVB}^@EaC^hT 7+retoE}!в::vn * x,A,)@Sx,>mI#5qhnYk[KF? =CED|.+.DhumP[¹oFzzJ*vXl56vڎe[$.e }.(b]2 M ݰMYu~OǁGkGx^(}0"'A@CmJz.[W44--;o>/$K\Z7y$x\/\nNԐG[݇+)K74:5[to]U"j2ϺuHCd "?`?Zbڊ/{KXpG 5ͬ.ƨ+cCěi7!2\̔R{paY)3c/mҖ"Uo@sCA#_\dG5|:EE[΢麦o&dGJA eu_PFs|^ʥ4L`l~L+xv%F6zgUz\dCq*[0a)<ܙր"5%9#땨9r@T?035hᮉ04f̺n^Ј#AFXӽFmS{9Z?(3t&%},ne)Oq v:Eds`^U' o|1s{\vNA (TZMOMx65sLcOQQ]U?$GX~9e} 3h3P0 6H*$d#tz`GGQx*Jh<pYNv2|Wբ ?C 8gcBn(0G**~xrN>¹Nc>f=ƒ^֜>g`$58VVegv5}uh^uڮɎk.ӻpoo]B>FX}r5 D@a2I/{CZt:r~Ӳ 8 FWK4pM4*tCzk|hSc4NkHZHd:33p ,o-9d|%|`n\RCzap`9&6壯q9l1YjM`cbΤ;}Iu1$246(:M$Y}ԜT{ڠ?nLYOrz6G-. oܦg%e~pގ"f ):_2_(f4BGrN{/m1<6NlpVĞ>=x[$A\^k U]B0\wpbHQ(}͛<=qaOVy6'Ɛ茷7#aUvTR=`,e?um_ƿP-+`A 9J-;تVn[ljY?](-t҃z:LSmt&Yxw#D#{f%GΩڜȐs$Gt;878iۮ'0[yʐ0َʓc%&<FrN>736q2nu#Ҩ} 1y eWSE Կ6*+Σ'!-KhQ+ oUYn f<<1Ȭ?- l5k܏.b]nQ:v(9̴RP#]p&1&RN=ưEQ3;@s n]66˒OA~#yVzl=nOey1ܶR(zțdsdkvh#vRԙύTWskTҗ⥅z\(G}M[ $ %^]KfwfnE0)#餞Nd鿯tY8;xzkM6s(Oj<"t>(/Fx5ˍyo_b_r :`b^i7!m<r ? _U)/C?tjPS', N5JpcUlzPr!=vSw}ZuZ]]-,n {gV9Vq o=. \l3U'~ C@Qo1t`s{Fܨt CJ*vz ` -)kЄ91^.q@(BwoZe5E:l"1AS܃vQB}7ySw1=K>TpyIqNUy}pѽ414De534V6av++۲},!:E݋t|U|L43o0+#}Ϡ4+VawmrͶO46;H^[ʲI8<Aii+Jbcvٞ5ܺ׽7*Vr]B9t߄Ebf1ƳS)'M劣(sNx(jyBa=Ъ-Γ^Y eTC koUՀg`Av**#Q.xQ(&%s*5A[t7WN$TVA ՂMҵ J>_&i~8w;aه~eɝ1?z*>,-*l-?M:i[xٖkW(p޳{ȋ@)94Uf[Bi[xQyڞN]kiCr6,c^-^Y#C?KI%/ K^ zL]վz^q[ER}˗8Z{TFeR3Ϊ™z.Aq'mm8[i4~0I#R(w/Kޫ5K+Bhh@3?e+ݞW;\^;w$&fR5x,ͤWN,Tn[E!dW?uՠ|eN]jE&ewxW>e &$k^tFccK$6tsB185=Lv,uo9d骹TOpa氖NTw/'_/»B  X~<54MOŁA}b }3OpdW} JWLS^a6tCvۉ5%y$Bi7nXc\A+͋r9.%;*o..%.Lj<敏cs4RB,1:b30D"ѭ.))!"'J'!aTz˲}zi6lEߑc45ֺkܑ>rߦ%8Y 6x{X)WWEVğt\A]#b(hk'4RTÈ.:A?MI=}\iJ: [GMoZ/B<, `Vm#=Jz@ryd!eAHZ'_n[,oD`. -M+.%"TQ76'oҪwo+ԁlKƬ$23&r꩹鶥M//Ulm|^Ryr=vւ wwѩijũZ_mbkyCNa:(OٳS w>$*ŒK4%D i]U_B?6(vs:Nhk4ÛE{pPrs8}"U$J^,\(N6 0ܞ8FVo}yi|aU??y~/DeݿO$O5# iҰW'M_~a3C?v{z .zNhQ_In$9E:E^4tcX,١jZ<*ϐ3q9)x϶L\* D*g"꥕5TŶhy а n 釨Amb6 g@x }6h3E(ݩPi؇)tM:]onɶt6_Q,1]SJNWF{eEŃ$skxjf05FT7rbDv^--g(4੗qsr}?J6 e544v;(X]-'^96${@-E勐JkNH[l/50/BA;oWlZ(lmHcD$η0LU a%43]{_Ld#@+ک^']SzƇnkӋ6h>jqHrZ[3h[kU;O+߽K_UT|4ՙ bz 5kc{pͽ D:mlKT JDm=QĨ P&TEHG(Kd kK z0pR U>AEQUGȍހsJRVol>5Pts8w9y~%lkU$4ǃޤ Z|}Y(1PPM?ل S+5X6~" qpCB@0([kTRpNMMl u2_#,Ϧ/ԠKH?භ)$:)wb+XuHpF 4[oVr1vpVߩmLXSM;䣎U a%_I N :W0d;z:Y:k^/оohWxFq$(;= vzUggyi~S \ϗLE #֍%H>-I[e4R*O>ԀXuwKhwB&hb5>htg؃OuWZ,$)΍q7uOr<5.B?=7M{P#5oE ьOÈ(pkfpp}%hJ&U} aʄ@PbP(6$pX8 >’WdJ΍nzsf1?10y9E6t׆S3?I_f#?nl%:_]ݕ( ݾ(GnL3T!wzVt:7Εʾۂ,69m^x akwVO⳯5eI_>(DmsiŹ]x7sPm8\aAHPV;A W S<9#ecF@kfն6jCZLPK7֭gШpJDtZU/V ~ߵ=ih&ZK]ц9.:%/Hr'䵑KA,S'Puu%LLX,MZ| A@`ztG }љO3f\>ƙz*T@Jz{w l%Y=PH>woUM 2%nnσ L~iy^znc X1 w|G_q[sߵَǨ鑆Ǵײ qq)43O?HÉs è=JCyWRZ11Qzjg: _uej|D!W- ,IF1"^ҩ\$6!Q$<ˆRQSАZ^5ġAb=(1>,ڋ%%lGBVK(l{I/n–=TvInFGv7װnDn 6Q+iodAC;o[ľGFPk O'.M,"ƵtN믞FRQBhlGiO J|H9VS BHj3Z0Pky I0feb},?