%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf LETT_1-2_JULETREKK_GAMMEL NISSE_1 2017-11-10T16:39:35+01:00 2017-11-10T16:39:35+01:00 2017-11-10T16:39:35+01:00 Adobe Illustrator CC 22.0 (Macintosh) 216 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAADYAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYqh5dR0+JzHLdRRyL9pGdQR8wTjTMY5HcArf0tpf/AC2Qf8jE/rhpPhT7j8nfpbS/+WyD /kYn9caXwp9x+Tv0tpf/AC2Qf8jE/rjS+FPuPyd+ltL/AOWyD/kYn9caXwp9x+Tv0tpf/LZB/wAj E/rjS+FPuPyd+ltL/wCWyD/kYn9caXwp9x+SnJruiRlRJqFshY8VDTRipPYVONFIwZDyifksHmPy 8aU1S0PIlVpPFuwpUD4uu+NFl+Wy/wA2XyLh5k8umlNUtDyqVpPFvTrT4u2NFfy2X+bL5FCaj5u0 q3gWSzntr9yC3pR3dvGeArVgZHUHoe+Ii2YtHORqQMf82X6AlcX5oaCZPSmhngmP2Yybd+ZH8hjl evzw8Bcg9lZKsEEfH9IW+XJLzWNZfVhdItoJWeKOO8E8hiMfAQyQwu9uqhvjqCWr9+E7J1IjihwV 6q/m1vfME+ry7mZZB1bsVdirsVdirsVdirsVdirsVdirsVdirsVQ1j/x8f8AGd/4YS2T6e5E4Gt2 KuxV2KuxV2KuxV2KuxV2KoSNEOrzvxHMW8IDU3oXl2rhbCfQPef0JY/lOI6+2rRzLGXlSd1EKery jj9Pgk32ljYCrL338cPFs5A1Z8PgI6Vz253y70+yLhuxV2KpXpel6Y2mWjNaQszQxkkxoSSUHthJ cjLlnxnc80V+idL/AOWOD/kWn9Mba/Fn3n5u/ROl/wDLHB/yLT+mNr4s+8/N36J0v/ljg/5Fp/TG 18Wfefm79E6X/wAscH/ItP6Y2viz7z83fonS/wDljg/5Fp/TG18Wfefm79E6X/yxwf8AItP6Y2vi z7z83fonS/8Aljg/5Fp/TG18Wfefm79E6X/yxwf8i0/pja+LPvPzd+idL/5Y4P8AkWn9MbXxZ95+ bv0Tpf8Ayxwf8i0/pja+LPvPzQ2gxxxpexxqERbuUKigAAbdAMSz1BJq/wCaEVbalYXMskVvOksk R4yopqVNK0ONNcsUoiyOaJwMFK5ure1hM1xIsUS/adzQD6TiyjAyNDcuS6tpJ5bdJUaeAKZogwLI HFV5DqK02xUwIANbFVxYuxV2KqN5fWVlD615PHbxVp6krBFr16mnYVxZwxykaiLKUw+d/Ks1y9um oxiSOtWcOkZINKJI6qjk9uJNe2HhLkS0GYC+H8e7mmsN/ZTymGG4jllVElKIwYiOSvB6A9GpscFO PLHICyNlkf8Ax1Lj/jBB/wATlwpP0D3n9CKwNbsVdirsVQuk/wDHLs/+MEf/ABAYS2ZfrPvKpfXt rY2c97dyCK1to2lnlNSFRByY0FTsBga1HTNY0zU4jLY3CzKtOa7q61rTmjAMtabVGLKUSDRQdt5j We6aE2ksYVir14u6bVBkSIyenUbgOQfbFgnGKXYq7FXYq7FXYq7FUt0X/j//AOYyX+GEt+f+H+qE h1b/AA/d3skNxM8xmliunthCZAy+tDbqpHcNJa8fpyQtzMPixiCBVAi78ifukkP1fyfCbqK+1Gaa 5ueDFriGTmrpG8CO3I8aq8hZSdx4+B3cvizmjGIAHcR3g/o3Rk2heXWvL51v5AzWTSmMROfQtPUq oWhC8FAoq07EjGy1x1GXhj6f4u/nL9feWSWuo6Potk0MszkW9x9VlnMT8jJJWVBIwBqSHHxnYk17 5GrcGeOeWVgcxfP4bfqVLnzhodtcyW0krmaL1eaKjMf3ChpOg/ZVgcHCxjo8khYGxr7eSY2N/DeL KYldfRcxyLIjIQwAPRvniQ0TxmNX1ROBgwXzXd6pqNrLpU0UJtLy6ksCojJkiaNWnjfkZVBJijEn 2Kb8d8nEO30kIQImLuMRL39D07zXPzYleavb3VoY7hj6ZSO54i0VQ4SGO7Kh1l7c1VqEHfbJ07KG AxlY8x9XmY93veieW9Xvb+aB5BbMlxaGZzBGUaMLLwiRj6koYN+8224lSMrIdJqcMYA1e0q367b9 B5e+05j/AOOpcf8AGCD/AInLgcU/QPef0IrA1uxV2KuxVC6T/wAcuz/4wR/8QGEtmX6z7y88/OHU 45p9K0NHVJlmS/nExWON4aSRBEdlkLPWp4qvT7RWoqhnp4cUunxeYaN5hfyp5mmuZ9dnDoGSO2Eb vH6bkEKQ4K8dhsg7ddskyIiJVORPu/an/mHzt+Y/OC70K5hfTpyZfQsoFjBZyXZ2J5Meddzy69sH CnJpSKMfVEpt5W/N7WxcsusI7LHxS4tp1SJo6sAZI5Qq8+K8iUKknahGNMPDBBraQ6PZIJop4I54 m5RSqHjbcVVhUHf2yLQvxV2KuxV2KuxVLdF/4/8A/mMl/hhLfn/h/qhXTR9IjmM8djbpMxBaVYkD Eh/UBLAV+38Xz3xtic0yKMjXv+H3Ol0jSpkKTWUEiFuZV4kYFvGhHXG0DNMcifm5NI0qPlwsoE5q yPxiQVWTd1NBuG7jvjanNM9T82k0bSEhaFbKAROeTp6aUZuPHk22547VONpOaZN2b96+bTNNmYNN aQyMvPizxqxHq7SUqP2/2vHvgtAyzHIn+zl8ldI40LFFClzyegAq3Sp99sWBJK7FCX3WgaZc3L3E iyrJJQyCK4niRiF4hmSN1QniKVIrTDbfHUTiKFfIH7wsby3o7LxMTge00wP0EOPDGyo1M+/7Ar6d pFhp/qG1Vw0tA7yyyTOQtSo5Ss7UHI0FabnEljkzSnz+4D7l0f8Ax1Lj/jBB/wATlxQfoHvP6EVg a3Yq7FXYqhdJ/wCOXZ/8YI/+IDCWzL9Z95Yt5+8t6frF9pRF2bPVlkMMMn2laCQF5I33BjDtEtHX flQYhGPIYmwxHzP+R8160Nyky3jxq3qxR/uJmJO1JJDL6lBsAzJTx7A22yyxnK5D5ftV9B/LXXLK 0W1tbOOzgUszfWrgFyxHUeiJwa033GHicrHq8eMVEGmTfl35V8waK19catPEGu2C/UoR6gBhZkSc znjzMsYXb01p0yJLg5cnHK2aYGt5Z+ak2v273+qaJ5gubdrK2QXGlRo6x8C4V5I5AAhZfVWtPiXx 7Zi6gyAJieXR2nZvhSnHHkgCJS52Qfd83kEv5j+epbUWr65dmIEmokIc17M4+Mj2JzXHVZCKt7CP YmlEr4PtNInybdfmDdap62g3dy1wD6krvMRE3Egn1OZ4uKsKjfrjDPkG9lo7Q0+ijHhnGMT/AERU vs/Ts+ifI2ravqOhK2s+kNVt5ZILoQkEVRyFYqPs8loR4jfoc2+GZlEE83idTGEchGMkx6XzZBlj Qlui/wDH/wD8xkv8MJb8/wDD/VCZYGh2KuxV2KuxV2KuxV2KuxV2KoWP/jqXH/GCD/icuFsP0D3n 9CKwNbsVdirsVQuk/wDHLs/+MEf/ABAYS2ZfrPvKB1zQG1F1lhkhR/TMM8F3ALq2miLBwJYecVSj CqHltv1rga0bpVgthYx2wEQK1LejH6SEk9kLOR9LHFUXirsVSnWvNfl/RbizttSvFgub+VYbSABn kdnYKDwQMwXkaFj8I7nFUl1JdYjuby4lsAtq7zCrrHNA0HpheMiK/MiYrzNQoB2bxNMcR8Qy6U3w MSOEmnnPmj8ttLvbiyk0ezh063jkpqRSaRzKrSKlYVkDBSSr8AW3HWgyrNohKuHbveg0XaebEJcc jP0+n389/wBL0G58prHZaZ/hq2RdPjCzemJ2t5KUrHxojc1JdmdXcV9xUZP8rB5+eonKVyNlKLrQ 9Zl1uP6zHHd6hHAOVtBX0BJ6A4mQyFFkSOV5ePIDZ/GgKdPUaieqbscZ9z0azV1tIFdWRxGgZHbm ykKKhn/aI8e+ZDjoPRf+P/8A5jJf4YS35/4f6oTLA0OxV2KuxV2KuxV2KuxV2KuxVCx/8dS4/wCM EH/E5cLYfoHvP6EVga3Yq7FXYqhdJ/45dn/xgj/4gMJbMv1n3lFYGt2KuxViH5ned7vyl5fW60+w fUdUu5Db2FuqlkEnptIXk40PFVQmgNT026hV4vpkesapcTahfyXUk9ynHUdYiEpRpH2VHlHwRr8Q VEHEUoAMmHJhjxzoXz+/9Vs/86/nBp2neTtPTS7xLrV9Tj9KSSOVWe3VP3c8zemPtcwVTYVNSPs0 yLTGoyF7i2AeSdS8zS2lzpFikkiyNQ3cpd4bVaEO6pv8XEnYfccyJAc3tddhwRMZ7AVtEbcXd8PN 755QaOHy5a25k5LYxiAyMysOEY+A812NEpv9++Y55vHar+8ke83yrmitGgJE+oSLSe+kMg3O0K/B AAD9msSqzD+YnA0JjirC/MHmSbQtFvZbZQb291GWzsy1aJK8bOrkANyCCMtTvki5M48RiP6ISPyV +cNrq11daXqQmha3XiuoiLYvXiQwjDqG/aVuKj28RTUYcR9AJRVj+Y/k7Tb82s+uGa5rxeBWuJow TX4PUuWPJq/tKFB8MWAjvTNdG8waPrMckmnXKz+i3CZaFXVqA0KsAeh69MCkEc0xxQ7FXYq7FXYq 7FXYqhY/+Opcf8YIP+Jy4Ww/QPef0IrA1uxV2KuxVC6T/wAcuz/4wR/8QGEtmX6z7yisDW7FXYql vmDy1ofmKw/R+tWaXtmHWURPUAOhqrAqVIp88VUp/LPlx9Hv9KS1htrDUkkju0gVYwfUXgSKCgan Tww0i3htz+Sem3+kXc/ljUJbq9tZZIoxePFElw0LmN4o1VPhaqkB2kpyHEqv2gQCgkJR+XOteZbT Xz5Vkt0ed5H/AHV5L6Bhli3kHPc7KrHiN9vhI35EFyceqlHnuHs+gaPqa63fSatqEb6b6UKwW1vJ tM4IkdpCKOwVvh3+0OuxNZGB7lz6vHOIAFEXe/yZukkbiqMGHtlZBDjggrsCXlPnrRtWur62vraC S9so764huLdEEximdo/QmRD9ncsHejEfCABUnJOcJiMo3/NDzrzLovna31ZBaS3NuZR6iwyBoB8L E7c1iWTfqAp7cuoqWMjMz/dy+3+xG6lpGi3lut35gjgj1KKHlcCKb0wAK0NWZdturffhLmZMUJC8 lcddCzH8vtF03R9D07zJq2snSYIpJ1je+cQJJA0rekQ80nD05oVRh8NfChyBLrJz24eYHLm9Wsr6 yv7WO7sbiK6tZRWK4gdZI2FaVV1JU4GpXxV2KvG5f+ciraLULmL9DtNaJM6W86zcGaJWKq5Qoftg cqVBFaHfMOesjGRFcneafsDNlxiYMRxdD+CzvSvzL8m3+kW+ovqUFp6wo1tPIqyowNGUpXlse9KZ kRyxIu9nV5NLkhMwMTxBMIfOnlCZ1SLWrFnf7K/WIqk+FC2SEgerSYSHMJyDXcdMkxQsf/HUuP8A jBB/xOXC2H6B7z+hFYGt2KuxV2KoXSf+OXZ/8YI/+IDCWzL9Z95RWBrdirsVQer3c1pp09xDGZJU WqooqSfbJwAJ3YZCQNmK6D5P02ysvrck7SLqB+tfVrR/StVeULQxyJ+9NBTfnQgbKooBOMidhsGE ogbncsZ856hpXla//RsOnJdepb/W7e5kCuI5HkZQqxhRHIyKvwySAso41rlYcrBjEpb/AI/H9gJY j5L1jyTp3mGTUNZ0mOSe9ndDf3EplihDoWZlgKSFpHeoYk1/lpUgpDLUQEZbdRdfj5/H4PbIdH0C 7jgubbTrCa3mjSSFlgjZWjdeSMDwGxHTJCqcU3aNg8v6TBNFcQ2/oSxCiCJ3RQPAorBSPYjIWzpM cCWG39tq0kry2T3CpFeXBD2ojd4pvg4SNFKVWSMpzjYVqOVR/MJFuz/w/wBUMjtrdr/S0j1eCOcy gGWCWFVXY1HKMvOtf9kci0om3sbK2gNvb28cNua1hjRUTfY/CABvirxD8110rQPzAh8xeZ9Hl1jy 7+j0tNLtlCm1juS9PTbmwRDx5NTia7UHw7Kp/wDkF6s9lr+qWmnyaX5b1G+9XRrORgacAUmZKfsF lUD5e2KvVsVdirwJ/wAgfNV1qztNd2sFm8jFpuckrhCTQqpUFm9mI+eYEtFxSJJ2ej0/b/g4BjjD 1Ac+nyDyVCxRS1ORAJ41puO1Sds12QVIjzeu0mQzxRkecogn5N5FyGb/AJefmdq3la+SGeR7rRZD S4tGPIoCftw1ICt+B79iMvT6oxNS5PPdq9iwyQM8QqY6Dr8O99H6fd215dNd2sgltrm0tpYJV+y0 bmVlYexBrm4eLP0D3n9CYYGt2KuxV2KoXSf+OXZ/8YI/+IDCWzL9Z95RWBrdirsVdiqTNpep6exO jSRtZmtdMuKrGhJrWCVQzRjc/AysvQLwGIUsX1fyz5d1PVDq2p2lzp2sqKNfyiWiIqhRSRTcWqKQ NwGHid8ncWFSS9fy68hXGpR3lxraSMyGIxx3NunqI4KsjFFViGBKnfcbYkx6JHFe70bTxpkMEVpY tH6VvEkUUUbBuMcY4qOpNAMgyReKuxVIYdX0/Sra+ub6UxRG+lUEK7ksabUQMcjlyRgLkaDkZYkm IH80IBvzO8sJcLFPOIEc8UeV0Qk7fsEg981ce1gZV4c+Hvq/uZnSbfVG0D57/OLyp5TBtfUGo6y0 Ykj06BhVVYVRppN1iVqgitWI3CnNrGQIscnFIp89eYvNvnDz/ei4uPWv4YnJtLGxid7eI0p8CRhy z9fiYluo6bZJin35J/mq3la5XRNSZh5cnmeL94rqbOdSA7IHApHVh6qfsk8uteQS+jZ/M2lRanDp 6yerLJH68sqFPShiYH03ldmUD1CKIBVm604gkV5MsIC5EAebKMDLkLVj5g0JeHPULeMyuIog8qIX c9FUMRUntTI4dTjygmEhKkzxyj9QpFXd3bWdtLdXUqQW0Kl5ppCFVVUVJJPQZcwfL/5l6t5M1PWz L5Zs/qsauZLm6+JEuXYVPGFgfTWp32Ulu382r1WSBOwBPe9f2LpNTEeozjDu2/33L4Ddh5NTXMF6 kChTWKXoWnedtes/LOkRabfywNCk1vOQQS3CUyIDWv2VmoPbOg0Z4sYJeZxdn4jlyxkAanY/zhbf /KxfO/8A1d5/+F/pmVwhyf5M0/8AMDY/MbzuDX9Lz/8AC/0x4Qv8maf+YE30b84/N1lMv1549St6 /HHIixvTvxeMLQ/6wOA4w4ufsTBMen0n8d72fy35k0zzDpiX9g9UPwyxN9uN+6OPHKSKeV1Wlnhn wy/tRWk/8cuz/wCMEf8AxAYlry/WfeUVga3Yq7FXYq7FXYq7FViQQJI8qRqskm8jhQGagpuR12GK r8Vdiry3zX5nuIZ7zR7awaaQXrzNMfVbYinwJBFOze9eOaftiMckRjPO76fplF2eEmJEv6Pn+gFS 023v7yI/WpIHrGXWNLeWB0FAaSeod9q1qoOc3kwwkTGO0o9bHT3RA+0uZGZG55H8dSlmhaeNG8w+ YvMc1lHdmG8t7O+gMaySR250+zmS4TkOXKJp/jVT8SV6lFGbvBqpafBDF/lTAkXy3PpB99/N1ueI nkMv4bZX5g1rVNVMWiabcm2e6Tne3cWzQ2hPElOJ2kl+xGe3xN+zTNLDtfP/AHuU7QNCI24peflH mfgGcsER6R1YVptxoWkafqGnJo1vNpGuXWpwWOnSoDCdRtdTnt7cEULK0sTpuPsLETtTOll2lWaU K2gRxH+iY8XF8P0uL4XpB70LpPlrVrTy1ocMNzPPp5slmlea6EDOsm/APFFPcKItwgTjRaVOYOtx QGeRnVyrh24ulHYmvsLmYJE4wI9OfT9qZwaZJYf7kLaC0smVQz3xSaSdqDqZSfVf7swTlGUiIMwB y3ER8By+TkCBiL9PyJTq78w2fn3y7/hwXkJmvrm3ga5t3FC1tMlxPGVrUOIYXbj+GbnRa3JkmcOW NHhu+8cvwRs4k4DHWXGeRHz5/i1+heU9H0uaTT20q3t7q2CB3k4zSTgovKVK7iMvsD4g/CMlmgYF mdRLMbkST5/jZBa75Q8s+aAsFrCYbxQ/C5tYCwAjm9JuZjFOqnjyb38cY4ZnmLbcGvnhNwlXl0+T x7zT5T1Xy1qx0/U4zGWHOGXYh4ySA4oSO24rlOXCYGi9jo+0Y6jGZQ+oc4/jv6FPL/TFsfLPl1wK PfW8t04pT7cpVeoB+wi9c3ukhwwAdb2dqPGnlmORl+ikpzKdq7FXYqzT8qPMUmk+aoLZnpZ6kRbz KenM/wB03zDmnyJyExYdT2xphkwk/wAUN/1veNJ/45dn/wAYI/8AiAykvHZfrPvLAtA85efb3zZp tnf6JdQ6WVvYdQu1tXgthMzs1kQZy0xCx2cqs/woWkSo+KMkNaRXH5kfmy0VlcWnle9eV7WSO5hk 054oVvZroLD+6aZpmWKC2m+L1UU80LcOSDFWVWnmf8wJfNWnWUujxrodwkMt3fCGdWQXFoXVAXYc WiubeVZOabK8QIB3ZVjEP5k/nDLahE8p11RntysMlneQw+lK0qycpi7xqU/cft1ozMVFGVFU08ve dPzP1PV9Mt7rRksbK4e1OoyS2F4hgjk09LmVRJJKiMxuC8Ian7srRwSRir03FXYq7FXYq7FXjvmB L+bzTqEcE1zBE1wweZPq4hTcVP7xJJS1PAUzlu2PDGa5cF8PXjv/AGJqvtd5i4uCNXy8v0oy2tLC 6u4LW8v+clFiak8sDlGYciPTaLrTwpmHofElKo74yQOVjnysj70Z+EDf6gO/9SOuJ4dJl1yaPndz apqaR2kBblJNNHY28Kry/l4Q82bsoJPTL+39NOeYH6cfCLl3cJP/ABWw6lwdNMAeaH8o6Enl+4XS nl9SbUXaWCUjihcKC1vGKtwSJV/dR12jFN+JOabNx68x8Mbjavj9R/3x7/eG8EYxv+PJj0VtPdNp 17ZsfqmhSJqkyEVDtqUjTSAnY1hsLl3pTcyKa7b7nUYBHUSxHeWb0jyEYCj8ZD/YlohP03/N/Sf1 MjsLgQeTPLMauySyWirRSlG+FdyzMqqo33J+WbbtHSZM0oiFx52fkz0cqB24kHeaOb5ma8pLcxR8 rRViFyGqwBMc1WUU6/Y+7Bi7IjjHrySPx4f2/a5M5AkbCvtH49yY+WdDtdP81WAs5pp1YST3P1iN QweSJ1f9iKlGVQrAfZ275sMGnxR9UOdVz6ODmPo5/wARTvXvKmstcy3GkS2d3Bcv6k+kazG09sJS CGlhccniJ2qvEqe1KnMlxE08saNrOmQzDVNV/SLzFTHCkK28FuFqOEKgu3HcfaY9NqDbFXlf/OQ+ pJLeaTpKRcpYo5Llpaj/AHYwRVUeP7s1rTtmPqcMskfSOrv+wRKE5ZaPBGJuuvklf5hWNtY6d5Yt ba4ju4U04FbmFg8chZyzMjDqpLGmZmEUKc7sKXFGZ75MLy53zsVdiqI053j1C2dDxdJUZSOxDAjA WvKLgR5PqTSf+OXZ/wDGCP8A4gMxy+eZfrPvLwuz8neSJPN1vqS+fbSzura8tAdLeFbKW4fTr5pi l4k8yvNcO4H7zgp6OFKsKhrR83l7yNJ5qkupfOtpZX0Osz3SW7QrZu7TXtvcyWs7vIn1pQbQorkb Er/KqlVGL+S2n669zreneaIri21D9JC3ls4I3tnj1AXqN6npzcLh4nvRRyeice/wqq/l/wDIW40j zRaeYP8AECTSWd693DYrp0UdsEuGdrhVT1H4SMDGqSqQUCdGr8Kq21/IGW3spbE68k1rJGKI9kQf WVLhA78LhFZD9ckLIFBY8SWryLKs38h+S38qWd/bNerfm+vJb0zegsDgzGpRuLMGC9F2FBt0xVk+ KuxV2KuxV4v5msb6982X8cLtHHHcFzPKxEEdf5IUKtPJt0kbgux67Hne0544ZTKRHIbD6j8f4R7t z3u5jGUoRA7vgP1lqz0e5sJP3c51SQuG5XFtHOGCvzVZyzxMd2b7HwitFUCgzDwa3EDsOGq2jxfd Vb8j39/VjkwTrvvvr8fjkxi88y+f/Luv6vf2uiWsltMzC1V4JpobWKTiziL0zbFebKC7Fd+IFSFB zoz4WqxmJ3ieY6/sdZKMsckBffndrN5pUtpd6VarP/eQXtu8sUsM0Z5RSxcjJxZHAPcHodjlOh7J waYkwHqPU81yZpT5oDSPzd17S/KP+HVsLK5WaCWG+urj1Xmn9YFWJKvHSinio3oAB2zP8OPFxUOL v6tfF0eh6HPff4d0y0gdZNYW0tItQExCFGS0hAiQsV4rQctuPJi3U4mZMbhRLsNL6Yk934tHaT5h Gm2l8dRu4R6DExWsI53UjbOFWIDm9QeC0q23jmszxlxXOv0D4/2JnLc96lca7qt/r2nyWMRtUF0Y LGa4HpyTmRBIhCGhUAxsoEgBINCBuWp02eMp8GOVyq+8fg30Y5YEDikNvtTu281aw87Wl/YXsurp y+K2leLgGPKP/RwDGaCm7g177bZljWzBqWOV+TUdPHmJCmZ2N9e22iPe66UgeBZJJiu3GJalS9CR z49eO1egHTM+JJG4px+Hehu8w0yHRfM0195j1K5ggfUZnMEc8HrSJBF+6iWlCB8KV2Na/Rl1Vs7y WOeEDGIk8PPehxdfiPp+DB/NenQ6Zf8A1K0uPrGnKWltG+MBRJQuoV91HME0+nvkoO47L+mRI4Te /wCv8c6vqkmTdq7FXYqr2X+9tv8A8ZE/4kMBYZPpPufUuk/8cuz/AOMEf/EBmOXzvL9Z95S9vJHk xr86i2gac2oMxka8NpAZi7CjMZOHKp7muBrUrr8vvIl1fLf3Hl7TpbxZHn9ZrWEsZZSC8jfD8Tki vJt64qm+n6bp2m2iWenWsNlZxljHbW8axRKXYu3FEAUcmYk++KojFXYq7FXYq7FXYq7FXk3m+8mb Ur23KGxs7eWSW81UsvN42O8cK78SvGpkYbVoATuvP9s+F4sPTx5eg+6/x73b4TPh51HhG/6mtM1K 5u4JPQtJ7S2QD0WkSrvUfaZWb1E/2VD7ZoZgx2B94iLr48vls5MTfMfP9X60r1PQtVvIGN/cNO8v wOjiSG2CkGoMcbB5Ae6PJQ+2W49YcUrEZRHfzkfjLYfCLCWHiFWD932b/awHztdeT7FW0hLO3vrw sRdG3iSwjgAC1SNreONnduXV2em9eR6dZoMmWcOKdUQK7/jyHyDqNRGETUefVkWmeevy+bX7HTNC 0OXS7G5jW3muQE9VTRm5NwE00pr8IBO/tkNdoxlFmcogDv2+LLBm4TQAJ+1mGpDTIdLWbVrM3dvC qlWmjAo2wULUbsTQfPOXwSy3wgS9XdcQPk7WYhVmtviWK38PnDX78DR55bKzhQBLO3hE8lN6GR1p Sg2AG3zzYabBj58ByyvmeX48zu0ZTL+cIDuRLfl15/uzZLdSXM8tmzSwSMsEVJDTi5b4RVVBAqf2 jWubDTYJYZGUMQiZf0mA1EQN5cWxHLvFX73pH6e/MO3X1LvQopE/lgarfckkx/DMs5s4/wAn/snE