[8EDCKg .$Gt~KkAi4 1 ]Lb6he}M> &/w?Aqo?]^ @HmOI\K@0N-DBF)\//gSq$jFG]r I4*N--D"bhiX ~\*"Z+mſl ع\h3} L"QUrNZ2,5#.YRisFGUt86|j>}vB"K>:]ZS- ihA ~ c#KFt:ve\ &SWN0݂+eppSh(M|c.pDvqJeP{JrwiO=cJ׺*v빢+sg+qyXɛԅ_=%p2I솁ާ yzz%H :};Z-VpFJ2NOEye98iVN ~8cƖ aUP& ɝ2+HANr|,.us7ʗȲsM'41yxzqݭ} 1(J t~ab,f)|&8~fix.gvŒ^ɪе{do~~\u9?/e)ߟP-@Sb)b{sEQ6#o%F/IG;H0#p"Yb#:iÔwU\ᨂDs 0-MZ.gm5͵U(KSaaiNux^шϡ[C О/џY64 @xtͯVwz *Y5/:g|SqRP n-q I3U@1uohAeCByAF6',AKw$Tc"=eՄ􀔍j砾ѮU$d򦾜Qy "`]T'ǃ԰RmUTO}Jr }Lbz斖CxAzRyQ;NnyFO*y`z:k +QQ꤉s7Dv;xj Feǂ2M7'&۔5W*Z'*P QW^$A8ʁYc i9D F) ȑ&hjKݻN.eԸBTL7oS Tgp<ۅK 8`/_BCz k)5Y<=!JMs[O ObO@}P"񯉕OaHi>ERَm-iUa L}9Йyu0;ruFr2,w`(zU!vb|cS*ssft:o).!ȵd i/oI(k^ Č;n > VTwk[73 _9K7J!#+Ƅi~zt17z K"V4S[E %?oftx=siDuf oLVkO9U|[xۆF+mlY6bɵe4너r}’▬}>g0+OQ8&[[*/~p tF|~FX-ԗq,Jḭ̆ ߖ[Ò jXii,7bJʌn,C/vgj5~}Ȣ:YTyζshZ.0u4:hx?͹RgA/3AO-& Q;n醠ٜ̙ŝI8( L=j&9≤=W*)I;0AݮLUF,M`ԟI)}=!c3.x""ɝnWV*vg:N/JsAŭGJsJ*ʾK@TcXaxrK!94,_bZpW2ImKQm_Sh1\H`8K}jl]o^5}"/J{S BI wF9%HRU7!YÍ~bU'2`ȣ_qRыO6D<(:9Hg2o ^}&wdpF1/ CY#3+O+F kf:'`%eOG{DZ>j爖q!d8᠅v ˘NhjFaz!l^yzC!¸ Ijq#f<3ףH&O׫5QӲڳיq 4U?.ݘ~|'RvkSC,a 59"ߪ0qGlra=cT^uoɖ%YezN!%&[{on'˹+ѣ6dcEsJ9U+` si~Amc"W{WNȖW(ȫ)A%2#+ aF9/A;R7 $A 9Iq( {_0X8䭦OG<9]= XN݂8汉.|n!ݢ2{{;亓,v Gg4.]y%܈,r%x((J>[(֌QF9q3aWq :d"@,$)fs=[6VKH OVv)Ň5M7VJLFVXaUײvS=' 8In^mŌ >U4F3}ۻ+#y2y0բvԕo:2 6x|&g#0Ӆt2Oֹ5Y40|`U|=393]j͆U+spTUf1Mg:m:&,4ɼr-U (L9OQ&4Ya`mD 8 sTB'R?E~Y븳[1H&':sd~{KdOtixgK( WF7azW?F0iU]w\&Rөuef*Wgk f[Y> MK5xv 5 Q.ƍgasOKV>bJ-F*ɶM+:{ zRV }%eԘ`WZ{"nr:NfwGg>[uxz%=_3;yH䈡: _&P=K#<|8xL#WMW;P4+6[YN6H.X)8z**0(v>N?aV 3ər)2uJtJ rc}j|r/ +1wZ#6"S:ĝ&DqdEw^"$'+&|*)S ?jI;Lmc^š洦J (9Gb?G8RIYE!b(\9JZK݊O3bn1$:.JXR%jdAWpVNEJqU9%jc sĺ{Y-c88ӵYA@bKZEa Ӂ{tbj~0Say3':,}< kjoOOT:uQ{ߞ^Ahc6ԎZ*J~XgR8X ;|O)N.5|ks#܊;+w۹ 2aۂr,a{;O;y\M%n,ND,'ǿTq#Hp!O_&/qI[ 9@'(*;fB?(Dy^~Rb+Ӯ`6J8@SSփ_P!{.5iI?wNkemߦidG3tk(BBAEFohPH78%TLޛkN7H |,J nq]nj-~5=x`*:6o+y9S;j2N̾Ԥ\MroBxu"L%xהߜw|]}y]0ݽrEr̛ڴEn(LkxO۔ }킬ҋj-W@VݬThsߒ3RhKٜ~jWX>M(q'r]FK"3N]!?̸q w.֭ zUT#IF84ag-)P=?ހ57;=* {rRV5~L˨D:T Vv}--b~!ѹQ⭀?!unbm&Sf:&ڧ'W0D@ &Lmg = qL{$>&:W}`k0Q5\}'||AV̵?41M#yQqy6+DWЕ/ 'i;L\}"'%n!ߌ{3^6ߊ'{ɭWewAwo[F`W/qNtw:/ }K3QUd!IOq[^XY1w4ϲ+dzۓjg,=nNOKYLMv )}&>6Q^kozc<^`!KA^t /^F,r"5'dIͤe[gN @&c4W+H>ٲ?LFư1. 6Kܣ[JGhI4D.b┣r*oF6p@^~*^ZKHBzHRIOpPU J&jLJ<4 ^1&"E0*qߡ%'Rfi.&7sj1W`B%_hXi7:VA ٲ%n%fc$<"O'>q4&C|` J-/ Fx`gkZwG)(DQKoꊞ w`kPuZ4@JrDh ɇ`$=/r''8ѕ1I%24j$b :x- tu}xcqIg*>ީEdĂJƛmjtwe)&^ ,u~:qMoXuėmWg2O8tM#}i?!v3["*բ"YcFrJ>f:R}:w$4ƕmv6a2j ߒ7U3eGcAQaZÁŇԉ$F%`=nu_L-@t4fY| gdTac hp)w簥q't~z-2݁:a?[G֪^ʙF(G2n~o`ß1J{،ja;}o@ 84[˭rPk%v2'|I fܛ[+KsCv D =3^Cy,VSm/X#+IFK#9$Q2)s9t7Y@uTDlg.أeps@!́f dtݭ7}o <4lhX6h2@DbBq:ɰ"!Cv%ot ^Sd_\Ȉvcԙgz@kv̸=THh rj/f:UMfUw׻}qe&Qp4q9-dFx$ [jfCKtFNU rjИrFoxYtH@M_'xsG~n{AmP)h 3F;vVar;iӥA980T|-YҒ"{Y2Xfm{ϵ9F頍D> P_Lx"Mp6|)fK †Ҟ!WtY])Qsc226vu/\7< zJ{ǍN T4Z#Ij:nol!;ǂ?}JkDa,\ ur5d~Wڒzz5sk<^\}% O 0.Wlfq eez w?2͉lm\6Ӣ]P5+ ?֦oѦo#!!rYIL? fCOWbh͍F {5nH%F8Q lɛS|N$n-׸/36en'_aIש-l"Ke=J F<ok>xvu+1esȍy-r4\z%CgyeI>e†H dtu 2ŸF#L~+uE; v2坙\BavI- v+R͂!eB)l T< 'U+A49 >e`oxA7[iy/O;h%J|IP*F~jTMg:9F>/ |AWS0cy}ot ٰ[xFI.&517gڱEaOEk5Zz۱RnNX&8&@%y%S~'])BC[ 1@F<4ZcoMڛNIyVD&Hco6?ńUZ_6t*^@9OK5OMmK@{ynR/xEڴ K$katkY:֗k\f?G@ֈa u|$; dEl怱rڦYG8Жw,kߢz^3t^6Nz7;l-N瘺zRuZ#?#jXW–_g{~esҙ7pq2E?,I}fu ~U7}m6&ucTTa%áI0 c2++L$! }REK"Nx1 &DRa<% CAܰee:qO{6D:w qTbLKlK"ů`~'<1ZKil>b/2gڞԛ˼;c:P39hoQ8lj҃'@\{q,#eKeIkRg y+d8h%LZz6xvfb3y&Ɂ@*0b~2\AY'],ab&y&%?S2 ̘ǯfIG<ݨE OK$Jr@83~8 8I` o~wOrػi8 =L0xUQRn+9~uԀ* jlGQT/4s aBCEBq<ԑPKǁ~2IsUy H u#ʸ^+ uj$(ڗ*-lwq-_ o~lR=A,>ݞۻ׳%ONU79U:}d{m*ǽ93RoFh_)u{2\D?|Yxg~1aհCf7#wxN; D71NfάL i$݂M3VΝ eFx@꼥١ƕE-'~kKR O1[ן5WM^sE6{W*F6 nJa5~S< ]I^牴Q_ow*.oxT f ā{7'v)z_mB뒕Z׼NwB[w+Y4Kyf("fF{~B)08ja/S5juܳqʏ[|C>x*ZY3 -8mWVF˜4$ 7yd%V}r5S+YZ*9T|Dc;fbsgWm㹫PGTn b >h[ŰP_6z'{ ?j9ď4~'AMb [ztHe޺P{<$v+!VaWǑBM+$Tao~ ^fRx|,^ڈ zQ盂2FGcS@WAn\*׀0nK?kJ: ĖlC@dXz(Z#BxFXqzsP 1L||~W]If/;%W Vǃ|c!5!W)7 IJ޽GsLy~FIőh'D?Ƶ#gqZ1F2q0Mp~Br&fN jxLvty*\ -mB#r;I$;gxhF냜f#dgj0rchW״;a!o};#6R~@nGfT[|YQdS /McgC1(n[D6*60&tj2O4%0NRSZ(ulv\HCê;YRȕq1! ;=IS3.ܺr(zD=䷿o8i_-}$XNKlSiZ8V1 i&i1vf!Y96hdDAhsWGLY1 gM"xzJl2x՚9`6ǙLɭ5\½i6݌#q<3 MUḀ$QMupTc`762; ۚl`Gc"pG  2)A:pq=o"V5͜6Cjr;ÝI/zNup~̖XYJYgGo!s鮓 !^\n_a ^~~YZѵQ=#6$\ pD9v E؝"LCŔWF$:i+Il&ekׅ ̽ yPAk# ?RJÍlp[ D bE\u=ER[K%RǔYA2`>XK-eQt^ ʿmf 8ϫ-_i.a_>*T>$}+FR;QEXvd rify[ 2 G ̆Nsћc;C7+3вnӢb4&^laY7w ϙ}ZCgWG ,4gABi?͸;EsWR*kxl 9OcC0l!@Pr(ֳ_NǮR^e:D4е! eOZ)4< [ 3Dp]RhnL|f{vnU եecIc.027s NLHmyk&亏abLA3pD9VJ\1g;%98]!;Yg9*ŊyMsu|~ 5툑*ق$/iTm{*m=: @n G@s0L`VҫeśM dT}v,qj@F5ga|GX%p.G HcKVâcw@+ :݊m6^(_vZΓUr8eTtn-2PP˼aE3#/=ʒAbM\% 矒8x-m\y1ģű8OxS4*\K,9i=~Q~yY_)r>*K*U[8][Ԯo:-C3 9= 0M-[̷ 'w>ۤrMN8rWP:fݓm+pόE {Ĵm~*m2F%<5\laZ'^F۲\~w:e]ӌԓm>g@q''xK}/J3vC|Cb-!M$Qg:ca %K`֒3)]wg~F`y(9h?_?Z \ڤ~ r0dyDګ,[ ?|q81/^2,P DsMfA1Ū@G1QSn*58b!h^'ߪAZ(ɮQ;||CX9NQ:QAVi[h'*YnnYW\ed؛"*6M kyӎƗGcqC<@{o4g'H+,+~{Y!JΚN QeNyxIϹwJbhK =zKԪ{ԄmRɮF%V@}GYh{jpԕP'z{\kݼA04 ʠv5 =.wʕ$QmpɍwH?ܬ`lI ށ@-QVI=?y rI3ش;QSne'.p%Jy+1jB֕ɳm֊Q?#Z_Wh<{U4ߓfgd.i>y\09 #;F6T=wS;IV+̓dPZnCgh 8㡿SI˒ u?5c@s J_#'lrui{ h~TcB.JQ0MU9v+|[8w+:vd`"{Q}i ݪ"o9/tpsEbLM` UI`iauz"a9{lqp-?&50X%! -@Ht[3V ϿS!Emw#dTZx0\hi0xK:jua]^=6fgش9htHu3kJ285#sim| ziE&,V}ĢE#w!p~mcyHGfzrͨԼ\Eѱs`\x=z3p5 Uĸ3qhP {w\6r"ʱǓD$B˳9"ӥ]قuF. GPm/=26b*Tץ-*a΀ X8#}4F iÃȃSAN CVύ2b #DˌLw.|m^YDK%[{FKN:5ݽZ(4TlJX{ʨȰBU]Bfn*d>=n;d u*l}AZEmtg!f@3.w; \"]^-4{ymemQ6-QcIPWT+RRŌTk^":X9V,8ͷv_pQ.