GPH/ADvsee/mr+YGq6ppKabDatYWxkK6gpfkzOp2jPwoQARuCOvyzI0epjkkYkGMh0LuuxNJHxxK Ruhcff8AjdF/lvqNxB5dtIpYbNSvP0TexVZlZ2YMrqK0PKnxN28My5jds7RgJZp1xVf8J8hf2pT+ aouhrNn9Za3Ltaq6Laf3aoztxHTr1OGDl9jcPDKr59WE5N3TsVdiqvZf722//GRP+JDAWGT6T7n1 LpP/ABy7P/jBH/xAZjl87y/WfeXlCX/kk+abER+c9ZZjqmpJ+jmaYia8W2h9SPkIxSG2i2RaV5P8 LYGtX1XVfIKTaMLjz3r1szun1OOKa4AuDWMD16W7VBqFPKg+P+alFVPXtV/L2Oa9+t+e/MFkyw23 rCCa6VYUZ04FeNuyh5TQN1ahPTfFUr8wa1+V6XVuLz8yfM9nJyl9NLa4vApIupFYPwtWHwyVjXl+ yBTahxVNr3U/I/8AiqGNPO+tDVA0DJYu8sloB9YhAb02hVKyMRD8LVo5oMVUoLvyDFqhH+P/ADG9 xGttbvBJPcmMGKS0ozKbbiGkaeFZGPX1GH81FUNc6r+XKarDbr5+8wQ6hemUQxSNeSUTURGlI+dv SLj8PpGtEc9K7Yqj9P1XyBOsGsW/nzXprW4uLmaJXnn9JuUbq8RjNuCscX1d2QGlG8ariqb/AJd3 Pk251aeXRPNOq61dW0b6dPb6lLM4DW0hkckTxRMZF9dV5A7gezYq9ExV5h5gDHVL8QuFl9WQBmUs qtXaoBWv35x3b5j+ZF7jhF/MvQ6a/DHuS7Sb+yea4sbGc313bkG7JcSuhboriMJGnsvHMLJGdCUc fDE8uf4PvNoiY3RlZRss12vwu5Wv7KkAfcuYc8mQbE1+PJujGLy782dI8u2UtlcW6iPX7xnmvo0d nUwMienI6Fisbsw2CgchUnxPbdjSynAOP4f1ejo9aIjIeH4+9kf5cW9lB5atLjR/qst/cq/6Tl9Q fWg4kIER4JKyqOAKqSv83UnNf2xkn4nDKRjCtqF339Q5OijHhsC5dbPJR806kNQk06Wy9SSxgnMk 8sIlmtpEMTKrTTKnpUDsNq7GjdjmPo9LwcRIIMo7XQl57Xe493c2ZcvERuKB+CZ6P5p17R4Pq9hM YoGcyPHxjkXkRQ7uC3btmRi1+SAoEEeY/V+tZ6aMjZBRd3571e8u/Xu44ZgsaxxwmKUxqylj6gUu V5tyoSPAZDWZ55wNzCv5swLYQ00Y+fwTPR/zG8yuiWFvbxXd2S7KZFkBNWLGnJx8K8gBVthmdh1u QQEQL4RzMr+dNUtNEHc/YrLon6VbULvzLYWjyTusxZVQzoyRCL7S8tuCjj8VevbCNRksG/V5XX2s oAQNxsV8/sfP915r127uluxeTwlY1igjSWSkcSj4Yxv08feubpwsmaUpmXInu2T1dfn1qzhmuYFj u4GaGadWJE5AVlk4fZj+FgvFdqgnvlmN6jsHIZRmT3j7lmWO/dirsVV7L/e23/4yJ/xIYCwyfSfc +pdJ/wCOXZ/8YI/+IDMcvneX6z7y8kuPNEn6ZE6edYyItQu7V7uTSyZ4V9WwH1OJfRkrGOfB35pU vyoeFQGtG655u9C8s4/8fyWfJ74el+iPUZvSjk+38I/uKfy/EQNsVWP5w9Py7bXH/KwWg5acs/11 9I9Tl/o8rfWQlG/k5lOR3Xj3piqUWnnrnZ6if+VnTTenZpNU6Jw9PnaNJ9YVqDaSnrInMcaFPYKp s/ma8OuNpr+dvrka6ckklpd6QUdXkkjEd78Nvwk4h68QVVXpXY/CqhbDzLaXmvSauPzBF1FNbNDp sP6Do9uZVtn5xzMhY7XMRdaAEMOX2ahVD3n5m2CLLJa/mS1LC5S51GGXR3UC09WNJYVc28jKw9Vd 6Mamnwgjiqir3XG06X6wn5gQ6VbW11JqV/Y2ui+pE0U1WeHkqhnFbedjJQueQY9qqsg8t2Wq6tpl 5eeWvOgNnePJPaFNMgRYjdJHMjNG6oWatXJovIu3IctwqzXQLbV7bRbODWbtb/VI4lF5doixrJLT 4iFUItK+Cj5DFXkvm+yhl1/U59S1CSHS1n4fU0b0UeQkfbkWkr8tlCBgD3DVzl+1MshqOHHC8lD1 c693Qe93kIjw4mR9NclW0sBFYRQ6bLHY2ASsFnHbkcWPcpyjCj241zT+IDfjGU5X/Ov8fP4NvCf4 KiPckeveeZvL9hLBd2oXWOIFlL6bm3uCxpzRjyCcACzRluXYEghsz9F2fHNMGH931v6h5fHpIefX Zx8+pMARL6und+PJ5Dz1HVNWVXk9e8u2LzzStQIo2MsjdAi7Dp4ADoM62Uo4obDYdB9wdOAZy8yy nRdT0bytcXT6WrahcyFhBfShouMThCUKhjzFUrUhTmg1cpaiMRM8I6gb7/1q/WHqdB2Jk3kfT7+f +l/XRTiL819Xjt7iOO0tllnUReq6GZVjbaT9054sSNhyqPY5HQ6fDgnxVI/L9QcnWdiZZxqM4/Ij 9JUdL1q1+pCMyTyXfrqFpGjQfVmqST8UbRvGdqfEGFOIHxU2k9FhzeqO3u/U85KWbTy4Mgr8dE8g ZJpVWOQPGxAEkaTy8a7/ALwRRPw/2WanVaMYZCJlz9w++X3OWM98t/df6ks8xazqmh3MLW9ksz/E 8NxJyVQVABqjiNuJV+PVTv2zJ7P0wMiRLlzrzcbU5zVUhB+Z/nfWbuHSFaC0e+kNvJ9XRgSq19bj 6zzBeCVLcM28dJAHvcSE5zkIjqhvzF8t6PYWNnd2MK20xmWF0QkK0fBm+yNqgoN/fftmVIOVrsEI RBjsUp0P/jnH/jM//EUyeN2/s79E/eEwRHd1RFLOxAVQKkk7AADLHoia3Kc6d5Xe9McbajZ2lzK/ pi0uXkSUPy4hWURtQk9MBLiZdWIWeGUh3iq+9Eat5ZtbXSHu7a8gu5bZ4kujbzeslJuQU7xxFDyQ 7fFt8twCww6uUsnCQQDdWK5fE/oSOy/3tt/+Mif8SGEuZk+k+59S6T/xy7P/AIwR/wDEBmOXzvL9 Z95SqTzJ5Fm1GB5NQ06TUYpZrS1kaSFpVkRFlnjjYnkOKcWentXA1omXzd5UhMAl1qwjNyQtsGuo V9QsKgJVviJHhiq2fzl5Qt3ZLjXNPhdFWR1kuoFKoxAViCwoCWAB98VUrnz55GtXRLnzFpkDychG sl5boW4uY2oGcVo6lT7imKqj+ZvJ/wClI7c6nYNqoBijiE0TXCrIy1FAS6qzhK9iePemKqNr5p8h LeTLa6vpS3t0Ip7gRXFuJZRIEjhkfi3JuXNFRj1qoHbFXT+b/Id6s9hNrGmXUbJcJdW7XEEqcLdQ blZRyKgIrjmG6Driq+TzH5Iuo30yTVNMnjk9S1ksWnt3VvTSssJiLGvFPtLTYdcVROl+ZvLepz/V dL1O0vZRCtwI7aaOX9yzFFkHAkceSkVxVM8VeQ+d4LPTr29117f1bozvBaO5Zl9aR1iREA5BOTOo ZgK0O+wzne2Mc55o4x6YSFyPfXO/cOXvdxikIw4jvIAU7TIb+zt0jvdTNwFjXkyIqsZaszuxXgtN wFHYDqc0OXLA7R9O/KPdtQ8z3m3JhGQ57+9INdvPL+vx/UtRjdtLkje4gvZSwMgtiGeaLip4wrWh kZgGrQcg2ZePHmwEZIE8fIg+fIHfn/RF1zNNMpQyemX0/j8W8tvv0d9ckbT7f6tb14xoXeRioJoS XZtz3ptm4nmmY8Mjf4+7uej7K7KhhHiEes/7H9vf8lDKndt0P340gSBJA6L4Lt7WVJEoWLBQrNxD dyNq1PEE0zI02UwlfTq6rtjRR1GMQsDJfpv7fsZj5Su7G81SSkzwX0ds7WESN6bTTD4mT1ewjiV5 Om9K9qHI1eojkxEjmKO4vr3PI5OzM2mmOMbGxYO3496DvNS1i5v7uTUeZbjHJp8TksGtSgpJGT8U ivIJAHIq1BsOmZGhwxhDbmefv/HTo67PMyluutTHBcQ3tsqGSKT1oz+yWZSjHb+ZGIr75msMWQwk JDoyvQU0fzGLr9J6dHeXdu5HpSqZFhicn0/SYcac1Xk3eux2C5zPbGr1GLKOH6K2q/jbt8RhnBMu aS+ZlsIzawWemNpKxKwks3SJGDEg8iYSyvyFPirXxzb9kGRxkylxWfx0H3O77IoRkAK3SmzupbS7 guoaerbyLLHUVHJGDCo+YzbO1nASiYnkXpv6LgmaDUzoUul6rCkfoT38xSxV1NI25BTIzqWUIjHp Twyq3nvFIuHiCcD/ADR6vPyrnZDCtf8AM2r3sUmm3QtkVJudy9rHHH68sdUEkjR7P1ND0yYDt9Np IQInHi5bWeQ8r5JRZf722/8AxkT/AIkMJcrJ9J9z6l0n/jl2f/GCP/iAzHL53l+s+8vOl8n+aT5s sbwaP5bMVveahNJexRuGhjnigEX7v4a3UrLykfj9haBxXcNaK1Hyn5okn0vhovlFzEy+sbm2mLqF KOwtaJ8J+AuK/wAq/MKqWr+VvNFwt1cQaT5OmtpYoOEl5bTMHKMpYysFI4IAfT6703GKoLWvI/na WRJodA8itDGZGme9s52YA3DyAqwWi/AQzV/bqcVR2oeTfNcuspdroflh7NGgPqRQSJf/AAXET/3p VV4xhDIAGBLKuKqMflPzOuqRm38ueUpLGRU430VqRSOB7UojGvIGizmPirKCsdab4qqXXknzRcTW zjRvKM9vxna+YWs6SNM6gD0+NQySMirKrndRvXpiqlp/ljzk0mnXcnl7yjDIqzT6xbLbP9aiu5lP H0XQvHyeMRrIWbehoxFMVT78u9F1a2szda/pGh6drPEIF0aD02ijYtJ6MpJk3rIWPFytWNK9SqzL FUjtNOsL6O9W8jEiR3szCpK02Fd1IyjVaTHnAGQXX46OXLNKBBia9Ief+ZPNP5TW0zwPJLqkDbSW Vp8cDEUb4pGKh0b/ACWIP4Zh4uxMccviRseX43c/Bp9Vnx1GPp7zt/axDzf+ZFl5ht7qy0nSjp11 qKWtm16ZTIwt7e49ZYo4hxRAxJDcetd+gzanTemuQpy49hZMQOWco+j1dTdb+TKNM/InSlhnk1Ev GIAwjaWUBZOJUmRhH9hKBh9qu9e2+BHRR3txZ9v6kmwa+A/TayXyF+X0s0du9s9rNdR1hhVpOcfA jlVi0i8mMq0qSGFONepw5YjGwRyTHtTNYlxn8eXJb5Z/Ljy1pHmO+j1u3a60m9+rW+kyzDmBMzOW WRoyChLFVQkAEmlakDMrS8Bjwnm0a3XZskxO+E1Vx2v3s58yflh5Z1Ty9c6VYWlvpc83For2GBOa yRmql6cWdeoILdDsQaHMyWMSjw9HBw6mePIMkT6gxryP+TekaDLJceZZba/urn1La1tzvDwlQo20 gUtI6FloB9kkb5Xh04g5Wv7Syakji2A5D72d+ZvKeheZNKl07UraORGjeOC49ONpYC68C8DSK4Rx 2NMvdc8oH5Ba9a6pFHY6jaLpDyhrych47gxn7RjgCPEJadG58a7le2G0Uyo/l3PaTT6LpDGysLmJ bkaoV9SQzI6LIkrKYzzKU4GtKbUotM1GbQTyZ+KRuHcQPgP0uZDUCOOgN3nPnzTrfTrm2s49Wj1i aL1luLtFVGDh6cJVRnT1F/aKhRX9kZtdHgjiiRF6PsLIZQlfexXMt3r0bRWik0W2h1iDSpIrkNLP LdXEcV4ysSI5aiWEk9vi378uoys83Q5wRkJxme3KgTHzHI/jowvzBpX6K1Way5K3p8a8XWShKgsp KbVVqjJg27bTZvEgJISy/wB7bf8A4yJ/xIYltyfSfc+pdJ/45dn/AMYI/wDiAzHL53l+s+8vJLzy jJ+mY1byNPSTULu4WGPUC1vKGmsW+tTS8ZfTZjFzSPmn93Tj8WBrR2teTXnu7Vl/L5LtY2veb/pb 0kUSo4+FeS7Tlv5fgr0xVq48nTt5Zjtf8Ao8wsbaL6mdVNAY6/uWfmS3pdm5HkO+KoEeS3m0xSn5 ePcO+kxwrNc6t6c7n0Zh6DoDFwb46O3wbv8A5OyqOtvKEtj5tinsvJJsvT00RQ3ltqQMDRiWEy2r I0R9NlqQOJHNOQ7CiqC8veVZIrZLJfy6eI2EM1moudVPFYrv6vcSRCTiqTKpkdFkXmR6I3BauKqe t+VJl9aX/lWrF7PUbW6sJ7bVVke5lZxWR14yUVCAj+opAXcEBahVfqXl/UbFtXlb8vbjUQtzZnTm Gr8zeTLdST/WSY09S3b1ZecnP4PkoxVmNh+Wfk+806WTUfL62N3qIka/tVuZZeLzBBKEkR1AVvRQ /CF+yDSoxVk2gaHYaDotno+nqy2djEsMIc8m4qKVJ23PXYUxV5n588z3x0nzZommJw+omOfVLxz0 ju5xEkEaEHkZFR+bHYLsKk/DMCyHPwwjPNjieR4R9rw0Bnag3Zj9JJzLfRiREXyAe3+XPLWk6XpK 6b69p9duEUX6XluysJSPiUTgFl4N9kqR0qN8xpG93h9VllqJcc4yrpR5D3PQtMitdf8AKMEF8TdR XEAhuXlVayPEeDSFaFfidOQqKeI7ZU6Mpfe6d5sFteWUdvZ6isQiOiX1xKYZEIRVb6wsUQBKSqX/ AHdAyHjQEfFGURIUVBo2k+tevZ3E0zzm6g026V4AyqY/VRDMPWWPiX9GqsFBBLUPtkcenhHcc3MF Thudxf7EVdarc3kXK81OOSMPHDJa2h9K29SYhY0mcGST42PEAuFetOJrmHPPkN0KDXHHEdbKSeYN MtrXS59O0yNo7yRXk06GB2Evrep6yejQ81CTHmqoOCn4moK5DDOUpA86ZZAACzzTtR0MRyXOntHJ camhvltoXTnclY1UyQhygcMqqOY+E7b5s3EVPLmvprli15FA8MPMegz1pLFJGk0Uq1Cn4klFQR8L VXtirEvOv5x6NoNw1jYR/pK+Q8ZmVgIIiCAVZhVmYV6KKdiQdslGBLn6Ts3Nn+kbd55PFbwzlIxI VZQWERWuy1BC7lieI2qSSe++VaLhokCiTuPN3vs/m48Rv6gaI7qQuZrv2XWWq8vLqC30WC7h09f9 Ja5huZVDs1WdZI5Ai16kMF28chW7q8mH97vMgy5UYj7Kv70k8x6rDqmrSXkMIgiZI0SIcjRY41RV PJm+yqhdvDpkgKcvS4Tjhwk2d/vQdl/vbb/8ZE/4kMS3ZPpPufUuk/8AHLs/+MEf/EBmOXzvL9Z9 5Y9rX5grpeoS2aeXNd1ER263IurKxaSF+Ugj9JWdoz6oryKkfZ3wNaH0r80LPU9Niv7bQNbKPJND JCbMGWKSAyB1lVZGCnlDxpXqy+9FVTR/zKtNWtr2e30LWU+py3MAjks95pbTZ1idXaP4m5KpZlBY EbGlVVsX5lwy6glivlzXFmeeWAF7NUASL/j4IaQP6DfsycaV26kVVQ1t+a0d3pwvLPyxrszhgj2Y tU9ZG9YQlWAlKq2/P4mA47kjFU40XzrBqmr32mforUrGWwWF5Jby3CRuLjlw9Pizsw+Bqtx4ihFa 4qyLFXYq7FXYq+ZfzB1+50r8wNfgUB7TU42tbyNiQOJk5K4p+0jKCPao75JyY5ODJCXdwn5Mf8rx xy+ZdKjkQyI93CpjX7TVkACj3PTMmZ2e+7UyGGnkR5D5kD9L3LUpbqK3f0ZNQe9YiO3tb6NTHJLK RHGvKR+K8nYDkcx3jpyAjdRrvid02/K+11DTNGudB1O4imv9Mno8cTcvTjnjSZAeh+07fTWmwyJO 7ganJCeQygOGPQMvnmSCF5WBIQV4ruSewA7k9BgaHksukecIH0d7QTwWkjWsGtvBJbmO4Zogs/Ga NVu1IZVjLs9K8jxXivJSDXRkep2WoNpel6ZeNBDqcc8Kf6FzdUj+sRyBIzcLIzEIm5I7cvh7WiF4 zfVoM/WK6Mog0XRtO0u4tkhCWskb/W3qfUlBB5tJJ9tmNT8Va5SBTcSkGg2EV9ParNEI5rRINRui QvMXE4YxxKwFQkK1QDaigLuCcsOwYDc+5I/zo8zXnl3QLDSdJVbVNQEkPOKielDAqD041FOIIcDb oBhxxsu67F0cM+ap/TEXXe8MtLO6uI+SgUqficmjVFG6b459RCBo8+4PQdqdo6fTyGOdniiNogEg A7bcqO4R5R47SCJ2VmQsKqa7bU7DI4JCRlIAiz1YdmZIZJ5MkIyiJyB9Qretyq6ZZC+v4LQyCL1m 48yK0J6ACoqT0G/XLy7LNk4ImVXT0by1oXmrRre9WNHihKVtLqW2uCAJuSyc4lHIU9Nalg3HqKg5 AkF0Wr1GHKY3z6jiHTlv8fK/e8zuIHguJYHILxOyMVIZSVNDQjYjLHoIy4gD3r7L/e23/wCMif8A EhgKMn0n3PqXSf8Ajl2f/GCP/iAzHL53l+s+8vOvzA1byLEJV1nzprGkvFE07y6ZPOlF5Qw8x9Wh dDRpkXjTqxNKioDWlfLyjZR3Md/+YHmArcPFFa8ZLtJYxAI7ICpik5PJLOGZgoDk8qfCWxVEeVdb 8n+jNr8fn3VtStWjmCxOJxD6N3eyRRFbeWGSVpYpZFjDr0ATYKd1VKLWfy/1Ce50kec/MT3GqQgR RlrpXRDcyLWIC3HpsJJfRYOK0VQR0OKqh1ryMt9oOsp5y122glnKwwTNeva3LXEfrJE4MZh2NwvG tVH92Ps0VV61GQY1If1AQKSbfFt12239sVXYq7FXYq7FXy7+dOh6rD5qvtWe1kOlSuy/XQpMSsrH kjsNkPxCnLr275JszDl7gwmz1m7t723vYmVmglSdV6KxQg8SV34tTffCZEuRl7Sz5ABKRodPd39/ xe4yS+WPPWiFLHVpNPDBZGtjKr3UTQtyHqK7GiB1DDiB0+1mHm1M4muHZPieJGiQw/y75ivPyu84 XMd8z6vYXduyhonKVPrkGTi/IB1kjkVlr71y7Hk4xbhzjwl735U1ObzB5f07WruD6u15GlwlpUlU rurVIUvX7QJFOlB3yaFeW1S31e0+qySQm4aV7i2TeF0Cku5U7I3qslWXck+5xVB+ZrWZLm01G0lV Lu2k9RY33V/gaMhh1oUkIqOhod+hvxjijwtGSXBLiW6prA1Dyjqzwr6V79XmtxbOQxFxIhSJfh+0 JGZeHc16A7CmUSDRboyBFhEaHbJHq2qvCawp9Xtqk7+pCjM1f9jKmGXREerzH84IrjXNVktlUt+h 5EiiVSR8M8Uc0r0/aY8lHtx271RIxBIFu67MznAJZYjiNEV8L++nll/eR81tYhS3i+Fqb1NKfhkN LpyLyT+uX2O27H7MnwnU5d8+TceQ5geV/YNlS3MQtEjVSJEdxKT3O3TMkXZJ+DtoeIZylIjhlXD7 vPzvddkm96HoGlaZe6KDDpmoXdlKEj1C6S5ChJUWpIh9JvhViaFeRod+vHKyd3RanNOGTeUIyHIV 099/fX6Ui8x+WLKxsfr9lJMkYkET290Yi3xAnlHJE1H6bjipHhkgXM0uslOXDKuV2L+0FILL/e23 /wCMif8AEhhLnZPpPufUuk/8cuz/AOMEf/EBmOXzvL9Z95SDWtA89Xj3j6b5rXTBNHEtpGmnwTCC RGYyPWVmL+oCBRvs0qMDWgbLyr+YSaNZW7+aILS7jiQXi22n27xPLzjeVl5LGB6nCQfYH94TTYYq qeWPK/nvTtAt7G/8ywSXUcEcdbbT4IoonSXmREqemnD0j6W6DYBgFNaqqFl5J8/W1tq0H+Ndr5mk sTHpltELR3dmkIAY8+fKp6fF8Xc4qvu/Kv5iXOoBD5qh/RUcttcKJdPt5pS0U8kskXEhVQcfSEcn JmXjX7XxYqzWISiMCVleT9pkUqp37Alv14quxV2KuxV2Kpbov/H/AP8AMZL/AAwlvz/w/wBUIHzP o3lpNK1PVLvRrK8mgtZZnM9vC5cRIXCszqajbvgaHzzoHkDW9L1WxuRewIIxKbp0DFhAlu7ThAV4 lmiVwK7A0wzhY3crLpZYhxEhlXlz8ubPVvOWn3Gq3U2plS099FcEMsiRISNtqJ6zpVdwa0748AiN meq0wxgG7Je36bq+j6gJV028guhbkJKLeRJAhPQHiTTptgcJDa0Rb3NnfKAJDzsRMa0j+tFOBNOx mijXp3whBQV/ffWdMi9eNorqKYwzK1DRlG+61FGqGGZGH6jTjZvpFsRv5ZF5anZTC1n9aGyka5JF uAtyYhM6oyFhEZmcVb/geosyV9Xc14ifp70xb81Py80FBYJqL30qMTPNCpk5O3xM5kPFGrXbgSAN hsKZrZ6iAO53dzh7OzzjcYSMfcxnUNXttd1q51yxkJsLoJFboV4VSDkvqsDvzdietPgCigIOZENx Yc/RYZQG/wAR3V+ljmueTrTUJGuIG+r3Tfa2+Bj4kdvnlgkQ7fT6ueLYbx7j+g9PtY1d6Vdaawhu FUMd1ZTXkAAOXtkgbc/S5vEs0Rv5IfC5b0DyHBpF5osunapDayNLMZLP60twr14gH0pI6KeRWnBS D3Ndhlcubo+0ZTjkEoGWw3qvtH6SwO4Km4lKqqLzbiicuIFei8/ioP8AK3yx3UeQX2X+9tv/AMZE /wCJDAUZPpPufUuk/wDHLs/+MEf/ABAZjl87y/WfeXnw86ebv8QWlkdW8uNZTX99FNKk781it7eJ 4YFQsGaYF2kloOKqAOQrga0Rf+bvNsMmmCHWvKUa3Los/wBYuplaWvGq2oDfESpZhWvYd6hVT1bz l5tt5rlbfXfJ8IjiheJLu6mVgXdA7yUf4UIYhKDckb4qgNZ8+eeLa4gSDzH5Ft1kMgKXl5cK7hbh 4xwo67qihW6/GGGKphd+cfNsXmGO1XVfLMlpyi52MVzJ9eo00aSEhiUCiN2IO1W4iu+KqVv5x87m /WKbW/JphKW6+jHdXHrGYtB69KtTiVm/dilavHXruqh7vz75ttnknk8w+TmtlMyoPrjxBROimweZ nkO1Q7ScSOS/YGKo0+c/NUF3G15rnlCKxluriJP9LmWRolCrEqlmCtMsrUkHTpTc4qmnknXfM2rX nq3uq6BqWnfVFLfoSaSVhP60qeoORcekyx8ftfaDDtuqzLFUt0X/AI//APmMl/hhLfn/AIf6oYP+ duv61p2mWWnWkK/o3VxcW+oXbLy4txX0oa7hDKrSENTquANFvLtR1m/vkZObWqMroVgdgeMiGNwW 25VViOlPbJndv1Gqlk8gl8MutR3EdxbXFzPq0pELS2/L1pIpG/ex8YqEpxqzKBTatNhRq2ieQk3I vS/ynttU0fUb28vLZ7exvLZEo44ytJG5Mf7s0ZQqu9eVOop3yYwyLQc8Q9Sv5ILjR5i8byQTxlGj FVbjJ8J3FStK7sOg3yqQo03RlYt5N5z/ADOsNHu72xtJF1O94xMk0TD0BciNkleUr9v7MfwJTv8A EMpy64YjQ3LtNB2Fk1Q4j6Id/f7g838y+ftX120WyeKK0tA5laKAEc2rWrkk/tEnbv1zA1HaE8or kPJ6bs72dwaaXGSZy8+Q+DGMwXoEws7zWTYzWdnJJ9XH72aOPsBtUkCtPHfMnHLIYER5B1eohp4Z hLJ/GOv07d/zHPbbvZh+XkV4lveNMrrEzR+nzBAJo3IivsVzYaASETxW6vWDH4l4+HhofTVde78c l3nL/eu3/wCMZ/4lmxi5Wg5FjuSdgyu2/MPXIbOOBZnVoESNIzSW2dUooV4JQyr8I6pT5d8jwh1k +zMZldc/gfmP0/Njd7dzXl5PdzU9a4kaWTiAo5OSxoB03OSdhjgIxERyDrL/AHtt/wDjIn/EhgK5 PpPufUuk/wDHLs/+MEf/ABAZjl87y/WfeXnMkdxH5ggnH5dWr6hDeXgtJ4poeCJIbUSXUjJG0STT IWb95STjHx/awNaL1WzvxdWKp+XOm3fptOI5JJ7Een6QLw+lzj5D1GiQ7L8NNxtiqrHYyXljHc6h 5B0xjc28Et6XlsnUMoLFGPB1YRMq8TyIpuDtiqU3djqc0sB/5VXpGpHnKlyfX05WhpKXjl+NHqJg 3qceoJ3rXFVbWFuD5imtLb8u7OeS3tEnGpgwo/1kT8rWJXWNG4c4A7MHomxalN1VSDStXm12a4u/ y3sIxHMkdvepe23CWCYxtJLLCE+KSJrWE/EpOw4H4d1V17ppubi5g/5VvptzG0tvvOltSXg8aSli 8ISsMUjMh5EELRakkKqqaRp+q3KRw65+XdlCIbuQic3VtecUWjx3MZdDLy5GgGzCm1NgFUy/KyyW Hy7bOfKSeVCIysFpyR5hEZXIWRqCXlQK7c96nFWaYqlui/8AH/8A8xkv8MJb8/8AD/VDAfz58xaH beXF0K5iN1qV8yz20au8foCJtrhmQrQhtkU/aPYqrUpzZRCNt2g0UtRkEBy6nuD58lmklr6jFgex JPT55pjnmTdl77H2bp4RERCJ94BT7yz521bQLkywJFcRPtLFMgqy/wAokXi6j2Bp7ZkYtfkgeduv 1fs5pso2HAfI/oexXP5ueQINHsrqO2kuL68j5GwjNWiYNwKyyEgDcGm1SN6b5sT2iKBvm8r/AKHs tyBiAIcz079u9E+f/wA1tO8uad+i7CNzrc9tVYgdrQypVDITuWXkDw/VkNRqhA98mfZvZGTUCx6Y Dq+eZA7lnKPzJqzNv1612zTkHnu9zhyxiREThQ2of9JFRyLmOxVnv5e6U8UE2oyrQzj04a9eANWP yJ/Vm37PxkRMj1ed7SyieUAfwCviav5UPtZjmxcBifnL/eu3/wCMZ/4lkouz0HIsdyTsHYq7FVey /wB7bf8A4yJ/xIYCwyfSfc+pdJ/45dn/AMYI/wDiAzHL53l+s+8sXn/KTyRLeJcfVZEQTy3ctssz mOS4meCQyNyLOCGtIyoRlXbpga0Reflb5DvJY5LnSw7RGYxgTTqo+sgiX4VkC/EGPbbtiqrb/lv5 Lt4oIotNCpbRRwQ1lmYiOIEIORcsaBiKk1piqGb8pfy+a9jvW0kG6itzaJKZ7iogYEFP7ynRiK9d ziqpb/ll5Ph1LUtRa1ee51Q2/r+rLIyqtpGscKRgEcQvGtftVJ3ptiqF078nvIVg7mKwd4yV9GKS aQrEqR28YRCGDMP9Cib42YgioO5xVQP5IfloGt5IdJMM9pFJDbSiedyiTcvUHCV5I35eo321PXFW td/JD8uNa9VrrTXSeZI4pbiKeYO0cckb8PiZl39FVJpy47AjFWYaVpGn6Vam1sIvRgaR5SnJ3+OR uTn4yx+JiSffFUZiqV6TLHFFqUsjBI47qZnc7AKACScJb8/8P9UPlnzr5kn8yeZb3VpQVWV+NvGf 2IU+GNN/Abn/ACqnvmk1WXjn5B7vsTRDDgBP1T3P6B+OqR5ju3T/AMoeTdS81ao2nadNAkqJ6rtM xQcAQDQAEkivQDLsOA5ORDq9d2pHTAccJb+6vv8A0PZYfyO8m6bo31jUZXnubWF5Lm7lleKCqgsX ZQ1VRFHQMOniSc2B0kRHlxSA9zyWTtrOZyMTwxmeVA9K6q0GieXrTV4tUgsDHdX9tDBaRvGWCLHG w48JXWjenEBJVh27k5o5ylqcgsgRhz4Sd6lXUcudVY89mgZpjH4Y+m7r3hEy6SL1rC3vNLt1sNPl 9aGJpzMiOImjX04WhC0HqHuKU2rmXH0EkTmb6Gtt+9rjDvASnWvJGgajqkJjsLKSK1ikF1Zxs1tL ymKmOUmH7VBEwUOO53yGUTlDaXCb51xfDf8AQ5OPPkxn0Ej3GmOWX5UeWZgb1tTl+qXw4WVqiqJI mZBRZJv30bSBuVBxA2703oOWUYEiN5IH1R9VV3x5fjv2cvJ2znnERJA/pbX+r5D9KY2eha/Zaarp Zz32m29IFuIYwZqRinP0Y5J2kjbajRlmrUMopU9Lp84nAEAge6nCw63h9M/mp2t/Y3YY2txHOEYq /psGKspoVYDoQdiDl9uxhkjLkbY15y/3rt/+MZ/4lk4u20HIsdyTsHYq7FVey/3tt/8AjIn/ABIY CwyfSfc+pdJ/45dn/wAYI/8AiAzHL53l+s+8vIrq49LWkt/rPm6D6xqN2/1M/wB/PwlsR6kLepH/ AKLHWg+B6p6m/YhrR+uR1vLP9153PB77a0aqp+7kHxN8VetIPj7jfFVrn0PLlia+cLbjBp45OfiH 74D9+KxUYdJx8NV7HuqkGlD/AEo/D+aJ5Qw/71NSNv8ASYhtv8D9n+z+75n3xVGol7f2XmIQX/m9 0uNauLU3dlGA6MZ0ira1kP8AosKqYyRWlGb4fs4qibV4dQl1S9hvfO8tsjMRBC4IElpczetFEUZv idrbjw+E8HUD7Qoql9lLdsk8FzJ53tpNXeS+M8sJthE88xtY7eJmuDwkSFuaxVJrxelVCBVOmvVt NQEzw+epUW5jVi1Pq4V5bxCzfEtIRz5ueqoIelKYqzryhpItLN779IXl8dU43NLuQssYerKI0LPw 2bejEeG1AFU/xV5l+ZvmP9DeSNYgQcp9WvZrBO/FJUJlYioNPTUqD2ZhleoycEbdlptL4+bHj6EC /d1fO2aF9HVeA48vTfj/ADV2269skIE8gXDnqRA1LJCJ8/8ApJk/5ZanFpvnvRbkBwsk3oP0pxnU xV9wOeZOlPDk3sW6ftgTzackGEoxN2D/AG9/e+qXVXUq26sCCOmxzbvFPKvzJ/MHSdO1NdKsAtxq hmiF1dt9i2VJFbhVaFm+H4qnpscphot5TJJ4h8vIO80XZWTLjOQ7RAJj3yP6lDWYpovME+oQ+X11 ewvbeBJLouskYKc/iWMCZzVHAPCM123zAh9NcXCQ4Eud1aP8sQ+jdXdx+hU0u2MaqLwlY+SIWdYl hIDpHGZX3bjvX4QKZDLvQu0w91JdfQmPWT+YMd9bWmlafD9Vs0ukkmju5leT44kjeLif30qK/wAX 81CBmx0uIxjR5lEsMsmQQgLn3fj7U20r8z9K836JdWiQPa6tEnrS6Yf3ouYoGEk0ML0X1PVjUpxZ VJqdqAnMkxI5sdVocuCvEjV/jos8yReVdcntptPtLaLUBALxNVVIpEEakCMMm6TJIC32wQAPho1C LY4bNW62WahdMF/MRtNnOjX1nZDTZb2xjmvdPEZhMM7AFkaJgpRgCO2/XvgxvZez59Evew/LHoHY q7FVey/3tt/+Mif8SGAsMn0n3PqXSf8Ajl2f/GCP/iAzHL53l+s+8orA1uxV2KuxV2KuxV2KuxV2 KuxV4N+ejELpw3Kte6iONdi3+jkD8DmLrhcHoOyJ8Opj0uHPu6/oVPKv5d6Fa+XbbVrl7a/vrhY7 kyzlmtbaKSB5RyUFVfj8BcsadtupxTp4wG+8k6ztnLnlUPTj/HM/oT+PU9Mggt7a00+WK3a3imZy TaSGOaRkNAlCTGE5vyKhVoa75HgkSbP6XV8QSi4v9Bg1bylr+piO4V0mSP6pI1zGLqkLw3IaHmz2 8foSL0oGdSQu5F2OYjxX05Xt97E3tR580w88/mhqNpHC+k6hHwKyLKYY0ZC5T938bep3r8K0PiRS jW4c0skxHYH9H6HI0WiGXLGP8JP7fueKIlzeXPFQ01xMxJruWY7kkn7yTm2nOMI2dgH0CUo442do h6npeiXzeRTp+k36p5lhukliMNw9uZIHRQY6u0aMUYkUP8u3XNdHUYM0r2LxGfPA6s5JxPhd3w8j 3782K67oH5lCUQaxb6jOkbceR9SaP4juFZeat9Fcy4Rxx+kAO3xavQRgZQA4wCQJXdj3/oLIfzwm ayutG8uW7/7j9OskKx9P3hJSreJ4IPvOSwjmWj2bx8RnkP1cv0n9DzrSby8stRt7uyna2u4HEkEy UqrLuOoII8VIoRsdssyCw7rtbDHJp5A+Ve+3pumec7T9Jww+Y4E0KW1gja2aBmmE0U8aSLVBbTcF 40IjKn/WFN4GRI26PBQ7KySjLJD1wEiPPbrXx6IX805vW1W1lXn6RiIieSlWXlUHbp16UFPCmSqn eezUrhP+swnF6Z2KuxVXsQTe24G5MqUH+yGAteT6T7n1LpP/ABy7P/jBH/xAZjl88y/WfeUVga3Y q7FXYq7FXYq7FXYq7FXYq8188X1g2j6np1xZw3g+syzztO8EXoxsRHWF7jYTunqCMruKE9aAy4b2 dji05zZIxuvTzon7kH5Z1OKPRX+sW7fVfXndluKC4jLSNKBdLIFUULUEpajUqeJqBr9RpvXsQuaH gyMDUvMbscu77Shbta6Utzc2/qF+WoXL3VqWZi7OiCWQT8mJYF2KVoy1zDz6kYzRoy8v1/qRjwmY 25eaWXTzLFcXTO9xelCzTyfHI7KCVBpTavRVoB0FM1niHLMCXK/k5vAIRNc2XaVceTp9Kllt7OC9 gVaC4YJJLIHma2QuxHIF5Ff/AFR2HTNpO8Qu+EDu8hf473CxzuVj6u9JbPyfYWk080BMZnYkoBUI lahFJNafrzS6vt2eYcJHpHn97u8mbLkiIzN15Ie+03WYDytoI7hBufiPLb/J+D8CcqxanEeZo+f4 +9xTGS7RvPXmfTLpbb1JIanikD8mQcu3pycqVPcZtcWqnEXE379w408EJcx+gsc/MrXp9b15LqdU SYQqjJGCFFCafaLb986Ls7NLJj4iKt6LsHB4cJd3F+hCfl/Z6Pc+bdOGsywwabHKJZnuSFiJi+NE Yt8HxyBVox3rmTmlQpr9otSI4RjHOR+wftpnf52eUQs41+zSMxz1kmkRn3jAjUV5FkLc3JHEglei /CzZHFKtnWdga/gn4Uj6Zcvf+1gCXq3GkWkZWk0DzK8m/wAatwZSfcVIyyqLvsWljhyz4RQlR+9R xcp2KuxVmP5ZeUrnXPMENwyEadp8izXMp6MynkkQ8SxG/t9GQnKg6rtXWDDiI/ilsP1ve9J/45dn /wAYI/8AiAykvG5frPvKKwNbsVdirsVdirsVdirsVdirsVeNean0yz8xX9+FOoau8/pQ2hLRR2sQ YmWX1qOA8oVU+FeajfwOUarVxxRomifm7cZshxDFAUDvI9/cEmvvPV/Oq6aEjsbdQ8ZktxInw8WC iIJxeF49qSc+J6cfiFNScg4eIC5Hv/G7UMZuj9Pkxi4vrj62z2spW34gohFCZCzNI7Vry58h1Hjm OZA/Vub3/Z7vJyIwPTbuTCx1X6xKYnj4kJz9QGq0FAa+Fa7ZRl0/CLF86oj8Wzhls0a+CGub+2Sd 5rNOFySvK5Wq8/TdZFDcSC6ckGzbbZbEyiOGRsfzfxy+DEwEjYFef4/SnVl5ntjQGWS2busn72P7 x8Q+7NZk0l9AfsP6vucgTITu31JpF5KqToKcpIHDUr4r1GYU9PR7vf8ArZiaL07QLfXEEl0xpAyM ZEPxiWiyUjLAhVCstdtxm50WAxuX8O4A7xyuX426OFmndDr+OTFfP3kbSbNkm06+abUJZVWaylkR pOLivqADiQqKOlOnTsD0Wn1/BH1CoAdHO0Xa08VQPqj3bA/jvvfqhtO06CwtvTWhJ3kc9/7Bmh1e qlnycXyDDJkM5GUuZ/Fe4LdOt72+uxFYo48u2iyXusWkal4p4PSkNTGCI42kkCrHL/eVq67JvuOz /EFiRJ/R5fjk6nMRxAw9Jvn+nyQ3kjyVq/mi3uzphhRbSQGRZnZf70fDxorV+wc3c5Vzex12thpj Hjskjp5f2sm/5Un5x/35Z/8AI1/+qeR8QOB/L2Dul8v2u/5Un5x/35Z/8jX/AOqePiBf5ewd0vl+ 1N9G/Iq5MqvrOoIsQPxQ2gLMw8PUkC8f+BORORxs/tAK/dx+f6v2vU9I0fTtIsY7HToFgto+iLuS T1ZidyT4nKybedzZp5ZcUjZW29pqUFvFAlzCUiRUUmFq0UUFf3uKynEkmj8/2Knp6p/y0Qf8iH/6 q4ouHcfn+x3p6p/y0Qf8iH/6q4rcO4/P9jvT1T/log/5EP8A9VcVuHcfn+x3p6p/y0Qf8iH/AOqu K3DuPz/Y709U/wCWiD/kQ/8A1VxW4dx+f7Henqn/AC0Qf8iH/wCquK3DuPz/AGO9PVP+WiD/AJEP /wBVcVuHcfn+x3p6p/y0Qf8AIh/+quK3DuPz/Y709U/5aIP+RD/9VcVuHcfn+x3p6p/y0Qf8iH/6 q4rcO4/P9jE9R/LOO/v7i9l1ArLcuZHVIgFBPhVzmDqNBDLLiJP4+DmR11ADh5ef7Enm/I3TZbqS 5/SciPLTmFiUAkADkfi3agAqewAwfkIcIjZ2/HcxGsAldfb+xuL8jtNR+TanJIB+w0S8T8/iwDs+ A6n8fBMtdfT7f2Iq6/J61uITEdUkVSRXjGBWm9PtZGHZmOJsGV/D9Sy1wO3D9v7EH/yovT/+rtL/ AMil/wCasf5Nx95/HwZ/yh/R+39jv+VF6f8A9XaX/kUv/NWP8m4+8/j4L/KH9H7f2Np+R1kjBk1e ZWG4IjUH/iWH+TYd5/HwQdeD/D9v7Edpf5UzaaskcGv3L2zoVS2kijMcbkoVkjpxfknpLwqxUeGZ P5aH4/HXq43jDuPz/YqXX5VpdXkt1Pqrt6khlSEQqI42ZaNwHLlvudyep7bZRPs/HLvBPPzpthqx Hp9v7EPdfk5aXMYjfVJVjrV0WJaOB+y3xfZr1Hfodqgxx9m44Gxd/jyZT1vEKr7f2Jvp3kFdP8tz aDBdoYrh5Jprt4eU7SyPy5lvUoWTZU2+FVUdsz4REQAOjjeJDisgn4/sXeQ/y/tPJ8d6ltdyXQvT Gzeoqrx9MMNuPjzyyc+JzO0e0paoxJAHCyvIOtdirsVdirsVdirsVdirsVdirsVdirsVdirsVdir sVdirsVdirsVdirsVdirsVdirsVdirsVdirsVf/Z uuid:f75d4969-5dd8-8341-a9ac-f2bc69dfeede xmp.did:af2e6f8f-0f7b-4a66-9301-9592d69ed442 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 xmp.iid:a57c8f4e-5688-44f5-888c-83ec880f48e1 xmp.did:a57c8f4e-5688-44f5-888c-83ec880f48e1 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:9eeb8828-6dcd-4786-a099-ab23f428b955 2017-11-10T16:19:46+01:00 Adobe Illustrator CC 22.0 (Macintosh) / saved xmp.iid:af2e6f8f-0f7b-4a66-9301-9592d69ed442 2017-11-10T16:39:29+01:00 Adobe Illustrator CC 22.0 (Macintosh) / Print False False 1 210.000000 297.000000 Millimeters TINESari TINE Sari Regular Type 1 001.000 False TINESar; TINE Sari.fam TINESari-Bold TINESari Bold Type 1 001.000 False TINESarBol; TINE Sari.fam bromello bromello Regular TrueType Version 1.000 False bromello.ttf Cyan Magenta Yellow Black LETT Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 PANTONE 707 C 2 SPOT 100.000000 LAB 80.784317 27 3 LETT SPOT 100.000000 CMYK 0.000000 89.999998 0.000000 0.000000 PANTONE 707 C SPOT 100.000000 LAB 80.784317 27 3 PANTONE 186 C SPOT 100.000000 LAB 44.705883 68 40 PANTONE 186 C 2 SPOT 100.000000 LAB 44.705883 68 40 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 6 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 7 0 obj <>stream HK% DwJKԇ <6< zD(R _1]ֻv\u=b_^}bbkѷ?_*WYy_?^.mѳ^r~}%Y#5'}Kkݭ٬w߁RwJ.scǐ&f4,w0qNq^/mŵ߫Wv 'j#=x^a/\y6\{۽z~}]oSni뒹jȜ:.8ˁ]'8}1-󒹸kl69u;Ơ.];G#,峳n00ﶘ0qWiL`F]5!ѺA:(Vh 4gy'=?ҁe$ h>&O[O_o3~)]Ɋu&.B3 3#ѕO HuFNvHtF_tL^EwҤ6kb]ଆ4|BUH̢X=>ÀY5<Pkr, M)HVQ˙`?8 &;gk {$$'g<@Cux9@ﯿTwu{jϪƝ2Q;Rclx{%eԉ{ Ѡ~77|n fS1:6wQE *sҐSR尨cU ?^SmETm@Kdm*`)MiH[>tҩ|݇'7|m Ʈp,P >)+ňɾvmj8ڡw= F<k%XʔxKxڒ?pXE)(]lN:aLA6ƲѓEybB7Uz i7-LnG.5N =,uUII1% )m><=SzzS][T I\ +&nAv+L5՜z[r{uqs^?KW4ZcK){+tZOѰ\J?O: :L+%zfuE=#TY~OIPj񄷩a~jd8Ԅ t# jaKtTH$8ժ:D,it[ExYݧUE|NDMVQ ׁ_fE6̓L m+:̅RD;t'j'-Iv(ozBM[ћbqt!HL]m1)X};+u+GBŬtKXL,ݍ/bQa3cĚz Lp kkW6^Uf wD~8<(~JzYK/=,[HO('-^uIO󭂲o!nyv4ҨNQN ma4=Pd ]SIc'D :8?.9r%u@ <=HUIPC$`0HlФхt3UiUd6sVbI&FbE,CQJ}M$#c ?ZKIoanZRkp^׃e O0+lub|(GC@/f 2#ZV/iNtr/!0[0EV %^cJx$l-R^V@Sxɐ#y=4>]\9QwZ:-&G'p59=M&G1 kuàoɍiˏaCOQu8cA@Ew̗,Eh;D:Uݠ$ /Y6-{>z<_o4:m1[j. F)`{<>ح^.S`a1TUB% oʹwJ2 ϳܟ;qզwĆDU:dF)U]u܄A_Y%TP䇹o(M1yHUzg\X6]ԕe,\m'jxT +kvsd\b j|fݝ1 +m4;d~ 5)Srȫw#&h6ېpUgFOp@WWs{y2ǺDvXy 2@Y\_ϕ#: t)ݶP~k 5m7&jm84~DzaǺz8$#m(jGʨꯥ2ZIIN̒R"RCm14<~hЊ:>\`% :YL٣|F]XoզS o_clYzHV,ۀ ?ٴ[஬CX{BC1IDտ;IP7*dFoYZ!ROt`v 镵tWwyQ-'0zK>ҖVmo|&BsUTϲ+5j%2:pjGexߠg' uC[⊉3K']S`!濕&%ꝕ P&߆HE1`gR3eBDNw[f8|L;4[=pS\ 7A"zs-WaRtG%Wb~D`"V$[ו,I+IFl'uоT'&ބH!Ԩ"h5M-+I W2xM򓜘uS_A-~EbQsOa-VZ wo}AuaOI9|9Use.Ϸ#)f3";>;%mъOIciGnRo||ܽf!'M,wgJRgK5%ԫjvB ? Oc[P1P jᶉ-؛k:ZʹD]> ^~)ʄfWQ{Kͨi1m*q_tj1"sBEnի)um.тtSuIMc-hfVPf ¤|$&1s9L5w x^j_z䏦@tHwS{;יftțR[Ԁȩ=&^{u&~Y_/Iq]o-O_} fp[aXdlS1xuBV6o3cqz|t_C(tvB0bʝDXHK¶#-G\C+ӧ.2yP;]ƶN,$}eY,52ark6tFk/P'>8IejQ(DBԁ=|LhLӥ*gJ%,ui+J%eL)RK6(nW{Py.%r $Ծyk8gEQ k#\ 8vr@3'Ob7սN-Ig%`lrެjFͺ~;6TV`LQ}nvw=N"BבU" s=ud+PD;d΄1<:,99+o lnc0m̿6][sȊ!w*ZOɊMkPc,ԎXLk~[ǭb3X3<"`1:z\?EC#mַ8.;?2.t|Ѕ3=xb_M='#d:(ϿHw# W̖Z4|`F{Eiw,ʏ1jdevT2?mCcp=Eqj54{U;Raև2*@TYuAdN O"Uԭ8lbaǔfowE6Cc_*\WFHcUw],]~k_46j"RO`ӆbǡi#'ou%RpEY$k3WVgQpsFsbA ,S17d9 + a%@V1s}B`1"R@?]o{1f@|O{P&ݟhQ. ;Difg{lŷ9#wF8ʂ0М  QKQ^)vQ0\is,dU Ȟ[' a95'CUf3£nbbRM 햝-%~-{ǖʀIur22'S_6"xeޒ.x%c +zٱLWֆF`UVl5ֽ썟ؘg1i~#CLheDF\ _(Pj8{p4ZޯAҽJ ҟ,r!2G6Ĩt!9oߡE2,Sܚ:EI>s7~]C|Gcab{yށw~!ZJa=p_F>nP%I Doj*Nt'`RX5A◵d:]f+b\Oj5^Uoo|5@YVp:ت0ˆ+L+8dVW³!<{իPlt},Q8tbO| ۘF Х ԴƎhL%9/΃# o#v&E(I¾qAr(=6cfo,.VnDu 7RiAr$Z[ͅ.hç)bvlRz6`:f++><"S1 F8Lf:,z5m5xByMkB K>SIx LRB99JaDyLLAz\LdiBkF\_Qh0=V|qũ/wJ>'1^zV S'OBw,)˦'{edG26B]bRdsZvrƅ,CȷO)*|tQ~r@#h 7̣b,u.&5`ѤD%j!#I zژowEQ2W3UPaK0dI.G}{}hDU[U RU}{2If1~^b`tdc-r~<:_ ZX3ksz EjݦʨBuc p>ŢϺ=G9:O; aVP4QO5NM~\ѝa%V*:}K溨̘}dR4e;R.AؤYP7/X6ղd ,ÜÊjk89xU}=Ԯᇔ .oF_Kdѣn\M*wt  0-~=|I|𯓇O'-@5ݺ.û= xεy/z 'Irwlw|>xϿ>/ xC|O .M7Hx Tyz07ƫ1güdƗ1ox;7{ Gfnc|ė!^޿ksݐn«x hX+iToetg{x.mRX;=;Idkr{"ԾAB*VGM.8ss _S>O㵫rv'Z AwIMU1Sr"/(i~`5fNmoRtioN:>Y1 vE$J5U;QVE/T`믕lhapU B߳3P)F4} F0354t>s5\JhIjsc ]׽Z kn6:ot#K5Go`s NhZ `FE_zLL:C> %.7hɫ$'ݢ TE1)/iT@{@}9 *#^ :4*7.&Cw:ԊNW1d AbsKM6:t5n :iߕJoLO^=qK~ 3ilT.\Z [Sf4`˿I/]$u-J2[&)ې(Ʉja6mF;Z?O1X,.3oe}Uk\}K@j7rȾK]cnTi&oD9off 1"Xˆ4΢jADj2V vWbDCkA vd71*kH 1dEcIP-=.b$fd͠gg=e?:/w` ff߾o?JuwɢfQb#5{.C[#9y/[ۿd.^û|T;?p9-y֗/Z$x?uM~}e8v/uR)+?uBL^,SvTa}`'yn}$ ΔLc^7`d/+;ږ՝aae %R]DPQNna 5?忧ת[*^lS纭YYoh c*辯{h+eҧzͫȁv2LZa֙:|/A sH0YS_ j Szg%PImȏfm#絗|!:̬GW]V5W7rtX^ƒ][A6R_-75Mz" e:{L Ѵy5$k rMG|1WJV!'ߧٛ&P .Lڮo Sl+kԁ=`=od}wڐKuTPbQt2d@8}Ԥf84rrb(;ȩԒd024` pՑَa/fr0e?z:\*k. M:Č+A i2$G)l@aYD['|z$ץQGf4e1D.p~J0g A}*$abz߮δ&tZJ}NБ2Y).u1wHX`,Iֶ!c aZltk  ;41}@90(Am,ÕKUPA]mI_on(CCDx}^*Hg~o.BnENMWl\){ETTDQYhJ%+>Lk]*@#W&x\vgֶ.rБBQUq<.#P *708:nlD&e6ѸKu|?CHFj(eD /Wgӊk@+['͝if.oʞy0%6?C$-?GKԷݙ;aXeWLމ.Ee뮽7{u9<fÀI X'DhDLq$_mUkhuڭIj]PBdɽjĉW$#Rf.fv5aIVDBUƛ@ ӝXbޢ+r>RE2đ ;OuRccTɟ kMT\ƿ~W*yJ}rWUaQo޷R Vw[k{+t^٢PLe5d W_m>ͽtQ~˫}K t2 s,7 v> d9-^p~mp?0nX,L[U\IX%q/R%3 ?lI]9C繊@x#U5|j`x9Ѭamct`ADܪ {km#5tͲBIXYbws+pe:QN{Xhhl"em[{UB:8.