ځu^{PbvKĽCsu=s-GM[ݡ6IԓW'] ~28BBܷEuP Ru|Csz=m_``$hBSIxFxڦDF]ښrX?# K\ E@a?L'!'Z2gޥsu/$rw+ ͱFLl `C+>򬐪JaO dWu;9Eխ&;`Eb;'o]998Q▛ayΛu ?[L/h@N`J9u *;_Q2(78[ϸʗO4f<5#8n a4G8àyd/>sGdXZWI_z|{Ftg':?H̰e="_w{;Lb,]߃-Cy~mI/ Jn3: З' Ray8? p[dFxa6 ^EL8&,(_S5|޷YUDY*[@SѴ,Y7zC o,,^=?4~eHyn~In- ɜ7vvL%p%Z`:fP߃t(Sr9]je^Ah ' mg|B`Đ_dSH;8ߤh@6Hw)&_SmS ,_bJZ9q%Jܿ qOfsMSfY^4Q.}߃!Gȉ [恊\q52}!F&‹AR i}Փm;ewAcbCӽ "_ĴxlD ȱıʹa,ly$CN=ꕖ;X %S 7Pt'y9~ٔd2Gf^dJ ]=l_ Fޕ- ,%j3yjw!u) Rfs Jtt ZHWhGChL6M^ʆQ.e~xi M -^ɱWnX̟ yUeVF _ړMRO3ɵD Rq~"Hk7G"ۥϚӼb{^c;]6^M|hxlr|ENˇl`YBN+ӺLU\ 4;MY9W@EwO3\^3*E0 u͇Oi#4М#o~ )_e,l;nַH=&kѠ0Hԩj˂(@ ud #\X[&A\½auXؿ(!vױjVǕo!NHWQm>må^YAfs(]_ON A>>AFysñcԘ|uv!ppLVV~)SoGA<Sfv|m4$ uIv:xX'-޳}bލ0|කo/K5&S. >nQϖZnbOrDnNm=AŹvqG̀NO{U5 -ʵ/h~)I32sEMNW2l34y6FU{,AH14ti{ojEz>>zojSGE۴7ɮRf5b0iJ\:rو9L~+1 \j4kv㮳̷xp2. ^4qW4 zU 1pc*-pUP2{]R Q~=G`dvRŮķSi!}H"f zD=&k7Р z=L7)8Zצ_PŃ7)KFlúME&8͗kXd~ÛI|OȒdBFB$M{bvNbr&T8Ŭ/*>ʧgQTf1. ?%JmM٨m\QآZ`åN}Euu*rdCJ/o;=OvٳUH4"C-c6,rʸ +bu0 ԮU9הJL6\|'s-YPjEc6.@U nMLLf50l0B$Ow/'뼜0=`ŕFh;= 'H :Bd-#L=C-]5 cu`ZzY!hӇ'4)g4Mmr[>й*aJGsxEL`4hmecZ[huGSql:Hש{,Ps FeܤE4ߏ $ VyTV[a򿍕nK̎i!Q 1I%"pbD/C} tBAp|1tبXK[C,^xɇeLe/2K2dsoL]J7*C`c9\4t5qNxh(wgn;αReѧYxԇUfV(aud!}e'e5M#GM4QP,CRoJ+혚g3%9,su ˤ1\smpyƐRŧ⼁|Źh푵~}53]+l΢C֘ihIMemgɝ]ꐛmhnPߓuҡIOJNRJ I &6ڣ ]oPuj b'ZFGuJ6b'+ON< 4azH &}ߒaF%D6%2H1e #.Xq`Y9]v ƽ0QJ嵶k:1Qd$̠m<1'_h>fG,@Q\RYb@X%LtGrd9 Ds ]@~riN}wBfE>_; 2Lw?DC1Ā-ge /s&K$_91 ^fJ'f zviG,='#bϲorQ86s~zeT֌n7G-ڇ|IR6_>!1wK v{<Uo+JihK-Uzj&Epi<* V@XpMo(`JVʾ=bVI SCь^1 ~c=9d10 sf8r u7 -w;ј5#l;(em!H *{4Zn6w"1d6| OE.T1 lPZƤidMYW>a>nޘӽ;ӝjb[އdݗE5kxZϻ15=_Ic绒(;}?ZwTPorЪډ(F6It_6_eYZUj9ɉS_QW9.|SZvw۫5ZhV3A6;6J9ES*9GIJ]4:\ ڲT3yl:u,Ydg!rK2_m&ᘙp Y|%LB ッy5 Qъ;֪`C\8shBYBN$Oi M3F XI!NZtI"չ_|=fD\~jxŠ˿'h5O!̓U_ou#EDH4TK:}0 ?X$to8gbnkX%JeնO⑄)~W‰% Pή .vO iE JTY47KD>$fאgRFX9 b0ό19F@=?9olĹjb*,7⟐L r/UA=R5(̋: ʧḗ)Aز˥!5N=seŸcv Ws#cY).{.¾N~4G@k+KfsqcUe?U~XuU:|nv,NBFY"<*vMoSo܂t3EWO&rC/hs8 0^*3*yEyCObƩ<]֜rF[ Qq!E0}*n|ɁkLY-6-LۯOԈYed ۶-XZq\ڨc ๝ZJnQēFݝެYAbTVH? XӔt#I,~7G6=Xbyx4ǁtڂ5$ݝ;=Y \8szsy $kPw#?q(+i|:eQg4q-.e0 s}j ^ѡ'A9l:~aPjM)gUT$KG(`Tlbʽ]_:EeA=9nT!v*q5&݄/i=ӗńX%`5 .$$y>c/k<II kDwv})B|lSI"Foo#F7쨉~O@Fd7 6UuT0`Pݱ>6B{pRkhXua(9C}-$S^F='FBM$n.+:EY U&RVՁѺǬt=RnhnRvq>,_'{?DR"Wmˬ1µcnXF=N9Hw&IsK7r16 7!ay!?ӫ~* ~Tknnk䦆Q٪c6GZ9׽nV ^ׅW9޸c*4[NrP(ÈP5rbw@ 3,]q(w|j^} 녹R!"= {S5>Wґv`?5Cj0c(:,]䅃qDL4Ki6~B2vgMrטBӸW*\Q{{\ũ}xKGqtzhE=#C8Λ[pqnWTb*Z0*BN wF9Ϭr&6q Rh rq|Pd3up⼔}='DT3iA3=\')rGv6XtHj&¥PYUƬov7/oSѣDO_t`%JM>U[H`0X}duOUylRR9ߒ*uFʫrzzD"#dÑKT /#qx8*rSg^f%YRc$xv%zhfoMڋ\Qk}֤ }s=˶xNI6=[$ᲆNfadңxhԊ 2|=$rʴ X$oM,ztj]-S"zm!7À3d/iЪ'QM,ܔ*k)<8}x[(gYcivBOUBǪ{R ?)w鄓zSRe{ c4F%T;_xwGhqv;1GqÛݨ:o@Mu\elS{|⭍=ɞ,-XL=dU-(.٢}kp @Qq{ s${43л4fcY#h2^ \jЇ.7QX`%'+n5o܅vOO8W mO_Ggx):˿P'qrИRD4"u._;D#y)(]U^Vs'й 4%.XqcFiL`M1X䅫ViVF N{^BLhHYqQR*]-EEєGTxt'^xJR){޸x }{PlwdQPXj sB #}~T%Ko"UVfOD>amѿk4]yR vw |gadzn&CrxYn vFžp+,Pꮘ;sxቴBKÂ،un[)הl.ҹOpmov}h| V66MC1z\㚟0Ǝ{5Ҙe[K%Bc/JXFo>ra:ܶp[ϳ{ mjh j:Tm2b} "29.՝sDz߾?6`8̙L'(c:mƅSɇV"ϓgJ5X0GJk}"!5|0HG񝏤];ug^J fr6n&<OZm>L볒h|A-%ն7(j1jBmugfrӛ(چݟZrIګ̣ͷ-1bΗFĽnIz{bÎH+7~XDugZ¡._Lt_(d,"sĨPZ^\ B~ʶun ]we7W%!BXXJdvԓRg.}~B$w;M+ٺ3&xӬ:^% lu4k9ej8v o@Rn| eͶ8m0CsMp.ʓv=R얌b3 :U InJUY%N"JL3h:V͌_2ߣ :[VV촣=s, XMk$9ڸ > "eT% 8|() I)F\RH҉/{X^Z=!,%O,"i,e iL&j Zlr^.jsaa[= V\Sқ \%. |ovwSGST=~\8{cFT^u0-u%Lzg=)C;!PzƬ7 %vlϘ碿]&|}HXh.ih%q4Uy 7~1u@A|/<+Lv|Ε z>\2z}+iH]&);qJgqgOKz7涎a9|P¼0а{ d \ 9LQ`bVr㨉 r ,ދ2O$\{B_ ޛϓ &JnkIN NOt"w4UV)`]u(j9~UyCNPQtIU3VУ_f9{yVr8Mk5+AebJ+tUv E'W .握?`P q3K]Ve&I2VlT9-)](5NdcŔpӏ\}zxl)y(~XhpWE9|Gih%Wņ!m8ƒ<f0cе~ nf-LY$}-x W"a$٬ ^2zC 噲J(Z0e"[UmJr9~Ywg: 4N:Q՛s+izC-!6\crFA %4Yut+שǥ 86.Gve-D#dkVWbw{ӧs5A_ h:|^/:!ޭCVhJ~Ŧ7f 2QnRб_:RzR$U =ċ6dBWk^Bo~(a Wt4b_ߖqoଇyuGD N@^SKýwddCQF&+%LziMt?/,<XzGq\W #o7. ؏EvjyJ'ҸzYJsLCBzqDDЫ0=('8{c,&gՍ`o.qw!o0G?90W\>u%E%~lB-mT@RWېbkF6]F)zчsY!bJS ɢy`lDhbO3]B-&Aɧ! *bKL=Lϥݵ{q_I'?Lu^t Kj{EUŃfRx.*,R\FH.9(*<]OO@3-YRMov yU&AчC鸛*;";|`_ê)l9h)u8%B <&$ζ;WF9fz\+ھiXq|3m|D88D&&q]J+)!JXii`׶ŎRnֹJYEhTW yjxTix~ cwW۞fڻ hb}Kx~rjóͲhaK, C^ ֠Re~ʾNT 00'+*?Yǟ2Yr#ID tY˝.懥(3/D4Jxxyb>Li%el FKPen?,)ܼG}r/f]M-ҙݪ6v4n֫ŐN^gQI@:T'Vͦ׍ddžھB|_ۉCl5(lr\όwm6q]F+$V$a۵MzϳBO䫵DQS^A.2b[@l-y"?xlM U.X@8]v}m-UuC3k63LVDj7rONl/7v=& 4Y &b# VkTk8_~w]ML@UnbcP5p禠8m'֊8?4!f;iO+psm9ݶ S¥3kZ[7 i [4q2bMnf ȕuwMB`]_y紘wQo'RI?PqR5E+T괸jM&n9Spۣ{R.[' Be>,^Ok.kL$Y&?>=7cc"_enX̓AYܬ:wpHl {2_qqN\\;/HpqH6V]݇#g_p{{,ooA#AbY%ډl@͕gTy1lRI> U&'mɬ nE9 ys+]Y*P&KBO>֒k <g3בЋaF;8lB/4wo(ѧ/1J5KκM3{'"x:c_mIwwKY!uiU/sѧ |t&_ZMW: x}[ǎ~}l9!ms\l_A} ^S( & 8'3߰(r¶}jsW%C%]kG4d:6~8'?Sg^E8ftI6jz\̈́u$0Ց^/f%c>>,GGdo۲B!A o:,c|ru4%>L{rM =35gPHE^NN} ΠLXc).;ǥec/Srb:p2[1r^ԵzFHo(4WnL#+v~bvջaH&?hhx`Þ@7,8fb?n@U ܷb;Q'}N d,4vمܴE,QM!v9gDDyF\9X֣Z"LڥJ YqchR7m6@[`]^yP-X1S|!* Pah07rI֧GWIxģYxĐQ>f?qMH劂QTXlnG0^󹒔 p3+|JQq:x QvAb .ѳ?aWl8;u'a3m?pNm#;C݁TJ:]}u^sMpqLӬkgɓ2.)205EEvX~KIhIHTDٸ5E>xl-z[iavMHdV휦uظ];9̂bŌ.Gؽ.HnsyX={3cEƮK:Z>5^=(1w'a2T 8Th;|dRԲ5t2ݒe5=tӌ(e9 -SjF'0x v/{\˾}ol7m}@mYH[V CZbͻPkލ.@CZ\Kvݰ{l#*+YJW {hq6q쌏rِOpwP$K?y6v70cТC%p1YHG|Ӑ1G xz_C8t! 2lUav ~7iqZ?HĽҸ^Xth窼lW΋6 =ĽBd&u|H s!5oE~K%p4YƵQ^ 񇊄KHvwx)[E}[!hu 79oRl,*(.S%Չc[\M{Ty2_!9G To=* PR㏌[-B/'̇,;l$t{$Xɳ@H]X#}8N_ Kɧ" M~D:"%[H~Ⱦw7sJbYv灺%_Ndֿ,;j8(ERxUr1n@Yxvߩd]vF _!"pQÝ`{DPkcyH#tx=w:C,I+c5# RX Ë,AeEXfLhm#1\df9L|#`n'4RsmBxwPabiu\͞KvAWnah@ְMWIhNf\ǵBƙ)`1^Aƻ^-^RTYiT|]\L/yYk/t߁Z7(KM, 1h;8لRr<$*Y>TwOu%/zlX v)9M1LRE:2V}A~&/Ov|)FO:!9:+m3VG:CߪzN'Tj]5?V>Ƞ_[H|^&ReAaYDLE6Oj^ ?