*n>N;v7e#s`ڷK$8}N&g$QѓJ4Eo"=4!= fI9}9 b|N Ռ;Ǩ24A[ Y?Y3 o6V  uz90'}!O;@ҚSB(߯D1L7Q/TH7K`_Ej9﹇e7 ь{`r&7}z cŰj_m#625P Qǭ:K 9S/ {$&?`KB+蹁3O e©~ HR׉5$|k@OB o|8֖<~I3raGv5`.Q&eko=)o4_ҕ>쪠+Yѕlpmg>F],FK4/k7_;}g %,Y7 k4uuꏣS)~alՊc u]fHi53 c5u xgPL ~ ll {‚m?a4QGAT7? UEͣXi՛.Z*OI4]ݎC>଎YԋA6oQwz\Az]\y[@8* ^PjV(iMuUP#j f&>.ÈtD-n(5cPpi`*==]j"͆$bZY#Pim+U'w"0/p(x[?Lʝl9tXg3in6zC=m!8D@sɂt|" c<IJk@ݘ^zGN 3|HT]?5-/SPxcc!kԋitZv6<[eTjsՉ } m+{i=*[< ; cͲLHͬ;_A]WsGu^+f O̐Bz '[v W 窈٤f?8F_ mnulmǭr=SeRV>7VK/>czEw r:!ԉKkMP>uY[?OOJPSmŴ6=Q0Ha8l*:P T7E`(}K +P `~B2=“dj[ڿi}˽Fv*(%'H%E`ZQ (=g3`*(jHG(IU%G9ґ׊QP~ }HnwRzx81z1Ebv!tų31Aƃ48@Mz^c:{椙s(#9U$"Ń-];>8s5R':UX|q<3=aiզGкB# 5h<5V. `E/=(9 As(2$a+@F->E*ޙ|J uO)īlkefGI3UW1wOf*.G\;1}b!LCEj\RUGb߮4<+WWAJHSׁc )Q ^Ds5W9R 3EK!*u|CvMwq  O(|z5C3Z(u*Ld@p2f%#"U\w7bQq_w}#(^-,i[U1^;)ZVdY:iwi]hӝ0 cF&KYG0#]=Z.n'U#5w"d򳡚)K%~Gz.^y=RWAC"WoE;5楃XG }BF=0X[.2^CV G =,-ԯ ,yf d~Ȁ>S]$R;[0Z &EeI2cXTDId %'ޤա,h ЇScLX|+/!%>dA>&v~(mYh AWr>yB&Nj͚uAjϪT9 Lx twxv=U #s]*ImJvr&yarm#Ak43dS UTRIUM?2ZSKx@ZMf> g֊1C <1Vz/Û.$ s-ՁA=a*]* QEo'Jw> OiA$45hD)9l;$\q=o"xtld*Vd?bpi ,N4`UU!/`,.vs'.f,r.3FVM&LwDm;N48z;p_z^2Z[ P.UմuW[6~sWg">DCǾUr\r~,<udi\nXZL!%"USHG܀JH˘[ De'W7y9Hq;b%&C `V669Ņ8(ͧruyc\Q2/™&ReUd#\@jɓ!~z9d"o=F{r}3{~鉘v0:2W Εqubrݕ;CsT3P}(Q<,-e(Cb{KʘW_ jLc<̋Ƹ>#YHMA UuWqumDͱb~te)"fRqOFL,)ё#wWٝ0r*䐅LQ7ƄG2u}w8am# bW{Z1kÍ՗W6Hحū9rFe@&Qo`S)bݹ.`nK$?2"V=hz=u`k1ص ,%3>>='h#;13>d^dGT3?Uݜ_BLdԖA 5PSKҬDH=9~D[ȸQ]Z%7dT!9H*& +Py]<1ԀɔT vFWjVR+îu"St7ҿ;b,O ^۸!AdEV "CuV܂7L)ڒ(6yHK<]$IXxdg-1lٟe͟jg wC1Oy]dq*_2ryoxV1 vUt%n+]|hKHctt7%)z\5ǘs#H{Ix!Ҏ :ޘvAĚ^ѕrQVX,vmy 'Z#/?j!l,W6-wY8.=ҶHst7U-Å]sbd^CԘ2*}ܾl{69e)vFIH`˖(w/K$]qq)yIFyߦtDȅ3%*+F 97Rj./HSDk̚zkon/ե†s j_.@@5U>8IԴZgbe{YOy@lD}piH`Pr ;T#&Tb`~fbܷ}NIn=4? `U!H6A^7el35+Ou- T@Лx6[ᣭerrn|!E}^8wT`:\1D'& "={^PMhOb`mMhDs|at~Wt%A`єϐ MI\ f!0 QFWC53cO>P֮|u(Jnt2.WgR!p"p?ȿ='XCˍdt(+"cО~Ն 1h|ZZBk&Q}RJƧ@x'5=gEJ9ʽoc5Xm ̀YԹT\tʓ Zֿq/$)nкQafӌ kYP:tBtݞu˷v^aRIPXYs5E%Km@tb\աk,IëQDu+ .UF(%q B[X%U/˸ N揕:â&ț*rԄA6[TKso j; ɉV5SZ Cx|9.-uYQ, EDDQ}-Z(7?iD~ձb#>=H.P0&5-n՘Sd<'SU\r'HċAƊ@-Std _CCsp&60L`7{(z/'ve DɌ=O,ٸ-drִSŏ\ktݙTnPe Rn'fE7Gv:Ԍsxtm(Ydut2q>d52]PJL D..A g*o0,*%c !f VmPmstun0ƒſ gy q_@5!ű3d:RENGiU TƐctEڞ6بMIcS=SX A+3n[PҰNٶd׽GB7&&j?g3oZ5G&kzcxfsZ,7ɆiOȎT'bv4wH~*] =Z샆BI$Y]gJh"qr>Z$EǜXܤ/>âQՙf0Ż:8m&D 5$TM6(|3&z{'zBGKzD r] U>ѷ)$dNta^ZBdISd0 {oQK{npSuNAɟjPpet'*.oΞltWxk&: '0b-۬y̘ c@̘pF7,5O^X|̖^ܝchz-3 ͎xe Q*H^\`ރ8UQNJ&[RjDFCz4Q%LZA5!EՀ&myBN" O!dMϜ֜*6n/叻1?̈́л_*/a>6o7}!d3#P\ej ۉNGK8}`R}Ry"V|sob|V?Xx5L䒆r^G{Bh=RZBnFdp 4yƟ;9#+7@7hS kN}m!+:zk>({ e|>J :ֶ%pqOn&%ٰWH7li{S+̙A0o{F VXپjq3##Lx8Mxhd߭U  G/W\έutjn |s.- .qnm9dZ (1,Kl@@ &R)dPoʲ&c˿J;;13Ej6r,#iB~Znw81X Ϣ$[^ԗ9 7u2T?)d(]%)Jhk䥵@z@nCh@_@ l,D;Ԗ}wDU5CjMgz6;NF{oܼixiQRPda-Bfggͥ} Q0F~gy޹>L2kӺ;?dNWݞ!%Z[>R>:h)cxMG瓲 /F0ʚi Cd`n5Ãm+,rc"dyLa$U:Ғ\ r\9HY& ONeEbǰl~ex@K!$Ӣ.2v+ S^d- aEdzKh۾ }Y$%;_'Vτ y.A pڑ r EU@a%GJ WF_lw÷J4=OyqzL 5Y̕CzXSqOrtvVR+]&1iD4AeB聴e=Vz%%_:O )%_Eb[PuJ.KHfTs"ّ ,gj/cJYF-3@ZQwZ눺NZӪܻ́xUH D]@qR 0%]]C91UYH'nvJ磕69WK6=gZ]JiC| .˖wwPs 誀HY4yk5e_yHghl}S9B0ݡ_! q Xυ\kּB:~%;K{/ɶ"⼒mTwҤ-*_H2VP*f5N-mLwxՑa]́A#I 9!1Qk dZ>2QجR/#R kߍJCJ  ]i7/{1:KʵD i8m;C mE/t"(.|RI8b=)f]J6苛>LJm 1:G׫T%aZf?HRCԩ$阮g!}]C%(%dƚj0$I\KIH*^9JW f _!ǶD24JJ.oKJؕ&8"KguM Lr2Q`QLQ (M?ɤ'W2j $Se)\v 2/0X[=]ȈA0@K&gUX1gt&acٍلvS$8k7ArTfXm 2v47)En6[\U1(-' DgS+7ZNAfIEW{m_07*eM7u[g4lv:-u Zv~=k'2 VxiT&c'|zH94[Ӯv6RrQPgcz|OEd4^kّKHMfL9rX6AǚEY4eIƞЉFc Oj$,Fm@A\z+08ɱ2iܦ+75,S1ej_?Br2j]HgckqK'1"qD왌u"Tq%C}J!~kl3K7@~p("s+EZ ]eJw yHnsL~r q<fe 8 2yB_&=W:jFDwS[BOyF5Uhk'tJk=XP! \kciVJ譠hUM6h&Q2«"Z}DӤK'NAi+O$Ե4'x$R0P3$/)@[z|$Arb]z4TUsH1["Ibhߡc ͹BИ rʔ:2}y=@5NU!j{;WlUhq:mQxCaq,i idP֚M4-5W%՟]o ɳ#(3v Hu yUVL}[s(nŠ.nH0IJlCЮXFo_&rVw=uw];#CyPeI |ٿ0-ˆ5VDwFeʱIv#b8LYV φimywpѱxܽ!r2Ec|j`sk6Jkcs "2 urŰnY_l& 6"|jM`(Rv*aOFyFHTcxdA$q6P_VUY8ƤU8FًWu0KO,="?* |={̝-U`O=t_p <`Ċ|&XbbS+C@#!C,KPUp%LurRu-AEfy{O\A ;b%~ܲTdfIXqٞ2ƞ*(O6+I2 ,'ݗEk|N۴$ғm,*v#Okz-PqKF'nn9'xKm2=@B8=YA]q9`;ҍ|Re9,H!Y(//hiMCM:>YG^~e拍Ί M5q 0:=(^ I;3dkIrDɑg6S:Ew_I'e]U$j]2rvtX"y?IOpgQЪw>Qd8܄/ (Ukp6= tھ-:;\3revoij`I?^ Y44/}KEL/0Pjs9怬d u=OIb.d@u!ފcZCg<R{;xZNS>5AÚ";!t'*7֕Pcڜ3iڔAՄ xzЍNC} l~ﳳd Vn&VF ՒhjyH5V?AQi/gm5J-It\-dR%E/HuX'f6G@pD섄WB0w:==*)YYoH 5aGB{&4 ULZUmٌ14Zh-*o1ҤUςR^#q NUCȉ&Cd(، R]&Bcs"xySɈL>q+UG/c\C3`H|F̅m| LAH 䬟w ʦGر_ -}(=sӛݼDaz{D\8k*.Kh*n<(lB3tq"K.~p8pPt6,~%!5ev2|yN]K:RUL FuDT`S[dN\`nnw}uko:Jn{:NU; M $s,Z2j * TM-@ŦBǁGs]NRǑ ]-ASP]3Uzw2-@cuEC}ӌ0BELdq:U\i\l,)4 jȌ2h3%S5# yJEefvVs4|`K/-sJdm h^Hܕ4$g;3Жafcw`W1t[L- ufgS[Å%X?J|B;f:ni,ZXfc$d [ryGݮl:%JGVw zr?5mfJ=͞8T/ULy\sr,ḩMV8?Dؠ=Z4I\^[$BZ4h@ _Lb}`e>?Օ!ꠒ@Nn( :";TVhʶP*!UCxՙms0&Oi|kjK4W|2 P @Z \Ԑzi0%iJ;2MPrtPUjR<'\av,fm%6W|ąeuJHK,Aa1?j.m}'[=59![Em +ר)g/ _t&u.-r2o잫Tp6i1vUsjW>}8d\rfb,΋ Q0|0wHnV=[u;)粿$?0Qౠ6ްaV[hA#(7Y}PĶ7.ۡc=-(zl5w쨘% '/֋<=Ʊ= 5*]ft5^XWBtD=viqk 7Y=턖%^-͊Շ 28?1hNo5",!QE#ìնu74I 0Ŗԝ1*k7?1~i*]s4q KT4!S`v`{.p.0sH}w01pLnK>8 u_ϕzʌZMݳxh[J5 B6xp# Qb29gJ *vJai TM0jS sH|(\lżA$.Ԙ b)Vx);DmoB|]-ٕ0l+YO5>ӳDؒXOuOyVIhi^0sHM h̷qP[32G\?!l ֚"`̣S'Jhd^vIi*'%Xɵ}Uڸȡ9^8xo,?Grڸ/ȆR[Y/@$)@5u^5A~!U#HCu^) qrݬe} Dw2ٴ>hz0~%m_ZBQE ""28}:qi](Z9:F9@nC]>ۧ_ШSa{<TD/sWqn2(!>qiͤQ$f08?&oK1nH-MB7v(h44Iv5 ڮJJ7m%ֳiIWV%')X4hY# Y7۾LH߬|C\6Hu2ltŷm]djEnr*o#d\p$Yؖřn3CvXSZ¹A ZUdWހFl`8*5 28=Ltԛ"W?pfQ4^mj6ɰ^| D"I9vaCN{r q]Uv?l,^>*ZAR!"#鯽UٿCg"z3%n&"puEf|x;3h鎕*3Uԃ `/anj[sA) :DͳBtK@N]Nt[9_O]C)%Qk`\V"t yf+-rM1+l[AZVzY.xE %t^<i.k^v'O~4xP$,@aB+ݙZJ5IA-cO>Fк8&f6V%сE!f ^Bw6B@06u}^0 "%P7E_4~jMpuO*U>;WN*àVMMeVAaN xq̈́tH亣ҺsMZ4UNzůi"@'!;lbi|SV/e. hMN@[Z@ԭO.ȤMI6I6IuM1>b/ ~Hdjs]}7ir5%F wL4=: M2W/ɥ;Ē:tTFU4Iq r$Dp1T|ֶ`m5KɃwYN^TV:-:vwCĝ)  NRZ FJ*4˩gw #sH*"}QCJ qk-zUf 6QcRƼB{PEC7oi|m fvXЊ馒at֥}XL<5>ê՛~0>sS-Mk^dk=k򞈄TWTS=kcxԢ)EMA,amQVd$ Z')Z]޷f;oaitAbMR@eouW d0e04de*1j K4'芅wݽ~D|CdVCw^~`{sF{ttCÌ]PA4]i!g!2MjhJWzshn!vq`{Ȁؘ"k+|LUbWc`K} L !X(t@N$[&M+iNQ̷Nj^ASOЮ$޶Ѡ]ޘ`]ժӺv\?EZqyO$DAKJ9?d *2z3h~:bo5OnVb"k;M!lZu5,*Ԕ5䓀I5&S`eXt+o!I0QZS++mR(4~1I.d2 L5֌1y)X5'Q iyA=^;$wXdv\.J%S Pzdn˶c}3>e"$Ƿ=(M +md:+F&bm0B}p3rm!_Eba{נFmg0jUgJkMh[U)pbsB l n7%C4r鱕˹Jv~L2Zn2jM9 (~m9R=jK#jzw W<.d^1[&c ЮEh é c ޺-*ust4J R#Y5aֶm5EgeiOY0\ޥ>ࣞ!^$pyꓱk %hH?:MZ SM}+0AYw7h4y|_Ö  5rxJ_ٮ,N6*>`oO=dVO\eYq']g%Etkn;hk}ZoXn1DR=31o_(/݇,Br*no`\HW~ms9qń Kπ[c#bP=rhT\cjx0댟 6(et~mO?Y ƓC NE;^|7j>ͳj ¯$ 4z V$j&~ [t/&9Мa:b}UYɝs fyAt?&dXcKJ1D\@HH#?I&i8.@"BqɸkřU"M4$p-&K}7]\yúy輡@Ct dÅ6a'W lV*4W vN"MJE`VZ3eɑUT$$1j谠Tl(t`[FgAA1Ϝ^jˠ L0Z%3!{}I7Oa=V?!9np%9m)HS.;* NەHV=lQߺ`Ŋkn\,Go0ŻYW7+Q] >pVEA=IҋrmJgNQD~7[d ~DyA#ybEm䏨G/WvPW=ns@ڽ-_\cQqht5eGFNe[i]j@ڪ5w>]d@0&W|!fVT L^B=Nf6>c3+/]q(GJ9VH͆ɵo|YdgA?>#&X9J??pk@%7YeAA ?ӈDQކGM$Y][tξkbq,f Z4 {j|!GuĐH -KÐ^ :ӹ*HՉȄ7 +"p0P\߶dwnF 9M:NxKRz8D؅Y@{j6|8 ߂ ̸΂UWvhK8&SU jAľW\Q08Qgd12*c] zHz5G&ͩ9ޡn}\CbCY6 ҉r^®l 8M;̲B X:cJ,km4N%I؟?iO]$v 2l5A˲(cȬ8ty[X`i! hFyhyʹ~@fE!TVd)C0B Rg㬳,l): m {քIF/䢥O}̰]I&M"pK1-^pazVX§SC 賏 lFy!ҞFg%dcI5Yi:9tnp;b߾p]P ]עu}qM[RU2ۋGQ+g\ ah("ȅ|= I1 3^‡tZ8s8+#!T/oד(:޲`Z51MF0)` (Gܷ(G㿌 mb3D^E\:W[$L%'y$z닇:@{:Yʅ*pe LbխO}Q!̌ w)r%WQZu/ YH4VD6W5/'%aѶ&׮BP- ։o$K^. H:uc@m>A@oV|42 b8--Zf -e|iEq8 D?N41m+^:\O7̳q<\ CI X vµ3>5`1\%x30)"pXm @`7DB ntc#·ڷZĩj8+@(eT MAXv`R%8,Z:V7A16X(YHˢ6SYYq512a!*us9*j,P Q d[ث4IF]8r/Jמ۲#,a?K sJijjO?Kwઍe'uO^Ua.@OB*1I"(K)Cnz*N>xIiӶ!l9˭*K҉.M wc%U6v-B}xX ΣD(}=s0 sV:QJsQ紥Cagc0 ' Fpb8:ܢ񺣘c0SMcjlm)1CqX((AeTzA 6V4[sLy[0rATq`Oj!˚%c!>Ӗ 㪑 {^WCMI@b5HٖA(xrHs@r|uԐǭtK] * =թ/t|Ig/w:RҢxӫBR! c|g?!n3̥J^FZśkxU!g9.T .Ů88|vo~ @\ðkR{5~Dz:3H6g扚Is2I%:2ömJ6Z+A䐂9z88}[6I jeoaX_œ5pԃrn{zz2cXPyjp`d AVs]e^錖`(WZ+h#:[{Ȣ6 u AxO:iNaJVJ &ӛPt$N dߵ79rNW Cj0=1mV˃,#kۡ$i͊^s7 `SX@+YB>>ʞv&l6E z[m 8c&SXNZqO\%j icRi `N3(c  6 1UצZjҦg &}0!4&vFwhvͨ{M3a8l_lܟZ%wa\Pc9-O5añ #M3UI,_MQySSCBG TF'm,oV匕P\AeZ!yj8^XL6Jl=E0mKOޡaila%iR&bB߫; 3&(>-dϴiAAW-3YxA`ݜbAXlw)`jKĺ4#ȽϛCE@Z\ 3׬O挒l$=4.'L"~k;D!^a[/4M ˘!9!:ab$$y6쌐9S"_%˒s6:b==Ǎ 0Qqx*e),ޣj3xCIV`0x֪G5}Ir]k*Zy@փ ֢icV;i̷hAG刮)fmز=H`#mʹ+W-F2 [ /o>7`a <U?w3qu\/Jx l CfgfEEBbj4+  >+2|4,hH]eٷ*A sGB/ EB!ЋUNIibq8^-iB`ZjP$%㖠I <`1rdӻvcQK!$Gוe;ӕvcr娈# }9 <* Q#x7wHwWTlh5-D1n9,6صw14R:g{u&'_b#1uHR>tAJ{5…U-jQf앨QړUy761y;_{< :k|r0IgrUk9Ю&4Zg=BCӵ+v8.=`rt^rL_ {͕={{֫",hq¡muجa3rODЏXS3g[-XozܕDYB8'=:ޒ _[fT7s¬ӦD} <(z 0ZQ1$zGzVvh;l7 : !ٍFA@;;аne'#>A%!_JpBAmD2k|GY(Hѿ*Ily~7sMGĬ\)N R4:[Cq F18_$nG$z4@I25i 5<`^$YZO '|RG=ܭC,%I+ %݀:]ZZnk]=SJ'YCɰ #S25?2LE$/*pꐯjM=sWu7.D3 >{caF$ JޤM ߾&:w (TkTii>V/`))QA=!{Ԟ&"W;H7imeE oR)LSp{2LuΜdStmxJNfE~w!5)C͕mE+ 䉳~"Ow*T.Ʌ +odG=dQ]MܒYq |w#i44STo5,j2C@*݂L$2 Zrf44'sA'Iex/ 5ӪP#,]0{˹E.cyv[0/C,+m_ѷ*ĿHNeZ-̂*]zIjUMLyj`]^@;i&!q9m[˿WdVgApQupoIkgpʛv/4[+v g'"GՒ+SY8*9ACyWS(/B3SlxLЫN`aQ/JjnVf‰R-/xiGU<:ȵ8ps2<Y)b1ﯛȈK ӛx'c/KZ' "n3ut[c o+h;ohFo5P35JOZkRgT uQbFė0Yц65" oy05]1Nﹿ">T3LЄU>m;';v%%kJ90`\겶Q~O%k뮧4 S}jbgͤͪR׶xiMX W*. _TGfGqgPFx? ޙckDQ7=J^M d-~U&K)l2vK'{]e]НD[#4򏟙ѿQn_Xcҥ]69F )!~B:0a1?F*h`R $E3eߒGYTtimJͶ"u]dU`wi=h{.5 %24E|LN_K;PCƅ<28(Q+J)NM%CH ֥jrYG !1։:uZPv@wM-;'΍^cY]:>8lA"3Wt/L19_msS.Wƅji"m-Ə۾%Ì1J!WhYL(1n/~Nwk'U R3i EglD&:76 x/u%&X;;d"3ZkDEX:~os4(֩0SpkDQkgQŭ6Gq,wk *Z1_O2`sD|Y$DLȮ , xV<<#Qw~:hbޤ~l5Yc?7ɏUQ-![b[w8]~\Ŀ /$9 0g?-<|  œS0Pt[!.*5%Lz2٘t1W;f#pݯc;QUn8,@YVQ;M{tɶ_az.汩KctT;џ^ጬFhKKv3k&%rus7{&{~f'Zm:JvR,F.zs! R%^\[_Ψb\]>Yp_cX'7^/@/ukI!q\_jkU\ Ub +xc z~=ϦP0k J$`ܷ@r~Evp$@C >tLw2ݙ:N<qXyή9/s;b5RT=g OBR|nIEad|Q `+WHZ7Uds%9H8O3p~em%SL=7k~,hn:vS֮-slMG$Z'≸ }*W~d: 2]ĶG?IFb''VU#YDɋߕ _ӛZ>?I9%U&RL|;|,5uiȱYq?>ȱG޲(ˀMg:P^]GݭDSewk;۬uqMSRGmaslS lͣW?L5;"<4%:}S[ BJ<%D@+أS~ŹYyWq n2k=w$DBJua?=ЪHߎ=j%VtXvwg˂06ʎ'ir[rU1Cj5 ; 9_!Ȃx@%\TY,Q%zZ qKG=oeG}B3[=-tDʦ>I/ ϫ|ҩK:[,5w'w8?J}xkD‰p=r }5ڲFӱ4Kj 7pXA$ݜVn\uus qnek;0YoUm;k_y598$M; ڲK6 Z2[9tj*ĺJ]/ pKʵH Sns~)\BqQX)trUݮZz]x.-~j}ݧ2**DpUJyZpoYbSh0͡:D_[:s0dƢ4k6-ꬹK(_˪2 Aƣ" @1Iz2Y6u!EtN| 6q:{RZDӥץWry4ʇ-W( Hʺ !\%gܡD% ur GڹmwEFNiL3` d`jU;kǾe[u7x°|0(][m=fc^ɫVh3@Nvww!:]&`ж̗`y<ە0*Y`h<%;f{XsEecNܵE6mVp5*=[S98v;'$_9nUW})QhZzwӯy bX@S׫#ȦB|H9!k6zR|:m ِuJifH:/O.8uAe3wz8.닕g´,RJe=dz>UgvqpVm 7()Y/V:Et*/$f̚K dGY%Q&a?9+;}Zu6؉p`D JVcRͳASw>a!:(Sov7"}0tcT5W?&:uHύ[|mL OBD!MfyMe;Zh45zw+au6+iב|ZXfc:g@$LqgTvn0Ţ3ݴ ݴ8 z[tp`H䏹<砳 9, @j+vfVA?^Q U1ӡiqDY돢xcW)h)_Gxq ]ʖuOjLecZ4?g!\d)8v[L%^F+n6*RK_Al{uzrdu&LM/ 췊N|)$VؑZ%6^g8* VXD7DnDŽӖladZ#60eB;Wgr#@ob_GI+ V3Gsc:yDs%/f zDML]-SM]<ZTW$O:`af:mL̋BT;VGwnm!Ĉ(z95Lt=:~u;"ޑb èh,Gh6bZ&QM G\@fl6q1?gyA7_7=4<|GQZ'n`o8AI^=^: %|}k»e?dι9e}Z.jԻefzeל: s)9:,TAdx;vKoz"?Ԅ::8u^Ġm`W.IPJ1:7rq~eءPxORdEA[G6PUxxi@O jl*[I'ϧ޾&YZ2S*WxۃaI]հɝK%6`[Mg )8 /&TخjkS:J;cG&na(S8G{\CUo?:j_<@#O-@X=*hӳ/Q&kIwnz#Gk); y~E4 GU QU@p6LJQ\QLk^ũט/ڵSڰ<3V83U)@8RBX!{1[TNs72jj[P^2k5,O1ije a"ԠȊ?\[җabdj>65Z $Mf鄩j8jdbl"N2ճ /%WN. _KТu.p_fnFHQryך+5)tq9aݚ_q^TAF2oH'e":VCEil)q1ϺFsJre#ıx ꚵΞ;,]a啶gVy/)GA˵dcj˖7rc)K W=#{v\\c>zoUڷ!C7uvn>)aςlÆ4RzW⪨ΜT5fj"pŜF}L ujɳ5ar%oHLmdvC 3I{{9$|5T|f@D(i3= I_)/,4 wr2prF͐&ohkzYZ")8-m\?]%OcZC:m6}8dc9Hp6_ވW j=}쒤x^$#|Z݅z;yz[65xa1z? |\g`]tj {a`o6KnVMy}9ST+1|]w; vI'<$=sG@M\qrh@b ~.s(VZl^2nigܓ/jo.zP,ֈ_Jð(:&xpj,wh_H_O;^dW\ FnRUa`6kx_ATT/ǨHxHA/bb+ S Jy$,KɌ[Lp`wkN 7;H] ;[iT~-0a6 x/ {ȱc_W'<ֹJR~_+V%.2{]gC0쫍H&ԜMXC̬Uf9 rZRi瞲 9{zczl:`{ C=xTR՝`)eQẪtб)T9Ƥ̮ZM>lk;$j.t7Pt]vԮٚ^V qO,h|ܽg_Ӿ/ U6Qu>0R|(椊;p /ux,Rt<HT d~HZ:GEf?RLvԄ&B@|bEBbb摏)#Uy a^~" >e ν{laf5_z/7)Fy LJݹJ~K?#WǡNC};ٖ*&zۺx"@Fp:lNw.`K3vT"\؋%6cVM?hl~5][DXD^\7S)Vy,]$9G1h=vH v2 >j%vf&:.TO ٮnb֑3L`&*S^+b3c ;P1prvY, ~CyBr;jOcͩ.nV~~I_#_jTǽbȓ|)zYoK\fppgADUBv{/G,ޔhYes^o!yˡо2L g5鐞}3 nUh i[OONQU[IKxxn$=[P΋A98l^,Q/XUwΟmKv0z z4 |BiF1ha% ͰƢ<:Q{}*6 ~~ FL|%Iu`O`%e%Gjԛ'& [e&tBENʠ)I j\~/(g_͎ؖX!̫fRK׾},QMIG܊ '̮aL 2cu0VCON9Z"5OÓUk$*jwy[IfGoٮzF+fq[qx$qAtSTa<7ZkjҤrx#~@ 9Vӭ2+m$1["U߰VO$=@t3qظy 6? K}-kIl/v˃A9خe]{iͽʄ]r|sdY Aj-Sȁdse+$dNN-,FvO=r^X{%H]Gn'BVyPԳR9FV.$}>*?nA>'i6}F9 g-1$OM*8a4 FuuoN3VK!|J:Y=fR%dcλdcb &7L4 T,9̴=XVqҫȢq%Gg x⡭gd9o-%g MG)ai@\fmdSgIYfwC-2j0sit\ hu00ɰa@k  u-ի l*+9`Ŧg[/0z!wn ԍRknRՅTaBGxV 4PBZ%`dsu8iTۭ[8hn۱4,$U h"zۘV ܎q6:}S:dͮRQ%Xy8oQjit2yѦI`a>A5c+S$;?/b[#i-o(_RaH(N]DȮNp(ju6tYxޭu5;hs^0#čZg3[`wJ8tYܴӿyPY2 ڗbWu,Y͝~xCВgw0E8i|;NOМjƣd.iTZ$4_x6c#VT LNkKY媄G0CbX K/U*v6KVr#M&ۊd]Τ){PKzn2 UmL餐] 'rpLs9jQ3c叭Kz&ҿˉN jfX𭥿B-5|pm.b㾽{ aQ8nIZvvR إNU$b%'d{JBZ(|,= gIJvS (P2Y@i1pM+˓ЊF : sli$W AouPlU%d aQNòXűiVzsK u1 {p(Xnp&'^VS*r@Cc괱ܪB(kY $C@Ԁҭc] 5P#V[w"hcufCte9ɥk:ʖT}TIͰpf2Fpx|;j⡰~.l~A9"i;ݷX# iX&>H ٨\P1/;j(5wOϲz_H ROJA=ڤI0Cf[]1rd I*ڪå##nܫ]u"=!>vU0Jc(ak{Z/e1$ڊ7+f.JMP0yx ZkSZzTF2.UTZe^:́s0"$BQ&AMgZ& $aNlk. E/HDgub_ Lf7( 3È%RZNMk.ASzw ԊZ4/u--* RVO C+;VBvuaY")GErDrӝg3u mY}s ^nXQ^x"iY~Cvs4N/h k3ZDQ48SCǤi %2t^C7'z3>}- Pwjqu[dVrX6 E 0lTPzIVںaQAب/F#WJ5lvcڻ>r2*} *nۆSL|>N-zc:9VwWzUTzpM᪲!z &Ae+A.Jv l eh3QG }a|1q8'fM%r.~GM+#o :?