_ wu&5Oi ;9L6H||޽t>00Н5덱to'|Փ eZCCw*}Dˢwwm-=)Raez  HBzE4#μMby0A&EƤ8M+cS̟=~95|qEA?F+OВ֮mWwVޠ^q({<·3ṏu=[kΪA96>J87wF,IncG@ՓGҳv_x7_ѼRK/̡Iq. .ۛ!,-L f2Oiuv4?Im3-G 8#fjpm`cԻ{ߛ8US`5=v.սۯ`y8ZK YF-!nFCy. fDhjztDB\6\ȑ )tCYk-3~Ÿ#YT؛Sdf>uHbޑx}{hbXٻB\JBMc%y7т8>\Qm䬟y|控Y:Q>7Sܮ9fyЁ.4ЯD^g90%0sT.e*T@6Q]#R%x~97lgٍlIm9.(+7C^z;Hn)xX.8-.j47?pᘲ$`l-OJ'2fVâӊFCj%!^[+6u\Yie}K_PY( bmܑ?nեÇ7\%;8G|㚴PmcWW7{˩OU,[rWu<^|uqFK:ӈ!v.}p})Ԟ-[TXeDJ/O+WV:o66sߒ (|i)cs67jvJSUN- 7T xo7Pv.rU8eʋfp6 eF 5Ё$ 94J[)Kj`JKAM}fjAoF$]pj1 y_"4VDdعkx4i\UViwMRvMLic +l;ZYu4M;WYR^pEU!22+V8Cܐ=#ɨ@6CGG^gUϕZtC@;lכl/nFB߬2F:=M ږ"sOX Xn21SI3ivv\Q3HtT@rs.Snn &ZúMm4gHRX}ʲ|L^A+=Rf Y~F $GDO*>vwHUM^ /,.뱫׾1+0 P6Wri4ֆw? _LrMb#3ͩw\i>x %$#[ yHI/@ #VQznr鈴SuЅjmAL7a>̈́SǾ 5tHh-?PΑA}ft*/#҇в"d]fߜtž_(t6ZIuH^]krFܨ4Js]gu2R W<u"3nxn)J]=UfU'a9E.e[}})}^ H/23DLVd s=LO 55"ϯ7 5a~*MjMd_%42Ro+!35NAđKu㠦Y9 lOD/@(ZH}z-ˣ$W#W[<-xf'H #.kgzf&OP*Vi4yKlW?L`KmYKkmpO慒/$@MTX {P%Sә)\Jzʀ#}9SdRd :q׉EAaT؝R'r4Vr$[8Lc3[9P+Jq4߃%7wbLe9&kBAc.(XyIxfSxMD@жWqi+')&^$Ze/!R C:dWe:4@pۧzΆT}M%8ޢ|6CPvS09:\j2G``j+._ejD]ÍsR%q]~ǿ.nYxHg˓/FE˜wI,JâTl f̓w[QFOweC%&P {CJfkM N)x3\ $"a||`PaIUR6[QQdD+jN[Eb+L8k(*s]J%L)Q3s9Cr-؅ߢȆh@IJe4ԑJn kF1o%v+}dH~'IwŴi(!bvrK,^:D&d>_E#1-%> l%dދ4GR)!ɨ S_^:la%%Vύو=|p.cR[H.~r3fP}\Β%kF*}kL(~"i6GRw=up^ʡ<֩raDž?8$5}|R:OFQ]OBތqfKZi5:1SU-53) ^YIUTX,nCt]2nte=<҉vO(6P9P\Lq,VFSrP׋qgw BR)O|h5NPRl Fd0s 5B|=y.Ϸ."~{nu ,?mw`g lNvJf[(K{($ْwQBE1K $﵄ltBzN{ O#﷏3 ؙDGdSiNRefElǰ ~+~62eYOk 1d(ħO3؟wC&flhڠE\l)HߐK<3( ?Sz+l)MZ5|e&q r&li8+{z$:CLp_l%7M $')V~mj]$ԌCr~+tUg[qjD ?LX;XYZCxʑO ؐHw/GYU1h]|LId0{W qr%QqyA+VNWln nSدP*,J:UB&4 ;^Low&Y̠݌yO}@3}S}֫rouZ&oI(~rYvc"#alޥKݸiΊ[>ό؞.k^cs:ќ4ig+IR^a`kps4}E䂅t vG1={+?Lt6AqH$L?yAŅd>B㸁 p*իqvjMݤ;òoNTTC>Z^h;JYǎjHYi/*0VVI$= 7r 6tpҷR:WIR?7IvxY*j{T1-i8%xwP4s׸_PZ1L၁uYKIkk9[fԧɘ wsԦ*~% VKG/: XIﲿTBDxE7CE'6)Om{g'ܹSE'2$7UniA> 8կD@O.~ mxah }AUh]0gXBuPCQ4%¯oH\|Hi %Jtŕ׫1O g\BKfj.輑؍:z8>"hq0-D_~`<5,s_ Ꭵt.&p❧U|0𜆍,ǫ.f5ōKĜG9uIXLF< D +E=wuZ-ɇr%99>a:7Tl@p!tdeujy9\(q8ʂ>g|OK$ÍDc瘼;k8h?BjTCh)ۤAx>tUMҰ";\j<)?Rpm-6{t_҆ !4t5QkTp,oR]_"s"RSaȱe?e #dxiPvV$(HR* Xù %Wx[_jPvrb[__X50`5lܽ' ZiRܦ#.95wڊhҁhd2N$~Gdlnr"&YӅ{G3}k#s&'"SY:y/=s=h߶^R^2X>B EB.q)k'|$,ft1.B^b-0Vll5>mݮ;CGʄC=l fz2Ch, >K5y^?Ko:2h"P$O} j>y"Rd:nȌt7i&>C*/QdK /)繞^kZIbkQI\ELLkl]`XDR0]E9?GB,5_뗬 z>Km'gY5W<#Dԕf ۛLg.a^M ˴憷,Rv+&{)Lf)Ekxܡh`Yr,9:!HBw&lLLUmdIw{ͷ&J]q0?7i.}n%& q˄\aSxb3*]^irj6 Ɯ\&g.[|~햬s} BcԲHAҖfEQ$O.{`ii&ԚDlk)dS,*rktlu+UH3zRIa'ˎm4]$_gh}h~X0[m2LT&Jc8!ꔓ!/,=gmpk8}0LLCcgvMy7T73 H;3[өշHH7ʈ^=Ct|S"īsrsh]EZ͋IuD\ uwEgRՀTI!R{v4&.'#6 ?4yۓZP? N;*mo&Vig;fL yX$e]o. |!@3t4jV uKpi[l'{5M*%CsoQwq|cVVFG3ž4~1=ɏ/6G"R>07P}Hļg{H>g&j:;]\ |*$07I-% HD#<}Xc: zY#|w~ȃ i!ŘnTLGyARs2UMw,A+"$R%mH}v{ Ku k-[Tq} +{ n>+kyrɵ#ǁnFJԇZF@F zTlO+DRd0 cBQ. W96a.d" T:'KnEKM^[Ü~M67Dݰ==|ԝ%k/ic giO,VqIz=W帔3˼ AZO%)? S>ʏ7˻Ͽ ߓi d·q{Xv31mfm7(JlrAI冥| Bms&$ 1`M5N ] UZ{^J8Ae 1_`t/cwGGg4+aڛ&GjM.