+JGgK}̓)D[8ezXU"LJX E)xKku4nY%VyWwuMmw'[K}17߁5`2q:- mm'k#Ɩ&FthzV|JwՈazLp)م,7yӄYaCy}x=,}v;HÉ4K#s41v'p|8D 3lhrkfTQ\nve|u-:[Peb]^Wk I[ >Nޫ EM_gl1jixE ̊@zji脽*y~/pbeu>:5ܟ7AvC ? Ca)jL׺C\isЪ"n<.1K0]#737OAh_/=Y)V&+j}/u"!nIQy`#Qx` zF˾CJfd7 (sMK#%#pUVJHїt[,܉h]ݬW5k 3qH T!$ ]Gc@R{g_F6Gxr/[lP6WuhQoϲBm'l+fVz@ qɼmk)4 !1齭3%逆]aû1(Tna,𾴹Uu2(0*aG˭YѢP2y A\6C $.X2&U0If(n IW7RpiwQbSG[M0ݘQ>†~ڹP$kSj}_ow |6SuXOfi wQ 熻;+wrf=&MD|{V(OY[*}-vs>휶*!tT!l=6.#|Z?U pNdOp9Ⱦ`_/Mq 0M(qxACărJ|!5~6a㡦_W+Aa#-AuΒ/W=P[ac[bWnbiò}&F0,˅Ţ穯x-`3\ptʕ GTyq{^KP'1kCxٸt] Sa0+!:ukok4񦹴[\(TJ\iMbW6Uσ3E~J;hZ}DAPI Tz64oc8HɄlR,0Ҧ4="NF扚ȓ <13N:s X,P0NjELޮ L]`i7@Pg i-Cu{)f΂0=ՃEԩ >.]ߪ.9W=u+ ǭZ =t!Z*P3*$fxHtC zQuG9grA&(Yo.~^vbƬ`6nۛפ]'ݳ\82Z)o5Ew9>hl Ð~LNM03Jx8GaWECN?{Q(T08Ӈ~5LfߔZrPwk6 INq޺z~`l͚d<>uȬP$:xӬD ٠$=yv(~[pY=EA*'E:LR7C;,kg5N Mʣ46ʩrF=y0th!;7(Ih-n %?^ă4 ӖQOraΪbXKۨ S-M&M@hO RDFX@u1 AE@K|)mɥYUwCuXr@x_ _R:Ɯlo&^{ 2"AКaL<XR&)Y%d͏d*Őyr[/n1mOBn z੎-api,oGOe?.l ~ :B׹,K4pCZ/Oj8Ѵ#M" 1_`j V!-swvY{WK|t2֛ ߰fI,JrrLuT(^A".T,<n#MSp6Ͷ>{r|{5HQvmaL/VFKT0$cI9c0thiGtM*=㯢VU܄YoRS` }Y* ܜ3܄nJBޫlQDCTc4{q#X$!*]߶iGS5҉q4`]gmgwMCl.N3;)k Ŭb¢Moqnx-EfQ kv$YvOgb2e,\ɱ@Vv3NLֻ%ǫ(K^UL{00rnUs܂B0a}[l{-~5`̃gl 2_ų ҝy2X^*٬^8Z,å; 5a7:< 49m8S'FG?-k{-יwY4m ضX:)&npZ~mk}l޵Wgi Ã>,ɆNk|IagXK?=bLTբ;^[.|XauaʂV}Oא׵ufSwSv%۴dr,P+ We;b]jA+N!z ymݭr`/gi#(.54>m\ll!%!O8!5e@R!Dى3V, Cs+ d9m\`yZm.x;?,O'=\D+nEg:KE=\]?1[[Zܻ;.R;%a׽]Wz<'<Z[)s Sv*q+Q0P*6Ny7tv;Zh#Uwy̓cuY8mlXS-Rwl$,awro6T ZXk{_>'j\I>mKY,El ͺnӗՑA˘Ӕϵbxx^{t^Vgy+Ұp(:nP91EZdh)LS&S4-:/^k0*:BNmmy  M5M,nb<$08Vѧ- "oŚh;m}uW$hN7YPk|V4<*+9AU 8R[1ސ̃὜T =(3-td5;gtyN֙q[ 2ۦW{po8$r7b \=[#5[U}L $kYPw?,4\ Rh6u[̄v^L< [hՏUǮ+)bgT!.Z QUs6L]|E(f8J1~a"S. -:⸰p[0/B^ jiۢ0+:;/':f3_׿%uGZ+BU$vK M狉mӪd~n-$ K $n+QT V a'I1^&IrHyaL7҂_?|V6ʸ`!VsQ6Jw 8˱@T/Yw0tƩ4TiAIO7:)vWV޵>aE)'߸;u CsMaxݔ+fc_< ZQb b7CWCr+Ŗ -H Za_afΗ_W҅qhP+,%1͙Weġt}5aPoI'ܛn Vƿ]ڟ4m5k tT?m6F&[bm 5'[ln@FN&G;x5qBB1mC/kZ[Jܤ0i9Ba8rAWBӥ 6Bo{хJWr ʯڭv#i^rۋ}G޹jZҌJj5(Fȏ`ehEO@7Olhyll{.ʙ(DVsO;'>@sR^yJuӹokg+ $;Ŋ>:ը=3ư:Mu7_IhJSF95^;[78leRv&i؝vTF'w 铃;efx{y Okvc L5RbFJLs߽۞2Ś`‘̺G#u46>6GؤDߩubUbQQ^LZWƨcx7/T V]$AÚNͦjHd>Gs0{[PϿxy7yzY\!N{X D>)pOnICq]Zb[NY XLku}YlLhzxT!dk> .J[II /A._Xq &H*5в h͓s%^i1g n&rz {Q]kcmnt\kK)"נI4i'I ['n(xPgŎJ@K4wSc?-nb2TW:b9x:($oٜwL:7fW#oﰶ5vy^ղzβ#ZQZ1I}^7k >QjWS]Z<!be4wH͏ñ_컻X.`XoA ܞ?.$d5}>+Q3~;ji2vNl}"13aJ"Q),5Ǎ1C_nve {ŽMjM17?g}ߓ2Gc@ocL2[$$ӄRa2)cz8mTԖ <^T{btwFzd>gR]F +T$,d"=ݦͣ?qLhTne=)i )Z֯E:tW(K{fC`үY oC+zJ7'<ġTK98E_8itKӒt>z; ?#Wؚc^CH@P/jm&:ʎ VJ0mRUF3YiBuZq{FKKQ[H wo(SxnZ HxQ(ZaԻPU4pY1rCN6B,_U @r2:v/<`%8Z|ݪ{w~8׏7O^n\np~Z;^; >E"eyӼ<ƎN0}H$Nyˁ)*.K^C%GB.׎=5;㤡G[54 \C qJϠR6pԍdS8`BUo\=([Th;imj_PpFr ⮌!uQHF^L`΅GyB($X~% @|b^jvϴsG W-Z˨IT*W__LYoZu}3(@ְ8`4H G7PbĮQ|>?vzyT#W0i?%qCIji}eA+1]]RaitRn nieu[V@xBF+y'((JbzjMm H"H*yȇ~Z[ʾ*3Aw]͘ll5,,VjX"s8="x0:FzA L,#" p5 ^uG#h+C 8x 4!a6N=iVJ^Z(, (/uDWo7E-&IY1:֙y>-%k:;=AȔu'HJ%{VJ/jn Nx薿<=E%F`c ͱ4>xLS pdEL? ^J Y+&z䁔C ⇄YCy:_"6-4rsjofqRnLX="Gpoty].P|Qt@g7YXRb X! UkzيRI-ԝL@K$i%UozdCLßyY2(E?LG2 P]V~i[YóU*ŶNe--"yjV"tth? ^ 5QKGXnKtP΃#7kNx1=J;Ma!(C*J,CIQNjBlh7oz$&U͜x F^<\yQ5T{qgADi:vDx\Vk@V8+s°?;)"y#>^nQM_2`Zocp\gJkv޳16鍟M<ݠ{lb/e[A"C#g႖Q_Au{Mf(fcXҾ^d,B+=&Y҄vϐ>&"sQYNYSV{f}j,P qAYNG( h,%H]K!E7 ځ"ד&SviVә>6>OB,V 0AE:Qa]+X ?2-5o`21L"A.[C.R7f1ÊT{1mhqXMppi2ц WE#5V/#^CpB`765BܾQਟ; leYfov VZX+$ooFGj>ay>n\?f &aQ&'uv̿!Ra[ah>a6FXTnMwyt*iMgֆB@et솖;ö,XF!;]8L]M`rdÄ ]P3i:S.4o ծoznrHv.OPp|eNVK;ې鴠RBF'yWjTWԆݩoyDsLd!4Œ'^hjj R)i8KO; I |4tTPsijk㯜fUL1f첌'QTD+lt/k$jr3GFd8_Ŋ숨 <"hb] Pg{Bεr_Q+ 9FZ(756tx7]@Q(#8\f.?>Ax膠PIм$;MVxwN{ ͪjHᬊUK&z͊}h:*J0\ZO&j:jOOϰrGpShϳ}~_͑FNv!z] =Ŭiܡ3 ^N/×qu+?=qh-xqՒzcB(,H9H6qH0~ҁsZK @[0j06d Ö&+s KoIśT̙@y喈Op#p~p*KB=?Wg1N7m{+WI.P,48Lh2iqR91G'D԰ReԠuOPpqPȝìFLAMiΑKI2#Ī6{ 2r$TD]pUqUs?R*yaÞ0?Ou\c%% >ˉ3faNg^v\oU/n{*Bը8\1ΩC›4 ЧUa-PDzk<Z}.Y [0kV? &\r VX]ShRp21s6dcl]|}94λH;`~y᳝|}:K8ΪDz?:dWէ>nְp{5 s5_3b;P,(|.t΂ϙʲ€Dp%[rF|a\.2rdøN)yuSH_LJ)wQg?^WVY9\2$鞃{$g6n[ Dn<13ks9ŏci>/@|kwrȺ5~1:٪3}U} +f ,Mu*t 9qّ4m : +GZ;(nrIw ^,6Y֬Ǎa /LH+bjm˗b+*!`7Kt皺i.P*Ěoa"u0jF1h#ײSIe3ŭCB8vˎA8 D OպI#7d;ՙ48͊En<\zEԨEG "nOJ '>l[Li!"΄6ɝb_ ZFQ5Mw!+;=Thj_Z'NV#\;j*vu4fL4tV5OnK5F-P>2kX5wڶ"hg(L9LGPj4G Ɋܣ~*gݿxKH[DqH:n&;tqkn%Te5Fayvد)8>Hϸ6w1bUQlOv98#iIG;L0a`Jڬnl#{m/|.GQ)7- Ӟ]T~reSz~V?6r9>mnS'ͪF3f=7,dbpc!e;Iu͇9?}?}Q15^X *:j$YR W)N9٢ϥގ5Wx>5lGcmXհMNK(oK4 ix>`FܜE"/1YA/'~S&ނΩ3XTz_'N{bsQF7F _k]7=j6s > Ռr|SZDyJQM4J"PgigtS1SN^GmpIllQ, b8htہjnrMd7!7.[K}y3mU1fVV Ci6+AkkP""b7S%Eݬ=wahrC 3w+ڻӜnWg u6Q _x4©1b.`F뙮Zq%?Wdea'n8HRn֦`ɪFE&wz7fSeo۞d[:bcW#r5f #$܁O\ 1"MTR=sH )f3Hf- '.` bPQ_7m$Khv{l|?8d%M94ApWPwDJQާwv=[Sմ,w[OӍ>`H}摾: +Ú̃ʢ`u 84&XlNʴoົP-+CVf ֐ELK.KøoT ^brCp):5734ȸH+sLHcѲftS%>i<9ӆDa뱆cN{Ws }ߕL M@:t}3ͤe%7}( cQ/|ur, ,W[G-X֛/E0OeEpYXxOSn_ss~@Sz폺ܵ`߿2ɓ5g1x.(]je ;Q4"%O9@_ˉ<@_֤vA,4,D./D1Т6zvvҰjYh2;SMz\ ^gB4TxT(i]ieZ*pU%@jnNV*:Va /yǂY[$Ԉ ptɠ][?@tb2ZE^k mp"Z tm5 Pz#&tl8 7X@ ^+ArM+HE Ы,{iq+U:i(M:Nm"V6Kؔmw_`b9 :|=ԲBŌXH#-5NW`i篵=76fҤb:t8C^CYYAB9$22eTu݉"Ct~Nbލ(AU3Jc\`&~ԩ<̛ KD HzѨѡ&$?:: EG]x:ww8C ,.i2z<PuTRQE}tjгv"t*ӟ4L4(Eldl0^|qzkaˢV{GwVi,L%%^<VwMvO08* A7ߝB >˩),r""\Z{gŖ -ovsaSSeviWfl]߻,m 'ݚ wA,v=K]P&`~k a }몎Ufk<22'eOc|RJ$hn"ǽhl`3] %ɧf]}̸/`jŰii y 3/M=eF-mfiJ~->Ka ]PׂZ՘փ=ջwR/h#4)5=_WXxhm;C9+ 2 zK(8V NX6kuծGdǵkqj&ҥ.^{=L@WLgtᷓnzJnN 4%1&09 Pst0tRړmՙ,_"J+FWjز2?  Li%ި  ]$XHAԙv"ՙw5Ezsux*·i?VGh8pj8Q[Em, ƚs+G:Lob5w屃qNA҄܍ͩ؍:+USOl3 Ȃո?+6DZA|0a1^UW\ǰ\# C =u{Ijz;i_oجH3.wk.zXi'>DAz_S+7rVS,P5 {@EJ_8Tx$yL@ ov")sNY% mxTWs:ˀCNY9S45L4C%)#HA5<ПUꎮ P2v}i SNn0 ׬ZCbEFn9eԞGU6mI #Lh-UrUw{uhԟ@*6M' mXtB Z#uUpVt79G)v%~փ!ly;(ao5Ӫ& 4iIߤ%p~BRӧ~ݷ6iÆ2.W'ʎ'0ӄ R)yqy@tVtw(RgĹnU &dWc# gq- NHi*W) C*gCW`[^ΐ_@,8,$nmR^EH\'Kk/Yz:f]S)#! Q}^8B lo?rӢ~v3ҪhJcT0fE%Ou+EEQ{ڦ:) BdiBC%9fۛ$`|`)( t` =ho~7k_jJ$FY*X(ʦոۋ)T "pF-,f7j~L%9wej<^MRhAbYʈ7GHF|| Y=o1w˻Ҵihz<<}Kc 4 bT#tJws]8,^8h^\3uk&> K` -XIyJKF4ע{Ʒp""'P=!B['ȇQ:?',cA0*(quǠmjiyz.3L+e69^pK6 `;[IspOm}i!9K61[0w> kyon ܞ*&!tV+3H#_*RţkoNGU tHp+eηvݺ7𸕝յK%AGA=cًeH M7:t;^7GVߔE\ò+9Ц^E+yt>f WEcLUuw;B5Y"D*sռ/Yt;"BgTCuҩc@f}:,:*@RS=JddL`6U3uY.JhPy v2\7_SjDH; 5uXruhڼJݠޙImBcy#_Յ}uJpY!^ <,CޭH u VomIq\;ڱ"[;QIw(jYMSVz/ZRW۸«̮WXyJZՈխ/3٪+_x5v~Z<M 3zH%8e,8ieOD+\;|Kef_!Dx4,ЗlY8;9Zqp.~vseB3y*W~VG*ܴ0cw^PlezBkI5Zm7 `I-qERVgS[tk[ [Rs~7РXF#i\H~>'"~uOܶAܓ_q]HwE{z6wW@1̅Ҳ*4 ]t'E},܎aM Tp/*IL+pվl[kKz QLx>dNJIhv%TgWXj 7hh&`:q>GU$Z$-?C$4j!n "͜G(!aansJ7)鏠G&g"./T%8'~bX"r? 4" Ex훱ntӅT[/H 쥋kc2RFTڶPQ0,m)zUnPSn9 2/nKw~ϱ;N Hl3oOȢ)9H. %Ø3Eh;f QisNsaNTtnvS>&x|kP:K=>"7؈PyionRH?W=Dܔ  z c![kq(d23P @m~fTtRAMo,.cԍ:@s:oBH`+c7MQb7 }TmBrP}q>1H'T*Zqg6wCԡNDt@qXSMoLh|myIN)q+S2w !JC' &&-\sUHX _%!JOĎZvWx(Xw[V #F3Xm_3! "uwȴmT 5yz@DKah~!Ի ^{"R޳r/qEouDeܤGW~BnVAm~$]f ["9vTxݮqh1ۡ *[WYxiZͽ裲$\Jy b[+{Ѳz穲*pHY)/M'!w{8^fX&Q ϼ%^GiXA2cz3f8kyt0xl'_SJQ›1Lp \_̻L儛NŢ^([Z\aebbS96*z$ ^@i/ȂH_ 2Iȃ~ʧ'wg Q">~`PN%zj, [:ﷆr==X?('6F=}"- WMyEy"\,3cs0dBy5*'gض@os-qϵ5GmcK4ʌDZ:h8z)9-J-Yv*yٓ (LQ:id[h4u Ēc{NZiQ4y}+zҰy8ol`'M.Bлʘ*}J2bQjk|PMTN*3X$fL $ETѱvn}"5NZ,r j]*8Sѥ)`̌ qK!?R4"L  vk@':h/dǍN 4 D͘H4Mr#5XPdFxhMrt]D \u=4%}E|3 aWi~}*92 V$a[ɺ Իjx\at=p rzکγY~7KbUQp貀3DTضhtzA w:-{: UJ³ 1]`sb3!y8#UQXwr kx+A*e}=mp/Jd1hnAji|w^A-Y<#4\{oݼUoh6K'`ш+C%iI> ݩۍ[z~2% pP\}W;4L6扮A0TIחz)sad>f#'hx=z씭}oP[z | _Tjn S:HMA$f5\t8+†xephJn^A)_X3\eG=`wBGŽ$ yPMDbԭ!R·qpd0 @s4 aiL# ْn Ŷz5DRhagף$#L6n#Da;JS!oQ7@GLj&tۣQOxr NeBU^6 :!/o ToĀՆ>^o?@J.,kWҭ=T{.?>jMPRҜ) myTy9lNKGHCDpJ 6,viy6t@o7`'%J\;vw\fl=;XhkRHQ>&MG GTnx zT R jTuUщ$Zz56nyܖMjz[Y^]u޶Z#bF#^MַAaxPkP4e/tNU(س4ìv;4#n(UV IXDYxRƤkD )2h˼X|]}\Ym\ǬFp JrMGF8I?8+i_LqL"WK4i &0x>a\zAgC2ub:p]H,SJ Q,mm%3+un*ok0OSfX{x%k3P;\Â*Fv}a r*Pmx4.^YbxeZ;_ x$.0|Wӯkfa@wmm!ۀEdUgmA6ʛ7xT(#*,n-7O=umK=2Uj ~wL;\Y8nM˝=ՙl5/{4?G6\iU\5hǙ zQ't pv~ׇuJxC3xFS;,ʞ\f># dEywLYHhQEEަF|A"Sեn ^Eۆ꽌6{ s ;~>Kɐvj4_"Qpsy@YXnwnE85͵7v Pbɠփƾ"ea+J"\k &T c,슟G7( jbTKRG1jYɸkPq(fZT)X,Kz|`~8N>ֶE̚ܬXxk<` o@3x`6>m5{wmQinڐZvҿRT=zC>N.:bo\e!&jreM4z\6q1iCMxc KF"zkšR]/bz5_Wypq]{?֗+o=IIS\DcD5|Oέ| Y>b PJ,l˘Zj!#GFPrc)_OP q'\Xr :Uh|'@EIv'A+3@FKiu !N#HZ;o wc w̔/DO l:[KE%M4cnoJ0~JoPȹ:+Iﴰi4L{gXi!͖pyVXoeB`}&,#+ Ϩ P]O j7)e@@h 8=];Cf< {0Ä UFckLhv~'' hʽ/ϻf퀌䑦&t}:?®'On"4k`hinr&MW+?W˞mؗ\.jj韐ck^fz3ʱ+az*.c&ú>XSjڊx. ӂP5EFm)*yvh|lS]j+a R ޻>Q\w_El,jw6RS N9dV')ꤷNF9] HZ *zbmXSQ=x j 9 kpl",`re9em<8=3Ū+ J h*6; rDXʿݟA,\OS_M%>xLf<$:3G<ǶC{̊dfntIW*Skd)&rF*"`龼nn[Ff\h[aR* N|MUBY \P/#hchVgKQߒҥ086~@iO5E庥8[m< e H&#>̵Ӵ|1w^ =|0ɇnL)$|m߂O\P =:v`(| Wcd0,pPY+VۆY_iM6bAҲF4O{ܢ+e=UNظ{;51]77lP{Mv5@2ׁVMu oX}t0v 5܇% Íiѻex-r { jM?1咶!mK5-QO׎Wn):# c}Xp3N*iT;pI&Nٮf6øQ(U"v0F$+mF47O5VHu"ɝ3n`iw s wb?#+<ΦUSH{Ɋ;M3IZVԣ 1XS&6V؄ǑXBiAҬW:AYqNf$GaUcݠn2DNkD{lM@u[fKo(AϻW3CL&>܄gh\͛9.o?"3kQq4nl[X?2NN1vp7gT؃e4Wkhtje6 U{ Ny뛍RVo'إμ2[Z.RIuHNsL!H>af1{TLP/>~y-; =aAh ??/L9ѓ+WnsX Dd#>mR (M_ޑLWޠՈJ'lavzZ"{ң*j'01HF TWAݥQ՚" ۖǪ_}Tuo T2jMJM8Ѣ8&[ū~|;'#5OsY䒛i8Bcd5h8=}Ȫ6_\ ԉ}(ԕMAwKנ1ߧ((qNBz$ ߾ Z8э)Ev30tV2{ %h:Bi;sXwH ?ջ b$3n;z.1K\F$uin8b8,3m|e{Y$>ҕ4Z=p5R$بJΧqf&O$뺀'Na]NE#VۻSTk߮ONщ{@i9i>NmZOMF})UH6E-"p=s0le v>.&:WZ5;-ēx.׫ E9O}H\aڙvYӲCV*VVE5׶)j k^"v1f?NVԿY/S_7{($tR,i8ĸ=2_BSƤטiV'(H֕!i"{Y: bQNrlw&vMVS /B!iKpoƠzYR BnT9a ԁS AeA7K'~s tӢzu Ap%kc+wKzM9;E`x7}䵏iم (nt9O5mI~݁GY @*RA3 ~[Yi֦+ܷ6d sK%9/c._S^sKDi@9{Yp?He15GYM' /._xObI~& _ ê$+"Z'mZk\{=3\86HbO 0PF҉S5WP:;JL(L=B/4+y(~QS:^1lt@˒79]z%z#4*#hޫC_s}iVvͺRm.ekvzݟH(цNd7;d((=ƺ [0)bw-p_5Yy(q,)FֳQ7/XS} B5Pi*k?3dU ;1)7" w:yrq _0=ҾQ5p gCN4*VW8+ }k/f4n?/6+h6M@ Y,> [g&`>W=(Z9+ {є0V!dt@&쩘OB-eX{9=h6瓧rKKHzLζLX()-fMe/6 .]%Km&. k-wYAѐpEh1(yJŨ!bvݼ%;zocWdcdGIO# +EMeŝ5eYݒasr\YS[rj]l1ЋZ[ωŁmjZFʴ_trLÚz>El[X6:A ų1y[+FpPV$6xq8B?mkLo yzl(5C+諭ĸ̤~l`d~g/e ѽO !9^/*ԛ>?a/ۡVpRFwM/sN59$~Zn) H^YodmhK0eodm([QL_ǵ}c3cC4S/Odrliݶ+}CvRj{䈯Fڭ: n9"zOw^Q}tjHJ[x X ^C%hY+rT[E}"K)g8V"njFyZƵ"y}Y'c^ZS3pOP׆yqWBq8!}CHYX'"XCZyuӿ[6be%'ālYHFtM3~51q4w^gBcb\ Kk\d ӁQTt]4eii\z^ʷ/V4X/40tluކkp1>#Fl:vO_2&OX@^Pxu&5ێѕKTRپQc0 m}MN<͸[,S+loOdڊ㓃\HXLIM-nk7B-UDb|&&9vCm6A0I,n]5Uy}<=haX\@c62jlHq+ӿ鯀TfGؽʊ-2҃-I?xfu{.LX}j|tF!nmK|bn -YrxWNQoHg8h~6WNpvŨJ0%M[NF;v'W^]B]Mػ:joj~$p]GY&nuMΤ[;ӉuUnuDJ+0I% DOdh7oBÍc*#G%uAhϼml)}$dj%92?TzS#U$^,iK&fU3+&}n5XTl#HNb4Onid؂mN6S] lֆm6v]O8\#},'bX}M#_,{dnr\UMJR {^ 6*؍, FBoBgB'ϩ}ZLp` %L;\uK6)9$3=xL3-q ?J;;zֻ9e[ Tf_PMjsj/zS#kw]*6NdCДƒnȴD<X:l6N^`TGFڵgȫg{-N/^ bZV,NXz*WS iL~#v0rgǭ1$ؒ/L[7Kd4Ғ1^J< ibo֥t".C} ߡytMԴv 8Y76%PUNRtF>9C5|v^.vG:7PJFAT }6>Ȃ/~X(&Az7?P!OukUJMuxghtڞO67FC m?=weE4HtR;n9YI2`U b% $5sk+oXRpIz"h.֞S|wH0V1L]|~ˁݏUR,`xc)~tsDWFy`B6ÊaaYG2J\5GsKxEûfI$=:`qe&⮻(B)Q$ rRTI7MꩤLⵦ<.KJe#E.@zIaу޵zg?v8C}m ;G*2^*X׎~k'ٺv[6]z@NkzeFKUfJ4 I*ZrvF"7~Kږ|Ty,oU/`fiʬ*iXR;RQr1Pfh[ӷkKΪ7""pR!隕36s=,$-k;\-]# JGɺ܎{װ*T]VEiZ9 R𲱍nqFJ;4ְC)Fyl^}ׇ~s]Q^œ?_׌!pB A^[n騧HӜjK`c«ĎVP$~TRXY 8iDpbZٕ4_ewM7s* `FpՏ]0$PE{V& H:!Q|a+Ut0I"B*kUM,('MVeo6҂APtNt> p_ï$N+r-j ˻ \ue6 ԇ7*d\lzuORs@g8Ѻ˷*ôA~68N5[`1o*QvVܒ?1.tPQOı^7iOr d[ʼnOlV;VF*H2#dH'>7TjMju.و_=b]pqM-*т&&qw 4+}1l YZ,rNh3ӑ>WxJաϴRkoAO+ ʡݞ7if*D$7$=-T]2ٿaͪ,DnuѦ 6!dc> BL)Q'mVf!>gެ9 8-]pM=qǣ(kx9JKG>skVZS*BaU"z ^j$|FG \H`HE`qA 4 ij:?X=>y Tw`G/j|hu@* cH_&M$cQ'06@wEzlio6[#M7$ Rb~c{.vFgՔ0= 5Ev<)`7 vKz 3KKH#I vt3v\4P8')9` +oEbì _Cm}_in(:f9/j_έl4Jy?==ExCر(7,ܾnB`z끜9-iaC\TcBXQP粇Ҋ\f& JMIv,i)$&Kb(y~.++҅ I/Taa[1$#)H|[g^frcrӖ1Zrr ELX2ʙ;.,֪%& 5fd=={˭D:0%r94.g=hx{i n;x^h~!^j/BJ2 |MXTNj~Uc_ӒP]8peb23Q~6sK=~."T378;a$-?LݐEj|suR9|7r~134X)Tr%OH*wԨ#5Z oKwpW΋.RPr T㐤2|u.3jgRSdi%&isKFSWʾ$-^Ko--V_EcㅂnTt 2AUu%՘>R8&]0Jڥ5YCص0z^mԭW==oVEU>퐉ȩm=P>AHuF@bqSJK|4&c hd`,ۘ@h}58y3S2 5Z^fx~ӲAQPg"Owɚ/;PW}][jX1r5噧DBFioaȯky4}06$&&\g[vKue!z0PW`JqB\gUa}ѬĄ $N:Cvc?h شJn|7GY^?Ƀkg,)6.+̜ H8@pn,r ^r|H^Vs5Mp1 \ 'Xi"Ӵ azY7p)g1 N.ub(r%WѱƴgzJXkHms U+{h}1mԹ]@ֵ@]ބ't6O@WK]\%H1-5{gTuH{ (@FnIѠEFA{42^}MγS& ڧw ᗇQ4;!1{{iVG 'AMg*pM]MzE;WЙxW~2~j|Q !*4pѸR{M箉4rܷųǖ\ۜ? ]Y5ml/vͺG4jhY.VOz겒~D7tӜEGMu>מxO+/f[n][7PW?҉la&'sa^aA:j }CKpM;GG嚪Q8~|wGoZK/5 /~Q83v|ޯI1wHaCAȣgF<@8CZ -*9dOÓ^6mR|6˅B$@{QDs˝t)7OY- ř#,L\ )843+\լ)HS3ro^۾7Bd$.3)Er~#d0E6 ė^QOpao"iǩ MSNaŽO:w $cʏg"LJwE尡}2uiΌ:ؐ;b98:(F-xpy(}&w7DKUݏXcͿmh׮r-rGC#LF()t!Gd_|XeeA9&f>ULc/tPEs~ggw!^-X^gn{9>:*}ҭ,>xJ]S-+UAW%kC?~SzFk~ LŖ %[e72X%Jt'=2m{8{3:NUAUt;ZBsck|fD <XW!>%-=7i1x]'+5uԎy[`Dto%VD8wf$K/F70!K&~\%>l>Vo+FN| q=A&idp~*X*Ώ:uO[!D}?Mspso:jwOԨf{ 7ϟOU+*c=-ڧE^()Ijs:|iGS9~D8?K{iQĔ/().p.HU7Z恺ժ[V̍0 C ҿ'OP1jឩ#QIc3>}` 2w5jznoe!SEoA|XOJK trxrL jrb 0Y/~j5D\&\ p]4&,!.q \n(‘]Ɨ~G9]'b(ȴYa8&<%:$7JiCS;,WE 041SI9jYrՕIr$/Õhڑ2cSO@[a1z6fER234mvZWnFsٱMipݰMu f icЗW)R:CBAT}C'~}3Cg ]{fg0@#E3Y<=yJ#^D9a?Q:A: ig8bH;C~yF,~ ;MR@PnM)q٪3&@k(Ƒ}Dgꡌdc-2Nl ~w 4mV+d8'M CwOlۮ/AQm#iC\ >BȰBS*U_l2㇖|Eh>j<6-=5z|(-o GJ۟>[FϏW9՗2)ZtѯW'9:5u`Wo4Ffg8nLG%a~YZ%m+d.Nu @кGI03'֊!ٴP [nesINKayd=3e~L`?i~UW'?j9u%dR[7J`aO*b sHWuv̻AP'pHu uAT 3rIt˶m΅^P ^oAk[YbrEi?1vHG>Thh_Q̃дl#73慳C֙ϩ덯Fr"i:ѾYbC>$50KF'Z}?( pԙe?JiF # ${MR;EL,$^ pѧ!3 ݶ=W6*l$IUQm  4`~VlUObcDzawg1c;Ƹ]?w)ķ\3+1*1QPgXљxM=6gΫS]^,61 `hu)tr{V+,p ?A/3 SjF[ܺG_JH,n%_ˇ/S9_pOmvS5IxvXGga =`í'7ӹ?*Maj$8N7'nf,b$NlHz^FSd3.~6 8[fzF6´ Fjwr<5gK(՟eP$(}IF6}rӝ]ϗ{s}~]ܪ,7ڬa8J6IOb68#udR=!ؿit5 ZP< wVVzKv0g]3Uol'ٲ˻Qz<8o4zm-ŠmH)$ͦ4vDR:d'a/pAE#t弸/PfV3+l0lvlN%P2=IU7♺Ӗ̑J KNdҩvsG&rkqi~R7 jto"ɾ9՗ɚyدMi d4Ӭӗ~1wPk.7ky]чe@hQM7T-jR}'3|<8M0G䈺 ٧WS < címit]nhK{sύuPV@ p[8xb~4f.ol @zv0`N¼Y K cdWIz6hM/6 މbW^t?~qf999{2{1"'mS7Sc:Dyp2";:zlaH@!@7 qz8tl>tс(Up5)$ ^dTJR a-kcB3m])2q?*XP(ҚCN2Wc# Dx'Q甖w3T\6e'Xj7u̷v[P]=qёA!~Om(M gqV6hn%t}(ep<%4me>{&tx,LS'iFr1ѸF\sUw379 Ho.cHŔ83rq^RB;t-m nlU`F'H7CcP*5nPnhm-!^< ɺ0YtJҜI֩uK4NdqS*=mDiӰ4u+uUn"l75{3]^`PhhZςg\3[.s{Jy lj+uل( Yݍ~0$I1HvG;% r#a?>U!/rnkJIBA6>HSXɫ@;$G"Cmn`ے~pp5THxZ)>]2 A?`' m3N懅*ۣ$qݥK;+mmAO%S\w!Jv-ӫ^w |k"bm57tb5j4"QZ+HC pH,WV|DѮKsiPL0eyӚn`=l8()&L:>b<A,9^'*];&ݒ.f|sQpMAUoQ]cVIWZ]Q؝_u.ʭPY/-4kDr~vz#,-FPg&L(sve)ڱ˜uo1Z54سomBH}T3mvyҳyߊ*-Gc|{ҷ;Yug&julCyFwyu[[*̝ݖ56*ފwd]>y66&,@ষU_!2#K]kWRLݼZ I`Yx@ˈK4K סɳ8"j,"3{ό J1btNOitzMXEK~ ,oFĪc +cWfBѵlKXٴ7j㕝mӡE^(wpeB2~$i =iYre/ HɄQtʹVb6/ OCG3 iA'CʑAj:NBuoF[}chG4$GNj'͂גIrE҂j ͷ)u6K8[NyDwNPLU{]qq! =eGKN,^LG? avCvBAh:e e-A!aCwIJINy~`3BK\ !^MYJ ^rARWd#[d:޿se"Ԏ'Zjr>7A&?$],]N(ܭ*ȽB|.9h$5~Y~&ٴ;Ft>]G0a:yaVnns.\%4br٭V"޷h2=:+qA&{{Z%F#:66HqةGӏ-y+Og[x_i gԳ;;W@#x,8?; ݔk}Q^^pI  KL6ܐ]#U/N5Qw@`nV9]EcW@kt䶎}H饑w tx̼# EIZ,Kw4,Ӏ>MHÞ Ľl2*(=G2{UHGiZ_L8wW(լ}mJծ]A[Y.WNn7״,`[6oϗҭp31n>Vd73eXӊ?_fuG l{bj /ի:,>t(E3sveLj-4V_5TbRzm-;8b{ừt`n{6'ԂߢxkkNp8+N$ QNt>6'9nT8g2zq2umMs1p d_$;0+ͥ$]Gw|fE옅!hw`NvvӍy rb.Wa ƎQ_8H#g ߞ 7zݎԨ*V9vST~T+)DRd:8g64]'n8;/5G=#Jt+#33aa$X?f ƌ&jj*wp3K T8L #J,O(F7[{Ġ7H89%y\N EqFBJ<,.%Xϐ}89RE'UUÎɾʦA%&$u1a]?-FJUuV6r4۴s7 %pC cҌǪ4,'*Vf;p~p{ T%NB gӽ(UʹUNخ>oDȳ.nԑ8l'ضiPe ɼT+\L0?Hzafkm=R_2R(Nk B:.nnVG"FG,O"q#S?[ȊJF tT i#}Mx%anlt낖1I )T&._9ڶWΧUHvYV_K  8Dza Ren`JIBPq^ՌV3T[uU,iIs$%?t*TTsao"mupf^axj;-mȤq?a/-H[Mh]"U_-Ouz, _*YV{~˘mN'!l/4sWʥMEׇT̉D^"CE Gk6BnSY,H"CmaM >@< w`XB%=:*bSFcb4rY:VseN{/'ΩgI^@fV҆wgՑ0c2}u󺷢9TR;̣3sa۬}|p0!YGq7 ;\?(zgcFbPIcHT4MWҭz4z(esaU=4-]PAA؇vb]|nzӅޢ=nySy|Z3Vn}#_;WovoPaO, V'ۊTPNH=maehXnyd3\f+UIE[}zDt~:Tm=n3Ʈ ]r[2.0>T7h ?4[ ^ִŴMkEoU&n yG)]8aH\lNm;Ri3HlG}#ke'4yٶ~aQa6vtI1[.U\پYlsFE %T)Ш{}QbnX/u]׎hd[hPJE*ˑV,>HGIeo{Բ@ sϻΥm*ιȎ-~R>v}HkLc?fP D6i&3`60(5v&ar]͕Pyv6 L8]- I5O$K/*N,19>b3wԩDf!XK@UpK7{zFuށbbYff+gYHˡaGؑ7,)BjT2 G _7,fu ?eu>$Y+DWawKb=JYUMUFz"G+Bjx"k er`eA7܊\HMڱWH%^A"-LY ,ϰ_?F\O^7|2zf/r֔#+9D3 ƼYFX"ȲtDP.{v۹ю !:kSʚv`;Dl߭>E:) a;EW2dp)NI!+˙e]pWnsYj\i^udz>CðþYđl.l\ήBZN#_? sNgK0KOBM`diΧ <5TZ>5fLt>//;5,$Цe&n&\{N sѫgy9)P 2Q~CNa'qA5 g%bb[e>M%s;=ܪ:T 69+MA+?/}p0ԫ  :)8ձ],8.NdaZbNI(Gr1@QI[I.02V,/)D}hX?u1`T2pUf\I.c TNz[j_d#c~֭76EG*bo~= RdģTfo`JYmojѣj8* ygJ['ALE!-n6] &A(,pW#YY+B鎉>l1a).ڳL|*~\J<+)tX5-$6 "g*X\0Ж3C3Ȫ2B VbDH +϶fwGx$Gr@t?z =7^kKT(. j bSB cidxBFK4Ա M&P{s׷Q*}oId9+RB&܂ɐG |L`Мʨ1iŀ{\!*w# wC%Cfp4rHpp1EU3n!\\u}zCM:+ZvnN xֳ_m`$Tk8,:Uiz@~^[co2Z"\zc:B#Ӛ^]s,lÛ# <rhbvUu;ćmȢ8Lk3z{5\P{jQ&:^2|Z;cN}\ By3- U`@’Q=@J*g]C4sėekmee}AY'B(%JEA+֡ tbAX)P-w{uk})ĒۅCw;'gY* #a|f \Nd4"pN%`q@j=(#d7'kdiDBS&WԮυDz!_fOKmq(Phv\FuFWnkzi!ѿL-x5^;'jmϾAafEWƄNvc̲;r NUUbSrGyTP{|>{9qG|냰H: F"/m4:-Tխd2ޔmixOwd[v30@a u-7 8hԽvr+@ i=ۭ LsGaھ]/*)Wtc'N?yAbP՞li {ٔBfuŢB.TD^(ix%lPEԾ̆>*Q W}o:Y!uFtZ {pn?nJlKZj60_K  `aU,::*@NΟ-ӄ r2PK\qam,WB?rB)<OĮd9.&$2&@1";Fuznac7UB&I4Wc^XSB~= 6bI.Ɏg3cmD]~LD5u8 d!}l*W2VjYACӶol}.x>?gq w`'= tZ|5rawQ9FI}JJEY[G9x'2cH+P?7t{ƯG; "ӰE0/ ۿMx׉`6@8k^u&U?f90P![9iO& YHŜM[],կ-*6!Y+i "m8˰+ e+ ²R͆}ԪJaiAnBU^LZ;Af4Zu]V]nmg o[0TlYDTQ =-zexM% W9x'x}LQt  ɉ''RۆpxV*v9Ul5ꓫYz hwy[X̝aC-К#t c?c%b`[um +8[Fmng,mfk.7h4o}Cٽnc8Tpm̂)Bk%Ъ oyO[ M/`$$_P74hM1"8oKKb0^M{+9%UHx]K5pMXFxT@uLjKT,2I]]V)iiδ3\.&4lmm׫cHg*Ǧ :QD]Ttq#a/jnp;"4'CSU!G¤?*-防(] G_O5/U"=;a&:WR:GZ_Uw\4Dg10t́ ֪+ϘOBYo?GfgS0 bD&s7^LqSCaZe.zΠN CWou/# t?>BvQ[u+Z}xh?yt]54v4K[zzqRUTMiϽ3HT4|!RuÝS?+},,%9>s2|ܣ}}:YMCW;n;`VFbM팢5'=h}~m\Ѱx~b"F\CS-!c1Vܧ53(.KO.}~\ 垶^)\EZeV/?؏ rE u'oX\LY/A81 \nqNguR?ת-~pd'oB/dHr5`$~ݿ3]K)Q|ݦ$KH;#$ϖPghy:5 (OYc@gܕݦxEaT׉2Ɗ=_j+0MLOdGV3m`GQ쏸.~j7~^Ɏ ;%V1;%4uN-;ˎVNiQ_q ʃX*rvԢEg % LE(+?Cyrxre^Qc]N]Y@+-erZT  }7}u줢=mtmY= \ߧw<\ʱxmݮ^,0|m`C`}x*. ׍*6 +KNA܈0sj& B᪛RɇY}2ev_2 013,>'ژm)ery!zr R)nua@J2dLV'; 0WJa;_4oXyw'YבN ]A8qnG<|%B;ܵaeZaxSF\I֞ڙ/j'_1_~j} |̉ڍKGuP^ЙW||c]9Z_i@6)ˮƺ㱿z!'MML;)7i(pWo,K7;i%o+;Eūࢋ3`%?gGa.M0+fJBhhDMN A cHH[O:gT&¡Ҍa `Sf:Lk@ӱ$LGK-0 ;UƷm'Ჵޱ)f@'JIuзF_klJ,()UX WJ^ ZƳdQk 2>.vgf6BwclF^D(-p %ץ}Vh'x(Ћmw"? fCO{'Aۋ; {$);r X%qYh3 v.~{)<>#]+5W-WwD Njm zqoJw"{ ށ}X@p$볼3Xi%w&E|ZP:n:$vBD2ISi$#aN㽖P/k.!_ۉ{:B6z:~Z#aZ nC()Ό?m( e.^"қcV+yλ%( 4 P9y[jvw|Ҝ)`kvN7rE=Sa'# WL@-ND E[ jJh@,Rnxp=R~jyp j_lvz봤iwu&x\ G?yZKPpV x<>9ל5X8` 7_t~,XѰ([JX\ڝQVPvXrAWo.k`9ԓuY,232"r5)4d V(d %/]ȃ\a \f ?{DDlᐺ̩F[[^3$}p{c& N<~ڧ{Ɋ$V'm8Nʼn?׷VB yO8'R\WvTcu8:Psă O泲yE 6bp ?>ChKR.kR}O(l}GΪ/dJ7om\&v@ #evI"TfK}sbA s;PWLC"pGI,qf!D[ې),z̞4cuvz֢Ovv2]n!;\<@#--KQBa%}}1YOj@ ThQGu247u`< -Mnr |ZeW,+_ikZzphD wA n+Ւ3nImćfJ474':x39:߷ǸK= EctQzF=@9Mh׏kgM"Μ%-Ζ:{d-ց$Io4RCqJ K_SUvz"/u0\e9OgNϜS=!).882gުQw(BUN/9u,VdJ@sAf.$qfofdONfs@R-^Ԯo$rkn2 @ؾصt<ާdE f tLQR&&& aLDtOCQ8(V{'@Ŋr k~[:)61,$WUݍ0Y9Oq0IkIt*~Z_bߡ`3i9Jx&Q:h%3>o9Ow a,k`rS^m$f 0 Sm&tތ ;fmKN$vON[.'3.0I1tqSjCE'"z(G8bٜq/U9S?!ЁLpl&%kQ3`i}II|p U$:UIۤqK#e]I,t;s>.*H }ޖX; 9^)IR5N%>upr==D}aX=}2lg=> +3ҝ<'SV&Ǥ'. , QW8!֠b'EՕl40LJwUYy{p|h0M2? Ȏ{~D{QY2~a=4~~`>Z__~)/`w6_WU2g5.% #MI5?̏,qSk$CiO?nR?RbmA%:$G9~9d@h8|g%$pjwQf\HjC>)jJ2KLI5^&pJ%Cs8 ,!J=5^QusKCU<x9!j=VL"o)C !YA@F[ lliuss gͨ]g*-{pKvs(qyʗuqd#0OAEN?wzBPD3vvy &JWm];KXu 1tĕmVv).]dzpnWGt"q L ̾e_YCakS;Cb[T'ʳ}nmO@y$uА*|?ΎY;Q>w7F&5?(5/9v$u ] ҝyz ۞yJƇU2aߡVMy R@("kV;0ldq?Jo;:)M Nܲ/hNnY;>#"y(Ff ^@yA(4p=HD̔6}44a)N]';--Yi0JF| P ʜJucfyP<e}QQv8҈IAV5i^f<e9n(0_K_ mHu@dDT2i6u3!+ tFA M nN ^0wU?R|:1w]-\E%n@|BVz.#Ty? 8z|-"[t(y&Klz%WY5{YԸ_c$,m5ekflbބ*+oEYdgZBi쾚j.Fw`(P& 'W{% KlbJng¿=9r\2#~g=VMQY;>1ӒRJMVw` j 4 #.oUÆ.0t :+t↕U_6byݻ~DnAp$~pP7+ 4Xni~E ֬'ʙs:EJ5Jx&m[qa++?t/%Z5Q%3瘟v|H)y!kSʰ$خ jBs̸ :bkH tG,BuZ9dO6 6= ^3~ eIc> è~)j:pMQȄtgl0U+tԍBh`LZFs-98Q2Vj r2HiCNXbsdB6%-񻁘a]Eڠ(74?^T ZH8S"i }~MwYZwŐ &4Qed[9]튛6ú;@}껫Ik_ .i@Zv<沄0qYH#nu_d-7#˝*^ZΣӕ>ج{mzpZ}GVő}Ǜ͵ŤԘȋXxvuX8X{X&iyf_V/Z"7a``hԨ/Hחl*F 7 XSB" vEM)dD|r/ z-ngwfj:Q( B"av{FI^EES,#]ym qyc E-PJpڣ9~ӱ[vJځ/B("LC{!w?,8p inZjd3fӭ,Ygx'o >q_{Q|~ MhnX(F#1Qs0>u|9P앑J^g|F"GגuU(i|W^JKm^ySOj=ƈ21[igRNPQu 9K WI]|0"i~[:-h\zwW7]+8'4P ֯ LڠM./RB?z7G%h5wt@ݧPJQz=˜P}ݟ빇Z{[LG} Vb,qOU*a/< ]G8 FӸ{ 6_J̢?#0 Nj| t_t̃^ +Ncҙk%~) ^chiJ}!hėfuX9ef{ ^ ծdL$j(.hU4bT+ɡ馓cna(7azKY;КN'<~ܒ4*]װH">{4*$JcJ! :+&^W^Di#wPT{61kEtS8Q]x`W5!eiFm2ppsB]^i{i.o nw[$k-JTd.'-ө7Ft5$_Z)AoBݳdd ŧ<\9/\\`o A&qϱwz@ZAdO-^G@m'(6,JjE_o>(*~7)5IڄO"aGԙn Ix~m}z| 8DVb~!7ZFZ |ϗ27nE[{LN0; $9lml֊WhŌc1 ϸVthk5XjVv9k.q ʎ ("3f-:5mM]`žO?ƽOdcݾN` 1ԡxiiVݣs<<cWf6 ɶoYBF՞i(40υ!@o媘0cjxǖR5| [>~wbG^t\g<\ ѹW HEǓ ^Ie$ᑗitt R0B7OrdY4j+)OQ{&n?=@t'cJօ.S(WQAa)$NjL,' <#j _B`ۯmcIF U" fB4"Z^ZE.nyBZy#3c3~j/x'e Jmg>0\"i3ٓ2 0Ug{u2L?ZwTvW5u`X[M, ̪ф(1S;ߎB3'hVWJci~;6جf=UD5dX&U Rt^1{c{j+Ioc ˧]#) 8retIm+6eGz 0᪆/4_PZ 0^*{"9јfVhG +g_ϘN躔;L9:2L^(*)3 ʥŁ:hГaBqrCFx73|7k- o&MJU0i-cT0T / *ؚԣHK1=0ij6<l]?4?%Ii^ 'r<Ų׷HԿA<^y! 6NT]77v~p }B·l KqA']6 -G>j'=.R _CW9U {ORҗS52brd8vjgA@ľ:gz4]8߁ Hšs ' >(z}@t"Pdž &E}7m> pNϟyIP&3$!TV GRj\WoCq&#yY<:`6ȭ+ţb<%Un(@[|Z)3Ij8VkB .S%HżTٵ^[/P3|Hc|@.z?&*_!SK&>um;2h+7l:[뼹㎇eZj" ?Sį!$5Os`c#ۂ&ԤFݱ9AsDPԹGLJO!#g=붡;;gn>W^Nsxm[vyFq,Urcd>gIrNOP/s=ޢֺo8n< Bl 'Vڮy5Cu\W;V,żZfD#-NkzuTO돇43swC0|zwwEH &ߔ<$|1I`?$GɅڔ*K 9jFN?TXaӠWA)ÕnȞ2''yTO;/ZWA3tTef͚<_8LQp23'%# 8x*nB_5uxgʹ43"Ele;sqJcեY֍m3x])凌x`;k OsƴnrI6vzZ?ڝ-^Mn1{~F۷46ۋۂ9sh%a5ft\i=|@"(l@- z؄²Ɋ_nV"\C{z@r͑a/ ?y''`n~k{v`3jWeHt:~,G^wq^.GYx̋b="mu}v6kNL$ |2gnD<< CB)blL]+2 7dF3#z$~f#}4#QB|;8hCo'W"r( L'=/u70x(08q)f-;᥸TO% ȾchH:)e+!tKN7ܦ=͸8Vos{++[KP'b*4Ɲb砶ra95;7[y]8]m!sTzC稃!yXg`hux<=8XUNIWR`uO?Y3ixybRa s*J dC&;^0hzPm4:qr[MփŌ۷89BYz)EҋvBmhaq+ EĊG0mWWc܇xi*_7{նAtff =#QVjF'?9+RsPfUC=ubOI4ؼP|kC(^fцqT,ES91ww,ۻ4!ζeؠu(4}Z)_{ )F7)TSLA}-=W/:U<T t85'5 A+ $­v>JX#\tx\ӴgW>J|**wlE.)/sfK{̱J#|f]a{K1a\څn}ړpr29뾮:/IA9\ -Ov߿2yB*ms!*6o#S1n{Li A,~~:J4)l3RU]RIw9ē}O:Pp*6YSBiHE`nв~xCE}/42)ք]Y Z,B"wߏԓ:5 ՘ȑ4r{;_v ?p>cas,cP/M`9*E 2z[ Q|5lp4UOgҀmdؑeYxPVF`*Z(4:԰vevK[twq?@nCtdR7d 0VTV]`1f)[˝#u-Ҩ 9eBf[!cԞL=z+ !ݒm{oI #AYq]YM0zXhQ6;b&N _5vW7(k, ,aՕC`Q(E>kKK~T4nt:ld341ȝW%;/* 8?~0pyͨ<*p4 @.O6O4LSvX}%.p v }v% @*,Ue)CVe0×cTM*B?9"Il־׻.Op=#*uHcxZ|s07>@۟#MAAt8rZXIx=SPg hcH%*Xjky_vyX]/VEjĠ6Đ307ZD^q}y5p43) }Rj찗-N~mjt6eZL`16 T9)7>kN<c=uK篧WYUz:!#ҳ+yLC$ 7t],=T(Y(=<@68Dq%e,/C@[IQvTl`>(g`-ZF_4~(O|avWm+ "f[ͧz矿C~sA3-z tɃ1;m hђG#"7B)nΧ|D@-7P!m\0 zxFj/J*\/v~OwչAt 2UՆ@eCS+4f`]@8HiHۇgۥt@?irfXt%tҮWeődk AEvW 0$w  rHúuz.-OQq[VìRM)(Ҳ:6Ѿ77Q?eIѽNQH3ѶtgT FDrrsIH^n y ã25+BDk7Z`hfLpmTU,I(!c.i+ wהOlپ_ZY]RgjGiZqK:0!vxStGky/-*t_l}'=sgu|ĵ+꾙#cct CKX҉U7- ֻݮljy*Zp,muϦN+9|Sh^,VxQhTd:<Zn 0'1@RG NE~Ι9G{4iffF#;_M@>ifS~{&JSQZ9+VHϺ}m00{4NBCMK3 l¶3'LPx{ `p|z?KFzV ubo3B EFv!4C?žAdͤqPS`l/RR?8&=_nc9DQs=ԀUsk{z+4)$ƶnty}#]%l"?Yx[5b5nem̏p9d{m4Z9ϣTynbe_&J ="k~'e(D7y^ 9sX5fO,h \e%aQ\DʚlPEžCx*_}gqY%$W~'j(sn8Wqo7qQskqw;!nݞP8Ngg!ees*Zi=Q {،9sx⢕/d\s8eeW pCUwX]` mi!mtnMfe~u lֽq4uk+k$.7ȺUI60+(3퓨 IEʲP֙.  !S qpb9ܼjs#KV=NJ>OX}^Uݢ.BXh&\U\dbt]i`yVda{l@6nqnp1S:a܃G<&v3S֟k4m b_5~Xp-L"Re Jb:ώO9%O{Zg2]~ۚiuJ6\Xw];ƸN~-#{%KVh>k.DMo0n#, [hϩ ;NasUᄌLKo[`\!_|vE#!vQؗLM,^FsD `iXAQ0wqvٜ??e e#KbF||x4@>0> дlJ=㡵kGJڔ[&%efs^n(ǙpmBLbD@WpX O]?Dz=hb}i%ZYly/;gg03}ODj~)sۍn"]te]ñzވрz)2|ڂbh?@9ɻhCk6$QmۻamZKC fbf7" Bc$;R@2^6"- 6)o+>$$^&7ΰ27=4Mt[xf1 '^̕?lOW9vuNJ]~ۣ(xcSv̖3GIlLZC8춎3 3.|Cq9\IH>qcw[3{CBpvČJfCd^Df2@OB(̲wm\#VMY6Ͽ&ji> J"h\B&8s;|hVԒ(N~\a{4YW풸 [l|u⠅G=}I[*6lN]PRѪ9,7 }Lҟ[i4zxŲӌm<=g^z 6YdeTd@ͥfƬ]g0% B,zkPZZZ/AS„Lv=9[#`A3sR 3gEf8݀T2+ 9DG速vdm&g:?$ 1ׯV=Լ㏿f`+ u4WmlQ8w 4v-J+~E+p#sԺgP6%ZN4l?Z|13?Sf{6P6׫9o[z4a>q;9V|8ۈ]H17Vx{JzuTRlnBtA}KYi~y=aONگD.ׁ~KKEm}L:a׎ߌb1LYj XeרvwVK+EcD m8@;)fY N֚Gߓ Z-GNnc-P2r"+d {swk?NRu'=/ 8S'o81ݹ9:Cy>yl~?iwP+ϭu 3ڧ|ǫA]%qKzy [mcuM?lKSD JM}L@lyo>Y+{ԝzg-UU)yQ_h)i&W6%N#uka?5P  ,ޟߌԋ5R|7+%lӖH/ܐ*(V` tީn6im pb˖*brۧ,:N2`J?t5%*<5g ?(~\O5jr{k*x+IbƓhdR@a1wt).3~nVV[QPc=-ލ?Z/Pѵ3oƇ򦴆/q5=5,h FGƎDHMXF`olK/L66BQ*Pȯer{S:KlϯNZ(yK>ҧM5xџmx] ETV6ë3>{YӢ8,Դ߿~x/oj-4Y"Vk,&~dQ Bt.>i,8G#e^n1=/pP)stَ~<\ yH^aWZc6EW Iz|[Ӭ̾f:x\Vm|ܐ$iڜhhxlZjIiRߜc# [ 0@F~me8uL:vpr>Yc ֿx &hMsv0dlZYՌljQuHT\5v>Z:GC:^L:weIԠRv7H{hf]R]tnEi؜(iӨ2XC[#KRA,\xVГj ,IiTkrJ*.RjlW6FYi+Wy0+O%MQEx|)u~Ky'?DZ7R쫪Gui9p VS B ~zBj Jb,c3CYdu|MfYzS7^hm\:Њ.hL\^>9}+ j9\PrF;,ZR<"ipuF,Ι FA چi:/溮?f%*HW!*>rGHO7{>L(Ƥ֫6~YDu,E]&ӯx_`Ȫ%Cuxm͘955VKY2]A3TF3i#QM1J~oMXeʭ6ꫫlUmQBQ)phc2;*y`҇q:0Z*aY<~9j8٦*}j;Z/n';ߩgAk"u OLch+Ԗʛf$X. \Jˍ+<;{ LU3!lXoKң( 6^Vç~AdtUC6t>UfMwBG9IJP)ӝ~7#v~Lʳbr=C6יF |lZYMgjF8v75{S'<V -#|ԥ"2dd'F_]ܦ:p˨PaoՈg\i=3Y/gުy '9Cx%' > ~ ~If}-alm*VM0=| ֳae3b/,tqaSa4W3II;5!7핍BD ! x\n7BRm>IoBh&OJ"Z&xyeshF{tiuw$0IeFigkj--=UY6IOm(;[3C {J墆 *9#7<!ȓ$5z.롋Z8N9m='[tmM1QUH2Y'͌(A1isoMH1h1of;t?e\ Cy8ZwDD,GEQ" !<%u|"s+]dyz֡ۡױg6v:jbHDSkk{qUDZ4I;\ 5?ɼ?9=_LɚE"X)t{]PV;s5[-@L1VLTÊa>aaQ'ƴ*4T9 L׆Ar'!nHݝV$4bP,'3<7IuLt-ZV)3%4soHOM/팳ƭQ? 췚R>#5E]f1+!XEm䖗EE;3|}DS~\D-rťT#UeeYOd?27zt(GH3^Vm͜79q24Qɒ| 2R25}L.1'm ·4L,q FER瑤7߅5v TDHlW5l߲RB~>Z Ғ,od82Cޗd{$F'miWx˗X6 }窢,94\h tԭ?`qsr5rLԏHG&kqt>9f/ZkIujÓq[ºĿVO#;. &X XZ{v=GmрUDWP qNdh e[]=;L Op\fV*4nmc7mH=X9dͰt߫WOժ Q}pfm#kHUAHo~84 F]vPn [3aF=~<AB껮'$)GE鋜|8[H;gC\) &)l AD6wK Kq 2H,y1 RZMe 4[>"gf뼰T(Ǧf>>`t|Kʗuj,cP.AK3V[X;!n64jsvuڞ*Lf a(iL't2¡## >],T+QJ@U\/uQ(#Qm%Hyl$G:/Dj<7 t} t o\fIS>Uz-G oaSYHL}fso}RޥaS'<$o9Pڃl JD{-qxx^1"g/Ĥ sXN:hⱭ&yOU" c'Z6nQX Ffn4 MnJ,UXiu.~ , $}uw᣺79,U-YZ[JM 4d^[u0#~ކwzoNYN[,YS Pz ,7=X1unϱLG,!6 >eN7Eo.&,9k]g<☍e4C56g+_s[E31? N۸]G/-#JXYҶ9AR _7q9ht-]pNu*t 0IX;&D^p$J.Y͠@TXNkqmWrPׂ#W~w-'[,s#C5pn)u?uhYzSll0ud_zn-VH'z;_"ڊII} SM䝥sȪPwH`(}A !`#1vj{ӱP5BoC_*%udwgƎ$I D=ӞLxe)EjR̽yUz7 KBiܣ3 @3kCUN e]jɲf65u]0ې?֥k2!an&N@E?U& &t\q׷Ltum8Nx;4ٶ[Q0H6eNzqAj[&K˛3H-*r8D[eσR͘;aEb6 R`s"U}7zIQ* F js#bWe"«Ӈ8Kϝ)Li͋Z&Go4_ƬV$+nlAۙS:i;`u/jl^@j4te|e0cK` QPJ*v}kꚫY':f7;: ?IO6Z3m?O WmHG!@f94uبcvc0  6Ll*̕Շdz>qcDŽl:⍐f7X5ub F gQ#݊ä-E^f|u鹛lAڷmT0۟cݞMv!qѯ-a8YuGض0KLP훻۶i[WY74Wm{ }1L;u`Z9)́5P78B fy.CcH #Ga!(뻴_1YV1יּ=R1 0dR#0*XmƵi꿉O:D* cF,O=,c,虭,TLԞKYM7ʷ_AgG%Rұz{UpO`6'5'd손 ڕVI?Ċ^ Z`4 -r[Zf׼a.=Z/o!T(ki>W'ɧr,cMk#puUVW;Wzmėϖ [eͩ~YPUNYs`a^[S1P\Mס6][I*+r"_9dYkUU1^,qӹY; hSf__ ?Y;Y8mۺC^ljQRuU`,5yU˗0au֫tVB 3rI jLi(k-4ML']`2X(qd)+Ԡ꯱,te߲6Ũ(WMܦC!&mY,%,Ŝ!o꧓" oE5 sѶ(La~/ChQ0Lг;<%~٩+ziɇ t,'x:UUYs= Fp8Hz}Lb1r0VlHPȼrdD޴fTA1yB0 ZF,3s[myW `.: vP_oZ%C( `q2jQa՞Ճi>sox[s=Nd駹*P:&lde=aC[Zp-(1bJ mѬ2]ޱj{h)NE7"h/-`'x~f` ߊ5յn /"x\JbL~?b{!@zC7`s0)o훉[8<ɯh PScT:3qY8a Gt)T +OZftwgVKllJd˒1]b(jZ:ŃN\?nQ~z"6LJ?&GO3p^Fk^֊Fb4{:ÜghٶlqMs7oѽWE:hSx}j7úgAS;MPgj` -u܆rA( K|pz3Hb7&ed tR~@uE1Rȱh#-`,؏۽-g4{QOb\"ԓ]%Qaԇ_BbxTV|;0zs[Xvޓz:VN2IW'aWyF\K<9MIpJ9ւQ \Zհq*Hw{,ԟ&i^ mv8:m9TJj0m.z4]T/k=Lv~65a8G rRl>z~ͽtNI+jO߃KX$N̬[V#0`i#,GiH@@Y a%׭?jvތiCUV儊):1W\ն{CJp[J2§DgfNrŻ v g h4zkQpDPBUGia;C=dՑ_/=^~ 756MikYb@VvDݺl-*-JN(yPP $mh!El8 . Ў,=80f A~ K(Dd /*qHc+08ϧ"㍰3';{j[{9$N3,EoTC(, T854fmrYQ>y$K]Gy>ZA@@^ˈSVJU S݊ E{LvM-&iP ?aћ,H][ 8@3gy퐈ģ'@;udڑeoL[Bzے LUQ "tpt-{>e6LquEODЍ< !gV)3)H=!RX*K~򎥒ڮ}-XJxbs4ʐ ERa ;邰gU,h/gGScaD^F&QÏ߲˂e\l5>E_M );.