%*a{Phc>:?3tҮ7m:4==-&NǑ_`,1>T Eտm=ئ|s3:h!wN' 4fuӖ3'/U+q˽5,̀(2EYfI:1b C~c5hgBAkrvw{=ndyyهhG`2S &+Y> g֝2Ig3j:.{w-0C]&-U yYLPVNGF4")ۦ?pq{q[:EX'&dQĥLMbĘjRykq0eVY$٦BgRkkV.2Btႄ@"HExzpY&BGa*mb(hbeb/E`JQ|yJ^GV#*f~zt+ZKV9y{&Ul"mP{fJԎ6 [W .l%Ѝ$xrw *FP]@԰,&G\~NKQF)i:/x}|/3Px#\IJ{H2z< s"춃EUr'AʪUKz0i Кb\&$ĠuSoЎ^Li哚k3'ʕ4J-H$*Kci2PI!gN!zrD#3U5rW.0dÅjK2uC̈́W_2Аn4f83塃&5K>mW Rn}:B[Zzx\jXRT~P nZD\%.Q)+,󌗣򦒠va8<:"^fR>mbʳVh\ 0,ĉƐyqMߩӦKbϼH8݆a#*@ ᝅng1܆nΒ^I3\_Ws&A/Fzc˕w^B*],qݮ=>ܝu*3;AYjD*ܵ %512oJ/<ܺsƪWN:yl&eRdj5Yk/^J@c>̊PڙaIb>P50 07Mƥ*FTDqBA rbx~+:C1wǗQycCuЎS{rk3ةq 6Oݍ.Z9tMlNo0+T > VBP: (jxKT1AknPBn3y vЧ.Y;k]%GpߧZ+kO`x4$h` oȬz!_t9DF7@OXsp҆˹U%SN~Igy!j]ө_ ~d*mbI0!BEc07 I*z+lkU(|ٺNw ХX2iJ ="B1fPpHeq,Ka 4%¤[hDBJHhb7^B͐bdS.: 3oIdiP nbab&Ĺ\]eZF=[. =: 3-N%+9l+qA&]Γ2H`7liX7m)*"36MU&:Ӄw*>g$-W{hШ񄡓V^.YM^ř*E&%{YCȋyDQcSYyxG/rPӀ𶌝QpυTR8|ZSqMD׃j.y%"_~h({^¨kM) M@rV t篏?ޞIo= r55՛Ϙ5IvVp@M ČHD YJo"ziSɡ9E*Dom2G{'G~O<lad{hКKa_t=+H]ACM*2CEӥ䂒={ԗŕwhTCtW&A~JݮR oJ\屢DsZk.ՙG ޗu=// ee /GQ;x( %-Ayʱm $E\E ;'iC=k_@v AA.oQmqa{gS|`}ɸZv#ȻTh{%no۲[šqAEID&S`A%/&d439HE8{%\V1N5M{'Y}#ȰYGJb?ɃZ2ۮuI[X֖, F]ҏ[CAhr}5Osrth j} ?`s{p?^_ /VjW$ɤN`vh C{4(o&0*<3r84xsύ>+YY\?nR0 ]/q /S4K">:^4cx &MKfJ iWyl@j+.C9ּ[mdXHqcOm ڦҷcwvye{SR " D@ ]Ac<LQ>%|DFjdƉΓ| h&+!貚^ T [:D~NTYykSc2)afq|:ԛCOT0:>_qah}E,iW&(n&[v`xhնDdvۮcm/ cT1.49H*dqY1|B$8 l6(P{؀8Bd3TTX_&?^V@ Ew-#PsGֺ}""sx2茠!|> u *8[ xf _=.c7) )$b|wV_~̓p(dtV#Ȉa!0Y3쵌J(򤀹c+,Ŭ:0?'=aȷ;>1gFύ>yJ匂r}㢒a^|3HnИhyܮS8ShĤ=oșKr&ICHTAYӐ H{/`2mঀO,S~7l rl{/4tA*h'P vlf'+_l_7[eG7_Mcohn=xT/R5 c$WUObR4 I>Nʏky6k'r 6Y{9ۂ-r&tEuI]vG~ka靖/X?U<-u|~Vp;ff'% bEA{g3!({jwLOTWos`p)* ռ h,I;1JJUX:BC;b_pB^LkBA9}:& H#qiFˏ=itAyl:ۢy3YQH`A4}TmVX *rtu#y^PN×w1ֆLb{='ve𲷝j;)|" m:m~\ u2"s  tjEv`=r<]zDbt$m!C~ e `bk/\׻Ҕ1iyaBqJl+}WZ1cՕ<$[ TS/'V&DWplǠڼ24wj%pE'qe4r`2YUDƿE!kRl^$#Cq^YIY]"9V[Pr2V[L]J cݯP$A9F~i[ۂybZYRөWCÍ{ ٽ0G+ncy:c!:areTE!q^c1mn1#SXej>+ƱNr>uCl <.37L_6vY.ﶥ#95s:WJWq|עNu`aEb:$!mAvq|{(\[Q1+4p oe{ME˩1{ynA,x?N~~<ƉT))scnAEC1~є58ؕzܠ+d60ZB/a?S{tN~OO]b<~ʵl@1璺vY1 ~:>t@D8vwAR6U3]ͤPfQ8pf=^qaG/Ly#$Z6&QE}F+.PdƝy `RkȦTcX9Y <9@PK7v=yب%P|śƹl5]Wg݁..+)|3Så0dL޾ܙ0H(VŮ@&Q;^'n"n*ZKD$en˾5ۂ:uZ%4NkX3̅By/zµi #/P@2-OZ7߄3_n}9ې9oWXC "ཱྀƹraTLu*~AWahd}4$K@ zf_o(ؖO(EJZ ---HDkLUA߮+Bw\6`pt*D}@15;ޅYEF5ؙ>0n\=Fzߏ;hR!;gVedW)[K#l>1ZLޞ2)Phcm EpԒuje`_0;> d9:B*.o+9|א­X`jghZnR|~ųkwz3oo }7]j4#~ŷ_~{?:Z ˇ_97쵗^A-)&jVL?|R#0& 59lcq@JU_!Bi$87x?x@d' 7I:ؔ2՝ %ƠFJhb"(RpT*FCijzno u#N#wQ_ܪ*Kih3=K(24RK[իP(" bc sE{nG##)Syr} ֔-HA;L:cT6g*iBޣBE!tUsUՒL-ᡖAGI}hs( 4yD6Z-ϐX,DY6r1yWw_PQ//DKm#(NEGltR,3ټF^ Bb:Ftr|t}WBR3G6gZ,?hɗM([ Kce@vblMa֜Qa}OԕiEkZBJTezW$^#W@z V}]b AmUC6L-`i*rnx^/HE1e!