{2~o|bςuv60O%triC?X O hhK ЋkV'~ɋup%g5*k9QUIU" xX*u'O]Jy]>xUBnP{6*а{eH1hh:*59Qj- ^ҕHVrVACg_(w׏`K p{~R'űXal)Ћ-[\0K.#;wKH aisf),W"a$&k*-Qs+!Z"aM4)|)5# +%zץWubd 4éh,(~[o]=I9|dui$_F`T QCBKYa&䉋q" [&tO>1;r[a>#IDy=ߩ)=RW;b.z@2RmջfN PV!S;2^ 9wJIljMgzfAΘȊTדXnB#5mhE`?Ǫ~0, 1`ˊqrQqsVyлDo#펝{c8QI2Y/Cj~=9l`أ5V*p]dxL;pl` '\U 87,gW֗h[HNr,C@-giXQT6P z vk[hn_{f'w~k\B E6A9Sy&]N|*}"5eY~PB]i1\'* `Uj׈SI)Tx0O b6i> JEM: $]d+m;*zCcG]#`gX֓.8Vc7Cx_K6`sVQ]Ёj FSdg?QBl+nxBhoi2qm6ZU3"bknM\΀u.EWSH_ };sW!f2D!QOy^/jC| P&%Ш[ 'B= vwk^&Umk_# ]cu{ E# օši,Fp'}7$ɹ=6Kmچ8n1{l --C: o&2=AerϞͭƃK;A >M}m F|M2T|z4vdP=}R b& .pM9'5)t*Vv"|"T]#)6퓱re$Y +n siLVDaF^f ځCJI7[i!q-f ݀a@gA~”-=w9Փ´uV=0M ٭2ku9f^NYp67|qjzAj5GA'.`F3I9LK=zYq0u'ǵodǨs~J.ű6]Eߏ|Z]v"4DA%м9 (ZAgGt>"/'[*2Y;rzwJ/`)p UemOm0;s].9F)) Cgh@61k 0]`fQ3+gzƺB$rntB7'K1Vx'.LH_bdᔓUAdf7V6"b1t3i)Fb,Jˎ_G"X&;S[+B.2c٬&yZ0L)@?ŒŤ~C,}M8n/+>L)oج5’=gv=哲U4G4L&2QtLH%ИǠȐtT3&q>b2 :˪܂HӘ(8Zê112^xWq,}efP7XmeFSf ?S h92k5# d꒗~bwvH4|f?$yfCi2,WG_ NoZPo-qQ@f}ɣ ø(j;zPZ;Wv㔙 ᯖjpynW}rNzmO\<^k;EHIl;-nQ zKEۑ;(2pXZuI+vl'=l~±G Ӝ+CJّYqpN )[ڔ=2^96,uW}V恥3S?s z&CVL[<73:xlTmc/O==Up!'~ \ s k… /ļX!*;Ám@wL`\Cs՜pd$hf˦?=eLF{d`^ΰ'hTB8nM)XV& z:̖Th酴A{#tsǧ1t1͂5ӿj:-JgE(@L۟w` ?TC-FݩKrC=\r|O`~s1Շ 4^LX@w)[bՙ T9ΝEsӘߋS}`Wy;ϮG ێᖨ1,kզA <!MKJ Pj!¥zY \0OQj\=1)ʍ=TIHC/ڑdʣ[eRhB!i+b f1 ]rQ6C?0xZM/q~G,gH?.J1[H4M+{&L0._3 d @~@h|$ 2($KBPoVMwhy'3kMm:t@y{L'3so$:47dcE tru`bRuG6` L L"jE_t`A@ v n\&hkNR9p+ aԬ]oa#+9=xk@G2sOh\ ^EE1(G.5I]A]ϑjj^w8٩I*O(3>zG&W?kdzym/ D.F~8W*9C=/={mdI*āN.s;OA(zRT/4sΈI $z.VNW_ZJIU9qi2I>y^r"Kɤ_$@H7.,wGr}ߎvhk녶Lǭ oZ(M8k;լ_9A;zȁ<۟ƺc_戭j;Bs0_?x ?ҹ.#ЙĪ]O:$Oyk(On/K~@9Eѱ#Nuﲟ8 >ѯ7J /|[hP<&tWwS?R)^#ߧuXTx"Ѝ'39Ycdi@U,TS,4%`B2{ǪNh* Z+\䦩9ώM#?-[ x 4-usJ)C?6&8C4TI"= LbSzv_4uK'n!-g[~_R*duMc&-=R(؈0USL0xJ5Hw0~<]oNLE&a4Ja38*@@@.M1u>pWu׮wu=_冪r^ʊ|7g:3P\c%TÔMPxc"'(|9XgEGv㔁y鐨wч1wgJ@QeVԢp2axBu Wx뻊_~c\]ӏLϴD\1WM?\'"N:8?iU<$E9itmke9i?tu`iMG #jHB=@6ET3c'FOg:Nn  f=UG zO>a(7 .5D!EHQ9 ,y ؕ7ڱϸP۲G'v8~I0Ǫ<(t*ݕfE% i[L\Ҏzڲif4'$#ۢG$LywԴg|sYnE?A&j [~RSn 8+!IM% Flنp/R\jY++=6|^hoVi[-%AHo\}yvyVDQ.TqHT;ĒbVCw / ׶?ht qM@:}+tu`ɧ#_X6 arJ2B[fi)C !|TǞ@7(Z[t"Zbn^ZUcE]`7Ҍ@S+\\}]^8xZ䓏7Pee+"Qi/X=3ЍN6BeM1s$e[jv'`5bv@İz ,+7H'?Ud[CIig^b=J{I8)>~,L{͞||[ moHؔΙHiJ>sy視VB PdQJ"~'g&83EFDqM}jxTwF*tF%f|g`?GK NP\Vs!rt{nxv ҥY:x7-R41ng1N %Ԡ:ܖgAtEb;EDyfcS-:u."w:i[&~x0"4_zK naY0jb|R.8t&y&ML@C;%  Z|qJޓ N_@wKV:R#j]&TU9FtF |<\0_0zmֺamOb.>G>aHZEGR'WU!=KIlHCFw8bƒs(>;kP;P1V%+kgMa=J2!/q޼03E+1Yj,8HMÛfdƠ]jI3J07d}}~JFnXlۮVR`_5~D%429W,~Gwl4)'{Ѥ}+ "f<Lk\e ?yd;lל{rCT5-bXƒ<a67Y 7dڇ`u+ {]+sz̠r/ۃm`zCBZӂ#mDo\`0_FD+!j `;:,)~-N)K 7|piWb|iݳnP1I;aZ S_g؉@hJNi5sxV;丱Vt@kwVBCݠkbd"N DtR OFFEݒ]Q 烱'q$Gc&W@l#ځl‰2r6A%jsF \N;KrS/gtX%>Fuߚ; #YWjJ8Rm=h!"_:@MI͖eU,]K!7WRv;itlUoo(aS _U`w0Qx.}w&V%8Ȩ\7Yt8JU_om[WU_ylO|s,`ȋjB&e4>50hBVT'yl&aP &hjreg]2ueuuI⩥ |(u֥t4x YjAXFߌĘ\4sI(hD1Rًj,OI3 ]r%I!$ uNZ}^ܔ0lz,ɞGmPܮ~`;s4ȡH6!\$AbqHBt,Ƹu4/=JDE)`ŻSI]4q ∔>S3!X꨻*5pQJKk6De.)Ҁ$hoOO _ K;:)$9؈ TQ"͊V>-\ezn"՚]5,.AQxf_c@ Z94q&HN:c~^"05'+8ӏ  B>輬)e 5.@^E=!b-?)\*IHYMG٬3>R]NI?s#7+[شmJ1:DGx~YYC0E&%#m}. iE+iS$LǍPTSBk^A#ZfNT쬨n.#ȩx''j6e bJ 6^! ֫pS UwwhB'~D a Lh[xӸe+Β>9,9Y%'A9P_@c6C!mxI$JҘ`Dޜp[,^$5RZph3COжKB%-:~AχԮ#G4hl\) P`LKcH+c={zXCӉeOTV҈ä*\r#J3ܤid}g0͙⏛GS^֮{wE]*Y(9zCVAYj(O זS@%'6|v)3ƒW `"r2sk%sah0SIܷ]:$9|M!3Ke8}.#,Խyҍ%\H8S4,W%4L|#]ϊQL.,p]pSk{M(gN{(_7#; &2&7^(&֤0~"YT&i}@k?I6=4fư-QL t໧v建D| T[85n aS`,J1ӈ?gNW bYgYfĤ` }PC8H1~zZp̂Ǧf+<gX̱o_<ȫ73>%`D<:%N%jۗBs5vE)i>IGV@d;b" ľ=ڍ&Z8|~Kc[6yջwe^ݺxnU"ц/Vngl><&1nI_/ C1ke~y#$?CO踢m[ۃVEhv"_/2Mn unLv鯫jMcs*B eKs(X-ÆʱDdYǦblAZtYUtA'VW5U6YL-bcbv;S1>Ԥ^^n᮶JV,cs;P*{T-ܥ$.~RoKt,[X -8އ;_0vLjՅ<z>.FiEG{+jʸY}wcu1"dQ4Ue۞:1tm}UWld ]5N,/23,ZJ%b_>%vUhYPeJ\"9dƕgni5*RhRE@1a>76CseЕ~*4s w;i`[?]{M5N¢atԣ*eN[ 'A9ˣ& QEz5JU)0c9-v.eYͲ^e 'z,1mh־BslUPwN[,:;Y8ϭy2/!ZKHpboYB]2X4.3\'4:~jz<񌚺..ݕ]t,?Гxk']'AKp3MUz5**6-YUgAЄ^Uc7BOzŅ/Ȃ\tłj0(yƥ]a ߣqaq=?\hYC͛Zx_ͣa (1JKC՚ !qX9;5Bn3921!UWNs>Xy:tX'j~~2bj>bcLONiT?5=|6MvܳgaueR  ǭ 9ns\&KK#s6+E5 z}݆XDÞzVhE Z$0Dd]I-Hŋ8N<%ȱ#rlĵ .eey.2Z:j06dpߡ\\\FLeh(_?[c<֒sU2c*zDxfrPCdٴ|'U'r69^(PiX5i4\m[-8a ׂM W|1C{rκrI%D~ uγj2 H=ep y}\[Ĉ/ %13ƯǗo%cِ67vsЊ&=X̓n8>jMI{TAJDn)_E(am: Xxmβ_ x% -#']_;)p0SG/h -7sCT<(א-h;(qh,UW"N)F"8k:5α<|n&e:%]gthrFLst?t)Zѹ-{= dh+ѓ[zy5pCt!XK-ԣT+6RwĿ uQ5Cjk"yXl -2=pFTfZz2cOǸeDCe[!XCӥMR F 2!SiȖ)`''p朎_bi$fpLaLU9/@S^iZ|E]GM>04B])JcۦF7,oo}LzC[CJғ7 {Rk֗Ľ5s.dzp<ɀ0CHTC.Lxk*j=7-!}DZK{/nnPihj&G%?( ?$7{Bi4NMk}reIB2i÷W G~0(N N-Ibn4^{( RŁա!K|p.KbkjC̯sI촻7 P&`h28%\gmv3'}*6zX@-t"Q=+ {Ҩ,jc7pJÜɡ˦1c97b}7wκs){@;Eky -2(՚NԤ-B(o 3%x5lgjsM_jk梎8AMS?~ Qn%p!FNLt`k& "ō#5> )[t]~Һc^p\f\}m@~gM"c# >| }}Oi$’2C,kLqE` A-xJ{4jp-Ō^NsDAı1 "??׃p"r}S:"p{L^*rppd DFz/"RkI:Z[rEI<ڛ-("1yr2OPc~|\ TL{M`0<N LT ܫ1t)c?XmJ7sFӊk/ mݕY┰bSDiSuK[-D^oѱ3t/IMP,53gR ՞ˇfuHQ -M|o@zd9GĹ(A |0m/ !}Ӈ5;l^ꩃNNFxQ8*/ol$/rJJ\Dy7󨡊^q4ݱ/\KpeŵOdTHӼsU)TܶL}cp7N I&},Ԣj(EFxzcr4~2WuHXCH3#Ѩ)"o Z;}؞}Tt@pqH}5o4*1GxB/.m+EΈ .έtzMws)֒cQ΅1|L"HH5eTؖcR3aPmv徊p=MUZqUjZ!槰05C幏M;J1`e[*GJUAԏE+RjM}=Cq RD#U@NBY>>4dm^VHFuɂHdzFaóI6ffw ܛ"oFTp@VlL߱\bP)\CMblM@$VH9E>"'ZE) I]ļM)dJx2&B( 㨥Hʰ Rn00j/ rS6"r ^I`F4zDx:gS.n`/A3UR[U+@ӊҚ羔bXBϜ#CcmYA!=)hnJ-ehPq::0vӧO!j/ B&V&l\rӮ qܵJCI[=[#>.̭A1*ː&^Nm1Fjl;]WϮEGKn.Sxn-Y68T.B֦,g4sRG9A`-\&d@I YhvۿFuC}waOdmx}?}*Rs;^;&}8P&v;副"ߙKxۆς"Aj>N"<]Ud{ɤ6}:4VX.GnGPi$Uא噪_p@\ᄯ/TIy.tq-1x3LuWfo7bLh\N=Kgo~auhL4LPowIĆ w%Ӳomp4Zyu&XE⦎;X1Nhtvs9ՑHQnLt ]Gã&A %YY,O//Yg^Pf|U[Fı4eIؾm_:g]~{PKe.ǿ?oc£O}VUAj 琥;tŰc>=nlWIre7)t)8 yo:BwxW>'Mekm.|#)7Lu~t7#GT{? rY\jo)h,:AwcpoCseq3t;e D&:i2xlAJH`ܖ{Y8L᭟t^"Iή쎀Cs&8FkwFjHC$B>9\r~ȯ(~2Z2feOK^#e>Xa\pF2MNrN^yM:]w^@?B yݨ|__C|32 |MŊF>+:( |(s.!xnwcr@$;86&505Mv57R^R(?L0(T9>y#Z61`0ƴ*ڽMD>H[Ch*guPߙopwBO\E /gEa֎HDUYҘac ߛȼIt;Z6dVG_"8qjn]|K!ٞq{N)+iW+(MMS-VZgNPi)1UHI]a7K]r[+َ"-4V{-A9mAz7- E!^:t=yo}ʭboH&gZe3(cUn.tE-@Ҫk9ADf)+`aNSCF5Ęk\)Nů[W[U[Y';Wp=7>qW[9;ݱӷj6YWIHt Oq9i%Ue)TjH29]ൿiTdd6VuV:dO@8k^QfO:^IRR].`2ڟJ/WP]? Cg!IJ4|>jƱT\%sj#MLU؜WƐ04w/=v9F=MI8k(˼ L[{{ž)_TyěĄS6N[!NWjԔ4F''H(A_s uLjB0>@%ɂ4i<>@tOqX~zSXnHSf!隹)jwq6 YDE)ro8<.lVr +"ٖ/ [!T_5XMN='lfX%sYptßw[-t VM̓,Gɚ M_Rp RN] N'å-ܙ$.0g!Sz/6J˭rqИQD paV#߾0 ~:y~=Orl~4ًp@bBR& R؄U+YJG4ɥRԽG e[{5@̧!]u"ɼͽ1Vֺs|p?Uv ]kl\U#0Q M(3jA4.[Z@U{R '0Q%@٫Ƥ 30ǹmFO ƹJՖ9Bd#3qH9䇩bL|h\ E`sѓ fRC2Q&a~▜M4LjGW$rւԳD;WFC96I pw)U6"5i*|v|`߂' ˗gDLީfos8;ո:"Dq֔ 3H:?k]n4.Y[}u0vIlzi 1Q>DTKEO8; cQ̒b쬝#Єjx*?xۭwӅv~Ajm :,"b mr,l&dcQ1Q| 򔤧yX1ӏ{e87#XD 2SqOV\g6CN F!'q:~8ܸG)&[&dKG $?Tk3ʉ7IǐӀ;ȢG|"1(]5v?lj ^H"A3^WsXEv)TĵwYh 'y8FLАSv#R?]&Iv6) H1|Excyo_OݽTxr/F)˚~bBY ww]e|@xz9p W45݄ O5kQ4²PkK(f6.lFh 0]֪*' Ϧ(أb}f. .ȁ@ёSҟFh2QXcs]/q(}dc2h|[i y[u@ayQݭ2t&4{caJq9 >^և흤),F=[nfu kqƃy=ʴ"ڕ2i՛0O@\oGEQ+aqPwc9л1T.ͳ-dh{WdfN9x${l4l%OI&n9DM?b״Y;fsLk1>9<4o;1EZ y7o-:uVASN5vuc Hpunt@4,_ph-2ub@TOx2L.L3x7輧fd}evITQMO6ּ6.텲JR3!Y)gc(W]WZB[4TM5>2Q)\b=uw,GFp3#DͶC¤vmgd!ۇltaz\wYO2.'˕ޛxƕY<o~)E%Nэ &"E6-'ѕEm Шgg +Ex U_W:2un-ҾgWB+18-X=|C|nwE29Acu3_{GzN;M%-prƗWs6(j\)q]ϯ}C?_Q4Y٨2y lpP GMvhz i$Ġ*Ag{h* -@/@];Y@I" g0ѡz88bX0uL8ԳoR騳_a,TU `ى2EgA棭Gٵ4רNj ̈́c<:v2%}X< &VA~I *LU %G;'V:&|J#8.-z|I{k,h;,\" yrdL^e_~}i/eS7 ;?4o$j ӽYdW[B[ }ZR1 W VWF28yQO٭ϖָ q'o xQFHCOg %=JQP \ zM׆Еrr?VyFeuvbʏZZ2j{hkrF3kTH+{weakylN׵lvR/Blߓ.zXM®gIr:%>=gE*zZOYYRDaxFUtlQoy.0EthÎK 4VnR]쥷 uF<#jƥk͆ϮB%ZOk80k͍ܰ0 %bިȒ^ڬjf46=ӂ GPnPFz8 w,âDU/[ɝ rVkMǩh84unQ%4ec3(Ȁ#/p <?3d/}R" I35QR-a`1MJt,8$ɦ:XK0dA/x횾s~tυ14EU'  38J@KL(Y]׸-/ uN :S0>eфnP$5Bv) V!&a=o)VR bG+Rt &UD]nUL9  pXo^&%"YjsE1{a:E4//c%x;ѕguL蔨l(L:\}>ЂV&Y%i`s^kvL\7}Xhc2mQ 8 k)MkoIG#: b1;G-q{e'лig\-u8M[7c|,\Qz`@0rOŠӹXu vr YngliKMla{լPU12R<61c*( .V+VuF5NL t0%i^WQh!˖ Vl@6.-~Y+~I8鵊oCGӧk|m7X1,&W+P^ڵ9 yϕXe-Nw* )YƽaxCk|hImid:Ԟ >7$/d쫳b.>DeMYX S:>Y>d \сIa7hYb %Z׼E8emhc%tkrG!&e78k0B`YvD*OfQyZy ?2%Q 幰IԂ1H[@nFBe̝ ֑mİv̭b[B#(ёfkBDp-H<+}$1ouYKÒyeXeHPLteNஞʁR!?(<1wmIȗ1_("\/Y afcap"m ャ (چT({lS9KlIu CeiDgdm[g5Bڣ Ü /5Q6ϔg_"}ETZ#:Ƙe;Fb>ƧYmqPI:,=P܅ݘV5S8_^ Uvg|Twn-سUA"Tbo@jeZ~F29ڄFlx*1rb*kq\u\@#l=rp, =\HXrkBʼn \+?`w|* *P/5[^o݇R[ wF׷>Kqfw t6{Q\f2FhN=D=\&F~7KPc)uK28`8dk2^(gGL=P k߇V:L8,fNPpp^Uskjv9yR3!rR2Hc \z-!# ֔=8Q#AW ǯ>TORYXu6$k LMSqO%(+:ϻs,1?P:htZBGY IE'vj^a捚}VQ=r&z'ո'+PdD!:kǰ#Zx$$w*'VLS;JؓNZV C; a20\[@&bʹP;qM?|{ۋD  S{tF:θO&ūc,[(t!mgF93g6yZ$]k{ WmP’Ng3gCG+ȗRޖ/ϱWR@{>N+˽ԜKf:hu 0"&)MtdA Dnղ \d1raoۚ骘BxV]DژgD[ƋD5淋]̅;vү OdH^TM-7A{{#}6Q|iR#h5+j/Ot, Z}0b4LpTeш^qcNAf(j/HHꯣ0> NlTڿhA5`; * Tv==Fw} / Iʶ??+s|6-K;cR^$׿ňxi?m:fנ"b;쮀=k?'Z=?f)77;VE}S$ôI\9r۰JrIAa$H  U\ USy6H+ sinAv;dZXz-?Y6$`,{piumVab¶JBa-3`ROeRRB1e$I`o%~5&4_B tg 'VCP#z6Fĭ՜z#5F)d$ du ZV" %H>bTZ(^ "Z9X)[pt؏ʰ \@tCm~b1Vs<&/)X9A]JnN3C,29W, rSe|Y^iHE>\GF- gķV[aq YUU4_ne1Ri95 NRv҈ķ̥.]w%)%Fb)Iq6Hh] <)&ԨrLD#΋B;e0gR#hyE 6@qtUnYTު,pvu$z#ydt&d/gd[bSHz7e?0VoOAC;Uyc$u d#F!iXV{Jf+_{uF5?֩5a=W8$;dH.v_j6^& _{3/mI0ٝ(%q2;Ͻ}hnXrpV;ⳚNyADHѮ8mT%);xt;QGqLA-FSqUs칬B7[*DV}խ7mՃM 7)xd~yO1Q(N_ցQY6f Q?/:/*NjiZ*@jXt'lޟ\^ѲT37E;l,t^5Z~!}(i0 '~U~e ID]seTʴO]uM|5TSvYnAXs;I#-N;|E܂jM'͛]kP+Y6N˿ qO#L3<~ްN&4 `rYe8ҍݓ>05./r:o*%Wْewhն#B$"\\%gֱvywmjtN!E+wH:Nvr8 VHrdW˻>]UVwwc_Wjl,K%΋ʙfDػ|~ᬻ*,YB.@skT.k%(zL,~s>0n%]јP%\I EFM7>@ iJj i#a Y虛`SS$l9A|H6< ( 캊d~1&jDZݕ /p<txL6< = DϬzdoMc{79~6N )xm8qs~]gIFӹc]{[x/іnFǮ`pB#@S#vS}nvqLaW{#d |BdDZshđXW}r̻Q@pf.7SzhU\^Usf=|Vn~%ͦH/o|{ּ:.Qo|v.h8B?6xUTX\m<|%eM@ki $=QF9ןl, @frوq G[8zBwSXx^V@ߤ ~t E=-}|ሼ6>c\0 ZF|A9#dWy 8xw[}!{oul#-Y(Q+b?@ 'e1Imƃ(c8J '7M@)GI bYu)6<d:&ةRt1cJu- ۇǃĆ H}"ffQd/57bnrey)Z.$麿*;Y؁+BG-[ė6জG|ڭGT<ffC4)i,heCEpEW Z~ްNt(tD7 m݇0< EObo dyb۫jC#N6t% ؊T+O|zgC>Fc3I|Y1[3rY(>Lիxsݑ[M?x`Zr+mW !>?MUQ:1ت+bSIxZ7Vk;1k9<֛S4=[ T)w"+>U׆/UBX-~v=MM(|71q*` )9h<$x1kA.) @GѸӓK#VO~!Yo<1"jQsA9=A8Idn-9kfohҠ.#z}^c|z1czYӥ)D{cWa}FtªAi⥌CV;bO;s-N|lʭ%4ua_fQמj/Zmv`.S86wо̭3|gcYm~/_%Ln kgDO'T嚖T%mǀԑǟ᳼[?ޯ'?=>M}>HہS2DGr2~,K#o02 nM +=|}EO|\ޣo<]bF?dSJÑvۣMX&l܎O]mm^?ÛS,pȞ{Δf8mScO.vK$mH哒) XTzjMA}wgcWUE5UK: RFiTTx;Pn(T{AZǻf:u,t[a5iiCLwBSY2yyT9!PAW|PDxw6!ȝ633K Z=yڏ44k:[ DbZ*jY[k8G2U*Y!X4[ = hL9k(w~Q/Kdg& Ğ哱o2h;B#Exn  P?WPetswW 2C] ZY*:`"\@4PAeLk=FbK(bKdi pu1ErAk^|;SCʃWH_%Л]siVџnU`3Mݷy>G3:4M 'U+HU{C2T2XI)[aY\2\Йn `/? 5wP ܒJJUE! sI:NJ71^Ur)5$7I7&ԫNW ̴])(822UCbףcC ҷC(Yu*/ۅ(`K"ׂd T0.|d@yNʑF1ɭ? y̵ (j_4/ 4.n1`:D]!TyhBxANmM@PҍX]Y2pVej5Ltxn=_l0Qb1\zoRt;~2έÔд`j O/PiqT݃qyos7s.R{t׌^e`Tp Z{ClloҒK xlE 9n o4\ *^]r'd JKU~+HZS,C?G#–+WGt<P)G{Z'M!z 1WI,SEﺴ0~H}%0t~`Gx4F'(͵E0a˒c*a=1->.byS&4G;۱KdH\d5…q o UJ$hJ2Sp~dF\i޶RHnjHOnAH O_$*܍"d RrFjAkLD7>b_m;ĺk2$GD!@TPG@r#Z=n&f{ ]LoodPH\|2ldTάD8V6g.rq%-y.C (Ͼ2'L?BCq.];3cϵ!`#TBG[&2e)[lvGZ{͟]*F޴[ijLxáPUvg-!]Ju;33P 2*x{rn狍N":+xqʅ0FX,Jd Mvs\ xFY 8i W ,TAEGH[_U@jjbZ-dkhh{ft)9%&̂&TVI4Q ti<Ж6aRD9ӕE`xF5BYs0rjh'M k+T\61 ZnkfngaC{$R(6vx>Cۗ | <*$ WY7TP}5?(cجp%C Ysi`E6C6tqtrFJ E4BFQyto?jWZNr܇`c;z5FHsv>VV}xe>/sz5-% RoR Y,f4&cR' 4Y:u,ꪉPρ^+Iz5lnLhoAoߎc¤ex=Bx PfCQ<%Y"l03  Η*BAjG7qBx).daxpl7*% xi1Xʹ]CP7Մo s O&FB7$CRR@,Cj$ QUQŰ ,E6fT<-QsL:$%t$f^ѡR5Yd99"׌2sw/{k!8R[,ӽ|8QaM{Qgr-v}`3ɃXZ 7G+Bl3N]3"9^P4Lҥ ^l KvmNw<I $>wX\WDݡ p,qТzpzZD8Կ*^z7Dm3Ȑ ǂ(1$#pN]76SAE_p:EVl][ 6{U Yi7M<ņ>[뼸 G?S(~ Ra,wSyiZJZG84У~MK+? Ԩ9#2 ¥hHSZ2Do5T:յ%¦A](>c5eoku+IE0D/7~> fe:a);p?B~SJ:&QpHUŚMw}bLhAjOx (`xu`㸚EݺjBK?٬PBUqMxo\yب4 ~*E=OyP{zzi0-[e^'y6mb._p{M2vv'*oz:ߋh Z]'n+iAj jŃ g cPsYWU?9{#7 jR'kmU,z5ː/#iNxΏ:[eϘ=^Tx8Oq%>nn[bͺo++5U0oc^^0ڱ%m zHTFlY'/YcJK{y2m(TN+mw(7{zVЃZe2H=R轌n F.t@.AU3q ?ZdMw\.Q^|5:-w1j"}I vGZ6Y`DȢZX^+eI[^O?KR4|t;++C5w~+0sfժ!sʛr'jdF\yn۴pOkSm\np`0A#YO c7.|ZftU'&a봐h>jJ#0KO;xǾps_:?qt}QJԍm95e|AsUE8>*?w͹V4 Kj3 X( U4ywzO |=UFS-Tl0p]:T0nUk RM̥^RO_<ӼEFxg7;w=#Bb+yzcC3Ө.Ysynܾ/br 5H  w&`v NZF4/o!/HE Fi?*z/a[+$8;na]S?jDyH(s/o>5d9.=i5uY o o5G`Yu3elT1-zXo]2^s?_o8~d-iy(MopxX-iy VN #ݼ2h5k/X⦶ۏ!6Ep*շU>iΨ:5ɆU]DѧZ%gҿXXUcG厭DU: V(U!mu+He:>T<Ǭf jJ:/hd (j\vLṢnQabO~VD\'!1#KFZu!>oE06D4[\FNp\S1|8a;:JF=:}myTÕBoiថYOtA=E#6:,i YBv:-v6G&2N\։f&Ӣj!FX: .B 1EDI{RFvDPs"hk;`z9ytPd/ >MX9ǘNnxJlK"*w~^Nc2Ҳ 1'qIQg8׊I^J(>/PWu0h x]DsVZhShwbFiuݪ磞=OG PʰB)$5 eۗvSWh<4USJ Ri'_  W egLm# n݊^@K]&4c%fk-t8l1em|t l`"IhP;Ol-U j!VXl(̂(環` '%ߦ+B2Q .5 St] .S֓^ "lʱl&r,1JPSAN !j5>n|4"y rOuɥڏ ]rn׏s]-<9d_^JSm7[P/ZǺMj.:O> "xa6tmO'5\JYzGvB'SZFM;9z&+KS$I:=]yc:Ukt$롑;qK #ٟvܲW,uUg4ƤS6.2,!U%DP9% 1[`; ߰ڻ:-}W5o~!:nT}^~ Y?R"jИ?%Y6[KAơMXJ/ar=R0b~Czsw3-q80"ZP]"<vmv\[{R}` VN%=Sb aĊFzuaEvN&`k"NIԈY(mKf0\+>:ݤW*`c錺86+̭}*/Ke,t>ڣ,ءў#Ľ/q#Q[ˌ݈nc6au; 牔&L0YU,[XijJWCtnHQOp vy9٪oKQs;yLJXpR\Q4 r.wIeοr- ƞ(,y mDY'R|%U*G54U`a6!Yt'8.8[-AeQ4("# ߹KFYI?y/3+Z,VbҖW99Rrm7Ջ=(2NlV.KY@B6 2E2(r#tGܬm(&_1HUʡ242EԪ!d$ DT !M"YnD8 M"W A7Jk#EˍJaoC6j}9G~/KpJ@k3qTpOW=~zseh)NI,iZvbXcn]tw-9XBEf/{?-"]3V׵Z25O3gx?Tqsc\42L͗NWt>o {#wvivwUC *.@c##t>!;)'ޚuzֲ4W_&1g ?