*$#щxҍw=hN2E̫M$fS y=cj,i8*mۚCe 5QdObUn-3-x `>Y83.)KW+ySD['Ti1R= x 0t,ZOGMIPSTeO EWm6}+#&.ߖ%,ZSK1 !caRFnC)> endobj 11 0 obj <> endobj 12 0 obj <>stream HVo\Gf\k{c{ԉ҄ 'R$qDc<@L/ n1?Y4I:F4Ui : Q05iFihA DLi1 3tI4r#% e)G-S/Q*C;"쥆8Q^e ݠn<׎LQ}F60ºjvc'upYgQ"ɞle }؁CYNm"}źڢ_ KlN\E4:!Ɏ>FY|fdmuBXl:tf2/;s궸n? ;v6۰p%p%$9v ]ܙvzvsB|nc_I}Y`+g:s77V޹Y>ѓsi"a-[xN^z?X;uf<Olcz-CqVz+ns eagP([}<y*_dL!@~'߃^*w!w(l TA%kϏ# P.\XXXRqgcm,[3F !:53 S<,꧿h٤UhIk$ƿU)Kxb\*CG+Ҏ0VkWń*azO2cKB'-ľZ-+vl,um摻;tGW&_B2 vxyT*F^U9tv4w'c)+'`vz0Pc;@ 3&A>pbKxPFOr'n`b},7 s q@8$y* mE(N::Ҏ]DΌW&*҇ID 2kl;ƎZmCLdcP!p>kX&U07- Y߉d* cӢt3طg\!AA.#=O@ `G3G7*Af3nښs3'^ǐ:I=e%%ª=L3G#}Qg|$2؜c cܬ+] J%67P \^_$_,{X/n .MÍdwZ ,C~|T^kRyRO\am78'ʼnl\l(Z&# E]Rem_diAǾ;Fidة!?G-q,2b,B!ܞZq0&4OI0|E|Qĸf`?@E#]a0CH&Z{  c /`a]UR/L q),3h*-=ӄ Cf Lx0f?):rBH-'Wt_e 9z޲w5ܨ1Dh$5ܿ0_k=.hIL)v#翝y4$JoF?]6eꮮx3x^ &v#6RBBķǜ9!8p儈r8"_!qC(y{:XqM}Bkg#ex)Je +#3e꒎|%0a]O8xoQUaq+Ue$U]Ny^Xѵ8HL nVH,qkD &02Dſ.~^~;=A 9gh-3@)97BdNt~3J wk"sc&AkVqt@6R܈0Y<]37#8=^#PcʫLpP&'7̅ˬ꒨]݉Vw^U4W縐[twKIr~Eן?b/"b@،n,o<̬ImRlr<.cPxWChIsQCo!U*kA %nqNOvkNHD|-qN( ݈DWb aD-k )蛜PVe*!]fD|@(RqcDSY9V_!ShP*q 0uLؐ0HqU'&c o~U߫qG[􈬈A1mG|y`0F'@Jslf,SP X#CfV5$V 󝼼]RGo+"IiS;5 A[iG f u)ii"uՐҰ`0:6P6fRII]Ar76Nקq=OXB#Ԛ~ާ^Qɛ.(ZKZύ+՜`8۹`z.OnHRpzjpYv7gՃfФHoؼ%9?gpѠ()|lp4$Rō bGp%#Ȱ{(<Ğ+jS#:# 6O+GjEF_A.HrP'J$'P)$tCsB8ihi!쏡&TB]qX/_RYe~3 ?0I(>7$D9k3H9#rQ1DE:KffV&C YBw,0Y)aDDH/2kޯXŖ>(#SSP迉]7k; /]ϼh]?@? }ٞyOG ?{Gy7Ӏ6. 6 6> 6ʚ+\%l1G%QrlȲ#HHJ>MUnzesڌD~s1ۥ8DxgD%ue13)STJ gJ% 8Y9kP'ԜLЅoӈФo4T'I!I]@BTGZR9wJf+8wa$ '1;R=[sj@R,ҕikМܔVYF>ajv.$KH@:n[ѮʑIEM'Li*B&]IhtUGj]5I~}ߥR{ͅheR~_0 .]?Z'65%B)emg Q8 bõX&c<ޅpN̋[\/v?bKvy9k+\ˑ&ڠ?Ek.#&=cÙ%Y(w)uZiې29qɲ+_^sY\>kpUJcᄚ3a&[!vēqV)gH}S +%"f>$ .3Hl`U}Msp]к \1(:tAo|߱q)KMfC/Zw^J<),) homl=xqXo?EapɁ;*fۖA\%$7me0G[X|<(RH0ٻM6ӎmU-͠Oz~3}4^l6*&,ꥇ0̦ȎxuPoA4;ᕋ2q-*ѣ"9HUHKE:[W>w602 FUh/}=8\^& BΑً=;JMmW 8%n@"@Al!6fQ]P_gl׻,W;oUWݻg6&mФEJ+44nt&vB ꋠ Z4>*-AEF`Mֿ=~sφ9Μ3s̙| 7Ia%kB+ &$2U&[Z]ǺqpDO7%UǞu\TYnX6Mr-mrcnE M2MF=PQkhlC9 X[WoGBdFK b(-DOЈbA gf޶m:7-fx6h0G5FFStC9]C]PՄNB: @mBZ5!44Vt<0_Dl s O<wc vmyĂp8#9-fݎx&1)mufRqJ3^-X6xV\Cq˶lpR1d0)O %v4Q] g7zԬjj%;9FO`gK"RxˇGMiWΊ^D-̷9/+_eo2gOuygESo'bs~}&hl"HWoO3GL/cm0"-jZMXi;撸KrJJ+(9MZ#k}%'#ق<69>f] 1 jX0Q+-W^@x3 6A2#Bx Jdb=E}퍢#yCW 30=W~$ endstream endobj 9 0 obj <> endobj 8 0 obj [/Separation/LETT/DeviceCMYK<>] endobj 5 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 14 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000081629 00000 n 0000000000 00000 f 0000314526 00000 n 0000081680 00000 n 0000081970 00000 n 0000314365 00000 n 0000314253 00000 n 0000307589 00000 n 0000307933 00000 n 0000308183 00000 n 0000968934 00000 n trailer <]>> startxref 969189 %%EOF