<=wX_+#@uc ?j槛ax>t'%k8Sǫ4f{e!ae{y&ec޼/Z4l0زI;AJb *9 d䄲]SZgݻ0h16&"{mkDXL}Q@DXt">tqAg H&⢈xOMޮtKH[ 3y~W_.Lb^ɥ n̉E$'#T.@R8c u) LLhtZr.Z՗ (w:3fS@:ti9o?z&pБU.cFPQ!ܜ|Q5i('cO؏@QdCAx:N;jeT]8A˾9UA FRAjل^H^@!qE\ ?=yUvDi2r; a`J\TƗæ('"mt%[q`eP s >u)=8㥺C)Ҥ/]isMb~D=VH MMw'_5B-AY'J<;hhP&l ck!'$E5"Πq#u#u#l=(18"D%ڒh@h 4 ~::=:/7;#Ҵ +qVψnvGyi'*0yҨ,^ϨXkjB l:DS\ۨRh4 r"2KEu3/̤27aиxwq 61߼}@{Dɧu=G(skI${X$J2 4ٜlR8US\pV AzmTԈRq/ўd_8fTO0 2R߄1l~A4u'dqw([v0$Eu3y4npQb+lT9W_%65D~Ĩ#H;X)laG4ý4'$ i԰Ǖ#ʼȃ){ߒra{ Pv#AG#ǩP#:Hg`<_P.!;[O Awĉ%u i;sկj[)&!23x (]W&I'Uҍ$žt x&дU~mirΡGhWaPoR qj') ܤ؛h4=I-ٖV.D pOT`^\$ $9Q@"Мسꋩ-e +M⍆P w IsnŊ-*]Wb_O\{°kw >`qJ6^M!G0N0)a"xc{Rþ=<[r {J0M\`AQ[$FdmVW$ԑЧ})h3HHQhE&Dwc]}̻:LE(E00+lECb= <>찦WRR;PusK j3xaPʜ{2o:ku>b R'!v T-7NJc9RVU{_kJj/+~ ʲr;.;_qVp=[(=޼lpԺ4p2pQտl<; rI+bQ@-lr̫7 W/+ $a2C8w?Ku33'ҒWJ`71gn> !J=Fpjٺ|rc^9$(5^a3 SGP KG3,4hG1 ERa R3F5AmmH#X-d!ڼC$k/R.jy,˻am7w`} #DھR0Q)@ 춹hu=Xq!l#}ayHc%%'{~1`J,g3IB|̎@sWR;wIK|J{pmvNoWVL OOFŴ&Yhd\R( ?mZ =Ubd3bf3F]V ۛm^elFiIfhNel*g ?m2 (\z$ZΩз4&A icB]xM=-ȉPw|[+RCb5[M<ZapRҾ $ʽNs/u4Pb0O V%=Zh%5PҖ(=eJ~,`X!;jĸpr1ݜ',ڱ\і$ǃҽ>N _CӰxТqw$η% 1C>L~f;dp8S9f6=pН̀\&Lm6_T_jȞ?.OX *MF]Wϒ1+m#[;?ALw%;[KPVL5jeŞf^u  1#@m} | զk-445ا}0})*r*$+(7 315t]=LfX*G[U.GMETgR#~@Ûj~ 3|&If,̎quTnGt8Whzl@q%mNTL+` C)Չ6g:׼=\Cӏ׏ ;{D2JO騎/aUg}i hH\]ZXRiya`kv(fR"HbIcCfFO AH~_x5_1 $$jbjݣ͞ze}MB2éqrzbYmxZ?+ ű]cX=p}cnX>a&>z'Cg]Kf7EʕEa`ϞI~,_i ٱGTư(' 2E,Vii5ʝ)ya*[3K}ȑV _,O*fJJQKGňrRZ.q)u4y0k W~Ï#tc9\-&)fx]ֽ6l 'tߞ].qlO8eizj %fn㊟60!Q0E(#FæƤK[v3> Rʲ-iPrLS1&lVnM81]n9vH*\[2f 4G'NUnpݔ()̌{Y{>oI?́H' dtSC=NQ|7վkt,G jϝuz8UP+~. l>=w}uEbbafF_0 TiCevfLgc Ŧf9wuXSVz[2^X} ?f04t7j hę <c랼Ԭ((> d ',j.Bt pt(ƸlΓxJ۔Y5&+NL!FWF+5+cx~C%tapaP35USiAW*5'#U38E.e3j`*~"&{ZMFjo\yƃt>WJ~1]1r1)ol1UT :apqnNWts85Hu!nqN\XY[DfG2D=8<坚*=]JaNZӝ4~ @n]$c_#8y45@#xZ@śێq=㴶Eu *eR*+T96 56YA&sbf t`@Oug 6"rd X2RXpy4Y1O; ]ݚ7RE"H2EWH-0V>`Y엯p@T<\T )L:_VHAEQ ֮ 'mϖ1lFfeV-+ÆaW)3#Q:3 )L켛۪QWj1Yiۚ,cNdނ:SXH =Enb@~|~ޞY%=WV'̠w™':zRԌZ=U$TSWQIRCj15"3:C) C'zz*דh ObW/T={}Ϡ88t(p5R;9PjF/Ғ= dM (uM;;2"c_-D h5WgVlIl?+Ȍ>Ɋ:cşR(~.X\F͙čXHr1J\_$Z rqIApnմ@JT1:lETv9t# ٟ}a .*buua2]=7Ҁ:[(L&Yz.I=#.'Z{2:AFTd.ԖTYM܉4Nؓ Gqs)h^UU!.𑾂lC"/`]p2цZN=C1(Bi4BY_esf*mK}N1/6"fщ 7g[UK*e{X Ne yd&Id7x>Sw䊏eՄ\5O$%AKcrErcd׽=Ԍw;Jo^ TY|iG2J,/]՚n4ROfF_M|Q^;/YVPYi|XG4FtŊTr=Vn3eVh#u QŦ6Yܝbm֬>gY*Me)(UKKQ#nTqo+x sX c=X'"47 HF5޴~ZB NNmz?`abY1bcُ2WV,a7f,tgK9Z ELx%o- #$ym3 o;0X/Ru|B͖%B9O_d9K@<Lk(B/EsМ!憠T}yƴoy d/@-|?T H#cX} (,qZ4N!e 8U<}6K/D{ Mu.$E'lukIVpIE#1#2 jVq´UXQZ]޽v4J]KHVA&m&i3=qr@ͷP۩C'`n6vBg)sOS ;[ `pCbkɁW6s$m,՚y9/Z6$[ ^CqY {~at]JyIXkI-P㶁2å4cjp^`Aj\2`Z,`c޹6L&hLhi}@_y'~KU3Ip;9ftn/f PѶ,ꬃ(s<sjf >e_'7re|CE*͝!Ņ`C)(~[׊8'JxȔ_P2C_ Ǣ(lXH@N=%D1+n7m2mwM$ oX I6xL\K:>tBPӞN Ӈ19F@'&jNVM2-z"gַUi|ۀ dLqHD6t-'"*X6 ?@Wc/]Y; mSW:*/JfC"vlћZZHVr"Mߦ}>\b_7ӛؐajQuTUqy<^W}nˬc8媘cCuL*Id ~| 7< |M/'` T: vφ\N89UX 4JEc3ͳHRz;CH1 m4vO:V2<ݠ\8}udhy?{hUUQ6} 7?"2↯ |Mfgn6dC),Vܹ U$7qWj7lϧ{0[6(sDQU l$0 +v: QvM5j"˴p6Cy-qj^IRIjփtU0:siM?0~T:S,Qb:/M(p2i*(T>>±cP3hʎW&tc,_7%> Tq'Ҍ!~u~6rUHVvm󬧅VXZ nK#n UJI L(@Gya#S|WUqd[{L4Y{'4OB-K%RJwɻM@/SFu3܉lh/l2HvOf,Aj %6xoIxq|uus՞RŸW $0?6YdSuDG;38E2?M xeXscסC-3z(&SO҇ Ǔohegr~&_0(wP,^,F,NOIX3ԅo{_f>sm[~LL숛6Wdn7bۥlar,؟3F8UZz_ Yl1S"?e%ߎ LD-B[v]\=lyG8}bxeyzm p+a[27fKS(kFxaPU a+ѫLpDb4 j䞘e|&Z:l{˚>M5}#j #姫\q,H&'[fzq3G^rRQj+gfhNӸ>ыV/L[g=VaY#_{,sJ۝̬òM;5)71GfzҔidܣ[#Ҕ\.9oϜ_Vs]&(ڲU\WXvxf+ h?^Irt m _i9_1OPW^.8]UȆyşi9t4y,N[|*TA_,<'D4嗓<0ŻԑծSVEἡ9&ҡMB):a,1znmqj pM\ G( fH7TRb懭82b&5/ITx<)D2-Uz.6:Wp^Ks:ч0]\t$cVq?f*-"Y )G3Q Jy[f3 0.G.=taofbdHswxMasiC%Gnj{ w> ;09F91 q3]La )r#-|В-)64|&VȰcDf)؇CLCR%6D։$VRE!bMxr a`Uj VKՋmcƝlO7A>͆!td0e= Omh6UYs;(\0FC`Aj6j=$W_V}bvnNsގk \gA2ZqR_h٤@im^ЛҒ{S3IY̓Vڡђz2Yk}9*[UP SqNpHmsʭ|潞uW<>ѥ"4'黒t[4lNy)OQ {Uɤ!>~#jkC37-6\v*U2Wvj]V9m顦xV+X6(vRco4|ݐN3]AMΩ[% +xwٸs,{티p=v]j/դb枘7L0Ԅ" H0lY$dgܖ @gM.YD# ޜA@?FlmQ%Yru8p%@t&>F`wx "[,X!{ˇm ~e4\y;ld`S\14/GPF@!la czRǰNns+ղPhY7b q5}RR^.xڑ7n ȵ 1IT#ݸc{OԢ9z ]4v0?qs4 Jip.=WN/sXm&:cxL{)5jsաeU@i kCEY_D0]Ȃ:K`vec4 5kGY;W8^}tʽMO~IE0tUObo)w*FjCuSԡ-dPY%$3'+mDqmDN5\L!b[pqb+[˜+wG>䈋aߓM%lu9˯XQ>d5?{̬An0`|.td\Cf)@uUxgQM αZ =xB8yxlek(ޣcu;B*ɡ&oҢƟFīA DiP|яI[$ԴiWCh_)0=&y xNJ_d(a[n.L~vPTj˯k{78ou4Y7k݂NG+N2S%mj[S)g IHU6Ձt=A&B[(CҚxm:" p߽GǯRl bZv0i<-c-,^faqTI<<9X8&qvۏڝ ywdh#*/*Áۅ4U)=ݏL9f9, tSgOG 2]ZH44P(0 yWw(̾>=+^-Hw6A w`O]y>^C7aJļ,ʪ gBϙ12L-$͹4h.R/Ŀ דuŔBM1moV`%GKyfF^YsƮ Ic59'{Y4qN@ʔض(v3?B.'&PKq݃v}py YTcDLh8d\vZ0c5pr_MϜۆRoT m CgHIXQz6v'!!xs1U^Mg(X0fgx˷Gt(GV $Zv{ݎw'h*^&nX%D5膏". X^DS 34}("u ]Ⱥ+<^VT !p Fbkz""N%|xH'Q67;gXa(]. q~`k%Q ]eڞj{}cb-jL BpyMOR@(/%@^ x1W=8kp=5G4ÿ^ÑjuσL Fa7VQqb".r+e;QNmg 0iXRc` z( 1xH \94Ft롛B4TxarשØrAqꜮU?z'M9~"*Hq5?K롣 WӪrJ4a" RkUˌF6O΄8j8˦ս>Wo|7SFiޡ\C^)jIcz! }bx,ܥn6Ǯ-y!kx=. K Iu;wh.lnleىLdžUYɲKIC1&*ԬmdV4nG;ȥo;B r9cȞOHtIQOP̈,f BmMwWۦ(`s9 .Ի%b`9tr3@c^I]؍FC>ƩradhRdTfr}kxbnak5fpГɚ$,_ \+~Oّi:7vCZ ЅȧqJ1 =? FXuϸme# VшH;Vn H p4X9F&]bmqRD^Cy &Amy7QH wwoQ@r,XFHеt:¿gweΡbKkhfOnd`{a3<7R~~XrMZmӖ<)(Qd"vf?2U8}%ȟTsb-\Xf t(8LF: ssGՂlۘ`fk7TJ}A|?4Ӈ߷NÉaw מUǑy8}- w>jK$̈́FM:iR!PR4ɭ6=sy~h;\= [c6/ti1a8H Ԝ61[eGe`yZtBn$MVءT6?&:E RLcRRwWuU~"bZvkY.b=W~mvel4R_maU)>s't(ҕ;ѻnW^n:F5Y}xpNQe+&UAh [kD*rL1IkM{58-y1Vq8p'Yk䕣!ncdBj 32uftRTL(&_E.t _4udfތ$7:HWN\xv91uydfuͯi|H&@oU+i|fBK1H?GW࠵펂ؚ[$ B2U|-jܵ}jEݐ=Da@A8hO[H/íh'.X5YHV)V~+=tشժG^eOZm$fTfJUģOG8<;OX MK&)06"DF-q[Z#icVPIOXe#Z^cSOЂ,j~5?lo sd%R5Ik?2`ỻmC RwDrwacR}.櫳E3Mzn;|}+bV;03^5v$c%$QyY\tە=Vb+{L=z\nwU Ot4[ܽK{uZ vEnF,j Nw9vOϟ /58Χ~vSrs_VAkjtr1Rbu`|gd"ͦ|SfL}c[-R]PQR$G8ii=dh8'y7*3l5AB?P~B NX1C%iWN9RQ!z'dJJ昄sgTܘ'66k^Tz\Zg:t~H_5SU4Jh:͋ SvM38ؙ*3P}gN:OQuSYb4e DXI9 9:(/i".#oic!ꐖ2C7k\ yeePn"W1@,:q0+hԳ&0Fmv1AVFͿ L1v[YZRK쮈yɃ,Z`;;F +'da?Cf'21Q/UԙS%甾E"k3>R=%W:BԺjwDFd++7@FӌĸA'adH!0VH8y@W[ Dޯ{FT X܍םC43n.GmjBHfsɵn tX⟌7Ľ"سiDJ6#Gv#ޑk$8vlJu6M=Uжo]w3M?IB8lV҅Kt5G} fk~xQGfVfyN`fwNѲ[|R)w]&qI@yZͲ[ܐ=m,{q9j0#1pZ^SURd2%դ-s_)X9[;Сt0u?FwY1OH= Xpa4Ee"'kP\ feRnD[{môb|ҽv]?\XL9mHgZez9,_dLק0C"i7 5N8NHgejO{ F)jfYB<'Aoh/bvs(SXQkJSnx3zf!iuPC69)x-*W  Bzް;*@m%DN(BWwj~5V\[̥K]E~u`n2*mjPW6)6WՋ.ی竢^#(-+fkyVaQ !.Oe77%"qcn}"TTb2.;}ޑsۍ9nKI!GZ\4S}RWK Bn-0i/Cth`=r-ћ*\N}G{(mV3 ZZ:棚}j_){8} %JHFw+b+u_5~x20"5(kùؘ6M27s(VbOX_ښkc5T,1̐gT>?8`y R#! @I9(j\ U{Sl+mƺNBPx4kDrQ(03(莐cA+]0ٜLܝeոض?A/|ۉg}T*a+ݢh-k'E((^ rvt(K #1j}ޫAFź˦9w26 3ߖxM{*jKUcJ s m 8P A Z0w{|G>5{>J'"V[GPPp$X$TAB%H21fګg9x@r$ ;9կ73p[no4d-&jBZɏDP1|/+Nnѷl-3%m7*ߝ]k΋8-*L#B2kkR d#HI4ؤ}/Ev<z%-s}98̘+$[~$R$,> AOhS2T,WZq-H9nP]'>E[,ԒSDuKuI6R.qˎ6[|0ămDUq$89L$(nc>-~GċXcgVʨlbm]w?)y8yBDϐ&$i6&:=7mzxxXmvƆYF3s繎ʶ `vi1γ~'/5Dk]|QuC͘69[bV*Z&?n;봗a[wn =)쫨f\1?r}(FKx~7?Tu'q 78Zv/?\;I fH2Gb͌,;m8[enB ˃1 iC>7fcg>Y񯫞0n]>P3~: _%^9_,V;7rM\>4~ [%(Տf&Ƴ=Yo'&cя܎]hoV%'En-e]9@G^~뵞 ] "#(ӴZ/Kf|&.Gx?SzמT6 w$ѨӂREu.ӱ[46+id+Y Qڼ 4*c8<8 * `^Tdz43=ny8aQ,nbn@["o" }? 1<l}Um8SMe?Y`[;=z%'0$Gj v6g ǀҺ]nt;1i1ܥ|@^D{ @=䉞JvcDrOZgX)S8>w~yk%. q`%|.?ˑȡکex-}_!c8"\XXżF(YDhV=/2x8P@^=^J`égQ݆^VjWewMMA xJ$7VqվËLҰ?xhDX;; ;fu)[E]LPCsP M ˾I)lV E6F6% jq%O_W왎rG4# g&2N5A@"b#&*YO,MɐA#sn._qt7o㌫b >ZWߒf$D`blTJӰdJF0mAJs*k8f"&̕7E`:?Cx v9țZӢmZF$BO#aXOx ֌pBb̢͚OĽxUfώ6J9 bt%X]!Ƭ*&kU;ܗ)0@M+.xOۆ{ocZp`j]U+q4.D\U4qR|ay-Cl%ά(  9C0\sS0АpЖCg+ d0佃`VңI ]QFy*ܿ>tR% H=;&vF E93Z`6g24'Np&aBtWޡ-;m) )ARãH5G} pWZ{G֛D>.:q都"g|䦭pLGvS&1+/:پXnLU1hk6[Rբ2B-;*liY'^\C{b7W6n%:ikÿCp9SvuCL$q`C6y&G: $Ljvb^3~7_|քBfw!үsX 5EAG[!!t#€Կ1(nI|Fffc}BlB*ͷ;%R܍i].3cQ'לv]TVX&gE8&~J khj5DX\G<5-fkyՌ)<!˽G; S( urysp|,6:~K}v Oq8-ZtD : P zx=tJit].:Xa*팩QH^K8Geķ7rk[ ӈ@kH7ɷŨRψN.<ྶذ\! $(c*wfNw_RۣifK$,/ն֑Q\D/hv"yhYD9UՇe X̙ wJe񕧂ҤǛD241WdtG$H0ewf4e܌Rlcq` 7S 9ɷ\PȥjHp]dMD:Qc]tS( ty{FTwTך?N'nGߝfh+z5;9-P!- C Yj Glp{>-OհX7(\Lp͗>.12'N\a_N)6:?g7 j 'h8zHG>_K@Ko 77.Ugy5~&|v5z'zvߣ7_4^nx!}⧖=@{O'0>7loo-eޮٻä1lF?SH8GG荽 7uo#w Odh>EgG{g'Oo&Uꝃw̧1zӒ=}7Z']K}>bӰdcؑ6Ppԍrr3#1}쿸 iH4n7˔ \v۱;)Ҡ:G*XIުF vxnա^{R!<1~ϓK؍A8jFxP mڀ EЧ7Ku\+xOmߕ' ׭%aĕK/0>¥Bb?YMO\%"Ad|W "QAA~&hF8s o/C%WɺhDk؂Y|8Xf$T0!tqu2!)>ij?91V' ! v1PCa8;o]c9yZ˳X4nRKФx UEB> C!6DM3ؠZNS}ִJaЛ XNꂾ+zB"I[6k}.;D{ 9lJk>.mYɮX,5VQO6Q, 8vlP] Hq'#ʼnmWxczd &Tx>қؔ*a{7+ ̄eIs+odV y5E|"kGFOuGe:]Jî4Et%ќlBv6eVEwmDqpeo SoV蜜prdR0ٽjE}6%'SڻԐ94.,u$ayR aI',jJƧ`g10RgjC:|@AߜHEx-$:0 EA ࣺ(6)HPbB@J׈7ڕ`4'h/'Gς / ,jgX9LQbc刋h*rxG9㚿3||MN&GWz>.ϯ7'F endstream endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <>stream HVo\G?3s~]ovR'ސ&96Dml'N8&NPTB|'*QJZ*-j}HI}sg9s;37oZ/eqoDĎݬ%*뗮߯bƥ\|t&WW.|5~AU4$Fw ח6~zp߹t{=~ Umm˷07nv>7VϣZ%>b? Ioɛ}kԌv=ؠ9w #~x =?Hgؽ'-<8'0St#t>M3*~Ax[!j^&( :H4A4>aaQ#I&C.ySD,Ey*`%*Sz|?:=^`E9jKL_tۍڞ8/]@zXYo=,J_"]MBB7E$ة-rO/[-".|Z[C:$1V;'h6k]ج.]8+Z,\FŅzg]WgaDZvf`_$N:yz |ZNt^LbBgڡfըwnnV7{<醹-vtuQچFQy펝:pw?A6dM1=!r٢ ?DOQȣC`@_tK(qI+ns\QRQH?rLت9l:5:mLU*3;㗌e$L㙋jv?^ {\J Lӻ'}h qFIUڊQ0\ouuÍMT3%7vdX:V CWCDjǠBӡX}hMan [. JU`'ǦEfoϸC\FzfnT4Df܂+5 U7f v !#u8ȓkJJU fu-%0F6B H$>e87@ƸYW*HOJHmnH ppHX N,/n .M>Ǎd;GB!T> l*B^M5kyP.0j?ö?8'ʼnl\l(Z&# E]Rem[diA'K#4J UԐEK`)Vp-klh?:1p4 /w5>Ek ,؟ (`߀QYD2aSdF26;iX1gF?]6eꮮx3x^ &v#6RBBķǜ9!8p儈r8"_!qC(y{:XqM}Bkg#ex)Je +#3e꒎|%0a]O8xoQUaq+Ue$U]Ny^Xѵ8HL nVH,qkD &02Dſ.~^~;=A 9gh-3@)97BdNt~3J wk"sc&AkVqt@6R܈0Y<]37#8=^#PcʫLpP&'7̅ˬ꒨]݉Vw^U4W縐[twKIr~Eן?b/"b@،n,o<̬ImRlr<.cPxWChIsQCo!U*kA %nqNOvkNHD|-qN( ݈DWb aD-k )蛜PVe*!]fD|@(RqcDSY9V_!ShP*q 0uLؐ0HqU'&c o~U߫qG[􈬈A1mG|y`0F'@Jslf,SP X#CfV5$V 󝼼]RGo+"IiS;5 A[iG f u)ii"uՐҰ`0:6P6fRII]Ar76Nקq=OXB#Ԛ~ާ^Qɛ.(ZKZύ+՜`8۹`z.OnHRpzjpYv7gՃfФHoؼ%9?gpѠ()|lp4$Rō bGp%#Ȱ{(<Ğ+jS#:# 6O+GjEF_A.HrP'J$'P)$tCsB8ihi!쏡&TB]qX/_RYe~3 ?0I(>7$D9k3H9#rQ1DE:KffV&C YBw,0Y)aDDH/2kޯXŖ>(#SSP迉]7k; /]ϼh]?@? }ٞyOG ?{Gy7Ӏ6. 6 6> 6ʚ+\%l1G%QrlȲ#HHJ>MUnzesڌD~s1ۥ8DxgD%ue13)STJ gJ% 8Y9kP'ԜLЅoӈФo4T'I!I]@BTGZR9wJf+8wa$ '1;R=[sj@R,ҕikМܔVYF>ajv.$KH@:n[ѮʑIEM'Li*B&]IhtUGj]5I~}ߥR{ͅheR~_0 .]?Z'65%B)emg Q8 bõX&c<ޅpN̋[\/v?bKvy9k+\ˑ&ڠ?Ek.#&=cÙ%Y(w)uZiې29qɲ+_^sY\>kpUJcᄚ3a&[!vēqV)gH}S +%"f>$ .3Hl`U}Msp]к \1(:tAo|߱q)KMfC/Zw^J<),) homl=xqXo?EapɁ;*fۖA\%$7me0G[X|<(RH0ٻM6ӎmU-͠Oz~3}4^l6*&,ꥇ0̦ȎxuPoA4;ᕋ2q-*ѣ"9HUHKE:[W>w602 FUh/}=8\^& BΑً=;JMmW 8%n@"@Al!6fQ]P_gl׻,W;oUWݻg6&mjhҍ?"a[j&]76]ݴ"( ̓>ZPR Q"X#m0EBMֿ=~sφd393Μ·pCc)MV.jmA"SuiZU5C:n[{`P_N:\CTڵj͞v:Zz$wӢZ7&4X!O$o ``8 % G6Ӕ5 f <.0-m}%@fl 8 ҂ATiI*qf m٢ssbws( Psql` k65z@WA84腙!.<  U-H L;;(p Tq۶ !pZBC#Lk%,ų K!5Mr}F;={m} \n F7djM@.8G,8 3x܃ڲk6l'\\m_Ja;`v!űQ4z߂=YټlI5li( 'J ]V߭/'5]4g}jFg[ 5"q/H:_gh[Ίy^@ 7ŗ<'yF8q"Ç5E|K7CwS*w3dl2|/"dAD|ƳXmy_|G>¿4(fOXǛ*Os<<>HS5Ay|"nzJ-xӣF*fE֮3 |cյ?+A[Nm _›ph q£PAԈ^'sgI:E71([Bp 30~? 5 endstream endobj 14 0 obj <> endobj 17 0 obj <>stream HdU PWfn]uPc8_끊'(H ( @.aTa CA@!X4*f7j]0jMbU7VXoJTT~hâņM_I8'3{( 4Η/3:ۿ5O UG$fcS7dNR'e祥$do]ޚNܚNѨ?ufz&Q=X= d EGL.'nIR/UtF]=u֔!E(j,E5&QT5ݟZJQQ4J:NQH֔Rws(+(oLaJpv7tL T* 0Fx) ~Om>t$ԩGN!g_) 7%~F߂` xՈUՕXJZlDžN]"*{ w7WYl<`R_sW]-V|5-$\|[J>߅>cBJh?\&aFp3=`b]Nroՙ: N0<#|P%ކq>oB n<4L]sȳx6).g!MR/`෇Vf6چm-GF<Njq~,\o@QyAT⾖j-}x t I~C2ַ@n5 Łx &8N~![l6 "La}g5<9qSZ47?GF9wfEJ@H\x3;tVUk-qi1Sg1;uVg1*Ekԫif\z}CRc豪YkcXJ3=ceaɴt6VXtfs:j DZSIT*z].3[3̊"&0uF#8A&WDZ]0XybҝNnfW@ F*C>AE0 ȇ-0"BRkh8<,!AlgIw8-1JɠO1E |nX| )qYwCXmAknqis8T%TWI{ l]%23J-H\%L\I30-];?T=[,Aoj =@_FV8+~=ۈ< O@Ұ &ɩ&&  FJds#ht?ۚՖz)C[ -4kMi# D(2vͫ>ޚ1Y i>'GV;SIǥi"}T/=߾)J 9[s(g -\3-&=1"rSѬ2،.NgC60aO ]*mɒ \^$W3Ǭߝg. --w6SsyxMR'Q endstream endobj 13 0 obj <> endobj 18 0 obj <>stream HlU{Tg1$>qfMี{*Rj((Z,*H0$`$ !Xyb ]mEV]n}tw'ТowHeAA 8G8,/3Ap0!q^2~fO?aҎS+ףLCOJQ\$'mHkj!\+"~}mbb(MY2ڵ4h97#xu)\++@ ˚Os@nEi죐H7D|Ya7<#JbܫSPVIF»w@yxd QUU;Ga |`:t5w1f[)a,{1s KGy5W]RL+Ժ^Xu[j $H;l%;.@5&Л2ƌt ZB,ˬl;X>>`Qڊa s[y|\oأR+`i?gDpGKW*b"2,vteh3A=/7(f*(ɬ42 O|s![]\`mh&O "LbF4c mLͮ(RÂOu\^ɵjcy ;ff- Y\friuv%>>;p ˜k3PT°f`g'ˏ7jݳ =ˀQc@~='~H-m-nHAtZxe,zn~S 5M؃b|8 RۑXߏ嬚zʘVYV_X~ԇGD%Qh2Cx'x ZSK[KWEA۲Y6$tt!( JlZm6Fz*Yo@9|x@:\͹T#$AV3mBqW'? zp! kqvsdpD= K{mfiנ˶S*Nja^ GUv̞(__;Mg7?9;ueKmf \k`L}7TCimdM)sa$#h<<w leJw1 42aa|`&Exüb锱dwb' ] sf QԱ#jߎo,ctN x%]f|^SW~ZBۊUԘ/i&^aһ Ӱ#F0uۿP|r!׹'rxUyĪ_hOAeulbrj܊ݧgmlgcᆭJ7g%]<5`VM{M(VK-UM2Әr͉w?SwKdW7A%KEƎ#LҒhKl#mm7s^ T,bC14ɖdvb{V-bZTӭyBMRdl`6l:V 1'/XK٢oFN'[̯)rMELlqA\k,gצt\Uρ? >epW_B3 BP!6g#,τVUQOse^mQA,$w6k)sGu|P,-w9xoPY Ξ1{ [2|oR#3?wt^goJ<֋gl|s_x$-wJ_^ +m#d:`]Q`J ̶J.&;z_jBGv鶎`;UiskZrB]R}'5JM'&kGe~y`A`#1퍇H}%Kv͐7K|ւrߋe85> endobj 8 0 obj [/Separation/LETT/DeviceCMYK<>] endobj 5 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 20 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000076270 00000 n 0000000000 00000 f 0000288106 00000 n 0000076321 00000 n 0000076635 00000 n 0000287945 00000 n 0000287833 00000 n 0000274334 00000 n 0000274977 00000 n 0000275515 00000 n 0000284874 00000 n 0000282177 00000 n 0000275859 00000 n 0000276109 00000 n 0000282482 00000 n 0000285198 00000 n 0000942514 00000 n trailer <<55365B9EC68E4F7AACFC8AAF0EC016DE>]>> startxref 942769 %%EOF